ID: 1026525512

View in Genome Browser
Species Human (GRCh38)
Location 7:71150109-71150131
Sequence ATGGTGAACAGGAATGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 683
Summary {0: 1, 1: 1, 2: 3, 3: 70, 4: 608}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026525512_1026525517 1 Left 1026525512 7:71150109-71150131 CCCTTCTCATTCCTGTTCACCAT 0: 1
1: 1
2: 3
3: 70
4: 608
Right 1026525517 7:71150133-71150155 CTGATCTGTGCCACAGACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026525512 Original CRISPR ATGGTGAACAGGAATGAGAA GGG (reversed) Intronic
900552851 1:3265176-3265198 GTGGTGGACAGGGATGAGACAGG + Intronic
901589660 1:10330109-10330131 AAGGAGAACAGGGATGAGAGAGG - Intronic
901622729 1:10601708-10601730 ATGCTGGCCAGGAAGGAGAAAGG - Intronic
903610309 1:24606625-24606647 AAGGTGACCAGGAAGGACAAAGG - Exonic
904233143 1:29094213-29094235 ATGGTGTACTGGTATGAAAATGG - Intronic
905406149 1:37733725-37733747 TTGGGGGAGAGGAATGAGAAGGG - Intronic
906027403 1:42684975-42684997 ATTTTTAACAGGAATGATAATGG + Intronic
906138160 1:43515084-43515106 TGGGAGAACGGGAATGAGAAGGG - Intergenic
906218343 1:44057864-44057886 ATGTTGTACAGGAGTGAGTAGGG - Intergenic
906867787 1:49441240-49441262 CTGGAGAACAGGCATGGGAATGG + Intronic
906879390 1:49574197-49574219 CTGGAGAACAGGCATAAGAATGG + Intronic
908011548 1:59783230-59783252 ATGGTGAACACCAATGAGCATGG + Intergenic
908737266 1:67289822-67289844 CTGGAGAACAGGCATGGGAATGG + Intergenic
908809898 1:67969832-67969854 ATGGTAAACAGGTATATGAAAGG - Intergenic
908937299 1:69391483-69391505 ATGGTGAATAGGAATGGTGAGGG + Intergenic
909576607 1:77183586-77183608 CTGGAGAACAGGCATGGGAATGG + Intronic
910633518 1:89381983-89382005 ATGATGAACAGTAATGACTAAGG - Intronic
910831456 1:91465983-91466005 CTGGAGAACAGGCATGGGAATGG - Intergenic
911043065 1:93607287-93607309 ATGGGGACCAGGAATGAGCATGG + Intronic
911102767 1:94107167-94107189 GAGGTTAACAGGGATGAGAAAGG - Intronic
912061229 1:105673618-105673640 ATACTAAACAGCAATGAGAATGG + Intergenic
912066730 1:105754323-105754345 CTGGAGAACAGGTATGAGAAAGG + Intergenic
912252133 1:108022080-108022102 CTGGAGAACAGGCATGGGAATGG - Intergenic
912866933 1:113266255-113266277 AAGGAGAACAGGAAGGAGAGTGG + Intergenic
912944123 1:114070449-114070471 CTGGAGAACAGGCATGAGAATGG - Intergenic
913185210 1:116364472-116364494 ATGGTGCAGTGGAAAGAGAAGGG + Intergenic
915026986 1:152840376-152840398 ATAGAGACCAGGAATGAGATGGG + Intergenic
915079915 1:153345081-153345103 ATGAGGAAAAGGGATGAGAAGGG + Intronic
915667965 1:157461924-157461946 CTGGAGAACAGGTATGGGAATGG - Intergenic
916349440 1:163832329-163832351 ATGGAGAACTAGAAAGAGAAAGG + Intergenic
917764405 1:178201119-178201141 CTGGAGAACAGGCATGGGAATGG + Intronic
918386362 1:184012016-184012038 ATCCTCAACAGGCATGAGAAAGG - Intronic
918814810 1:189168980-189169002 CTGGAGAACAGGCATGGGAATGG + Intergenic
919124949 1:193382415-193382437 TTGGAGAACAGGCATGGGAATGG - Intergenic
919241508 1:194922233-194922255 CTGGAGAACAGGCATGAGAATGG + Intergenic
919554737 1:199036819-199036841 ATGGAGAAAAGGAATAAGCAAGG - Intergenic
920081168 1:203373803-203373825 GTGGTGAAGAGGAAGGAGAGTGG - Intergenic
920197123 1:204236089-204236111 CTGGAGAACAGGCATGGGAATGG + Intronic
922034397 1:221834300-221834322 ATGGCAAACAGGAAGGAAAAAGG + Intergenic
922634571 1:227154237-227154259 CTGGTAATCAGAAATGAGAAGGG + Intronic
922806918 1:228395006-228395028 AACGTGAACAGGAAGGAGAAGGG - Exonic
924096937 1:240561950-240561972 AAGGTGAAAAGGAAAGAGTATGG - Intronic
924109680 1:240685767-240685789 AAGGTGAATAGACATGAGAAAGG + Intergenic
1062770782 10:98946-98968 CTGGAGAACAGGCATGGGAATGG - Intergenic
1062956734 10:1545436-1545458 AAGTAGAACAGAAATGAGAATGG + Intronic
1063215182 10:3918453-3918475 ATGGCCAACAGGTATGTGAAAGG - Intergenic
1063561538 10:7132776-7132798 ATGATGTAAAGGAAGGAGAATGG - Intergenic
1063718291 10:8552579-8552601 ATGGTGGACAGCAGAGAGAAGGG + Intergenic
1064517947 10:16170509-16170531 CTGGAGAACAGGCATGGGAATGG - Intergenic
1064545949 10:16450077-16450099 CTGGAGAACAGGCATGGGAATGG - Intronic
1065070752 10:22021628-22021650 AGGGAGCACAGGAATGAGAGGGG + Intergenic
1065189511 10:23196974-23196996 GGGGAGAACAGGAATGGGAATGG - Intergenic
1065217381 10:23462212-23462234 CTAGTGGACAGGAAAGAGAAAGG + Intergenic
1065733842 10:28733243-28733265 ATGGTGCCCAGGAATAAGACAGG + Intergenic
1067062745 10:43086325-43086347 ATGTTGAACAGGGATGAGAAGGG + Intronic
1067332852 10:45337946-45337968 CTGGAGAACAGGCATGAGAATGG + Intergenic
1068225645 10:54103877-54103899 CTGGAGAACAGGCATGGGAATGG - Intronic
1068837539 10:61570870-61570892 CTGGAGAACAGGCATGGGAATGG - Intergenic
1070111519 10:73491485-73491507 ATGGTTAACAGTAATGAGAGTGG + Intronic
1070494825 10:77011915-77011937 TTGGGGAATAGGAATGAGAAAGG + Intronic
1071320071 10:84446065-84446087 ATAATGAAAAGAAATGAGAAAGG - Intronic
1071388643 10:85147611-85147633 ATGCAGAAAAGGAAAGAGAAAGG - Intergenic
1071693001 10:87842453-87842475 ATGGTGAACAGGGAAGCAAAAGG + Intergenic
1071937404 10:90547049-90547071 CTGGAGAACAGGCATGGGAATGG + Intergenic
1071943076 10:90610052-90610074 CTGGAGAACAGGCATGGGAATGG - Intergenic
1071976537 10:90961588-90961610 ATGTTGAGCTGGAATCAGAAGGG + Intergenic
1071983899 10:91031675-91031697 CTGGAGCACAGGAATGAGCATGG - Intergenic
1072487189 10:95866799-95866821 ATGGCAAACAGGAGAGAGAAAGG - Exonic
1073388831 10:103154487-103154509 ATGGTGTAATGGAAAGAGAATGG + Intronic
1073557033 10:104463631-104463653 CTGGAGAACAGGCATGGGAATGG + Intergenic
1073802370 10:107056169-107056191 AATGTGCTCAGGAATGAGAAAGG + Intronic
1074224488 10:111470546-111470568 AGGCTGAACACTAATGAGAATGG + Intergenic
1074584665 10:114755484-114755506 ATGAAGCACAGGAATGAGTAAGG - Intergenic
1075414122 10:122249895-122249917 ATGTTGAAAAGGAATGAAAATGG - Intronic
1076927718 10:133501503-133501525 CTGGAGAACAGGCATGGGAATGG - Intergenic
1077672522 11:4168648-4168670 ATGGGGGCCAGGAAGGAGAAGGG - Intergenic
1077876929 11:6317040-6317062 ATGGAAAACAGGAATGGCAAGGG - Intergenic
1078664746 11:13315270-13315292 AGGGTGAACAGGCATGAGCTAGG - Intronic
1079281258 11:19089299-19089321 ATGGTGAGCCGGAATGGAAAAGG - Intergenic
1079567855 11:21904618-21904640 ATGGAGAAAGGGAAGGAGAATGG + Intergenic
1080765962 11:35296957-35296979 ATGGTGAATAAGACAGAGAAAGG - Intronic
1081072492 11:38628821-38628843 CTGGAGAGCAGGCATGAGAATGG + Intergenic
1081608734 11:44545561-44545583 CTGGAGAACAGGCATGGGAATGG + Intergenic
1084965222 11:72741123-72741145 ATGGTAAACAGGAAGGAGTTGGG - Intronic
1085249187 11:75130945-75130967 GTGGAGAACAGGTGTGAGAATGG + Intronic
1085423433 11:76382605-76382627 ATGGAGAACAGCAAGGAAAATGG - Intronic
1085566886 11:77521888-77521910 ATGGTTCACAGGAATAAGCAGGG + Intronic
1085747276 11:79125952-79125974 CTGGAGAACAGGCATGGGAACGG + Intronic
1085839780 11:79998352-79998374 CTGAGGATCAGGAATGAGAATGG + Intergenic
1086077793 11:82872942-82872964 GTGGTGAACAAGAGAGAGAATGG + Intronic
1086213896 11:84353944-84353966 ATGGAGGAGAGGAATGAGAGTGG - Intronic
1086348603 11:85922731-85922753 ATGGAGAAGAGTGATGAGAAGGG - Intergenic
1086752573 11:90516034-90516056 ATGTTGAAAATGTATGAGAAAGG - Intergenic
1086833828 11:91598102-91598124 CTGGAGAACAGGCATGGGAATGG + Intergenic
1087434932 11:98102632-98102654 ATGGTGACCAGGGGCGAGAAGGG + Intergenic
1088264849 11:107979259-107979281 GTGGAGAACAGGCATGGGAATGG + Intergenic
1088345984 11:108825611-108825633 TAGGTGAACATGAATGAGAATGG - Intronic
1088480590 11:110293266-110293288 ATGGAAAACAGGACTGGGAAAGG + Intronic
1089094394 11:115906654-115906676 CTGTGGAACAGGGATGAGAAGGG + Intergenic
1089112365 11:116066979-116067001 CCGCAGAACAGGAATGAGAAGGG + Intergenic
1090510632 11:127371065-127371087 ATGGAGAAGAGAGATGAGAAAGG - Intergenic
1093032201 12:14298500-14298522 CTGGAGAACAGGCATGGGAATGG - Intergenic
1095603784 12:44043810-44043832 CTGGAGAACAGGCATGGGAATGG + Intronic
1095844767 12:46732776-46732798 CTGGAGAACAGGCATGGGAATGG - Intergenic
1096009692 12:48202451-48202473 ATGGTGTACAGGAGGGAGAAAGG + Exonic
1096457790 12:51801717-51801739 CTGGAGAACAGGTATGGGAATGG - Intronic
1098581889 12:72109770-72109792 TTGGTGAACTGGAATGGGATTGG + Intronic
1098660252 12:73084390-73084412 ATAGTTGAAAGGAATGAGAAAGG + Intergenic
1098715751 12:73827162-73827184 CTGGAGAACAGGCATGGGAATGG + Intergenic
1098832201 12:75376322-75376344 CTGGAGAACAGGTATGGGAATGG - Intronic
1099365642 12:81763167-81763189 CTGGAGAACAGGCATGGGAATGG + Intergenic
1100097484 12:91059477-91059499 ATGGTGAAGAGGAAATAGATTGG - Intergenic
1100367871 12:93937957-93937979 AGGGTGAGCAGGAAAGAGCAGGG - Intergenic
1100900633 12:99236697-99236719 ATGTTGAATAGGAATAAGGAGGG + Intronic
1101263823 12:103063820-103063842 CTGGAGAACAGGCATGGGAATGG + Intergenic
1101542781 12:105680363-105680385 CTGGAGAACAGGCATGGGAATGG + Intergenic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1103072622 12:117957437-117957459 ATGGTGGCCAGGAAGGAGGATGG - Intronic
1103396207 12:120609160-120609182 CTGGAGAACAGGCATGGGAATGG + Intergenic
1103733572 12:123044220-123044242 GAGGTGACCAGGAGTGAGAAAGG - Intronic
1104125401 12:125841301-125841323 CTGGTAAACAGGAATGAGAGAGG + Intergenic
1106149359 13:27083501-27083523 CTGGGGAACTGTAATGAGAAAGG - Intronic
1106300968 13:28465174-28465196 ATGGTAGGCAGGAATGAGGAAGG - Intronic
1107340586 13:39400892-39400914 GTAGTGAAAAGGAATGATAAAGG - Intronic
1107424704 13:40281485-40281507 CTGGAGAACAGGCATGGGAATGG - Intergenic
1107490173 13:40874054-40874076 CTGGAGAACAGGCATGGGAATGG + Intergenic
1107614683 13:42153094-42153116 AAAGTGAACAGTAATGAGCAAGG - Intronic
1107983871 13:45758258-45758280 CTGGAGAACAGGCATGGGAATGG - Intergenic
1108080837 13:46733337-46733359 ATGGTAAACAGCACTGAAAATGG - Intronic
1109471158 13:62805929-62805951 ATGGTTGACGGGAATGAAAATGG + Intergenic
1109515986 13:63443011-63443033 CTGGAGAACATGCATGAGAATGG + Intergenic
1109941751 13:69376868-69376890 ACGGTGAATACGAATGAGACAGG + Intergenic
1109951310 13:69504450-69504472 CTGGAGAACAGGCATGGGAATGG - Intergenic
1111429347 13:88131956-88131978 ATTTTGAATAGGAATGGGAATGG - Intergenic
1111576043 13:90155056-90155078 CTGGAGAACAGGCATGGGAATGG - Intergenic
1112250231 13:97772508-97772530 CTGGAGAACAGGCATGGGAATGG - Intergenic
1113591313 13:111503261-111503283 ATGGAGTGCTGGAATGAGAAGGG - Intergenic
1114211487 14:20619337-20619359 ATGATCAACAGGAATGGAAAGGG - Intergenic
1114781291 14:25540955-25540977 ATGCTGAAAAGGAGTGAGGATGG + Intergenic
1115172276 14:30522915-30522937 TTGGTCAAGAGGAGTGAGAATGG + Intergenic
1115546499 14:34469180-34469202 GTCATAAACAGGAATGAGAAAGG - Intergenic
1116058616 14:39894648-39894670 CTGGAGAACAGGCATGGGAATGG + Intergenic
1116081021 14:40172400-40172422 TTGAGGAATAGGAATGAGAAAGG - Intergenic
1116158686 14:41238964-41238986 CTGGAGAACAGGCATGGGAATGG - Intergenic
1116386234 14:44333941-44333963 GAGGTGAACAGGAAAGAGAGAGG + Intergenic
1116414780 14:44667021-44667043 CTGGAGAAGAGGCATGAGAATGG + Intergenic
1116650920 14:47591886-47591908 ATGTTGAATAGGAGTGAGAGAGG - Intronic
1117001281 14:51374002-51374024 CTGGAGAACAGGAATGGGAATGG + Intergenic
1117216525 14:53557816-53557838 CTGGAGAACAGGCATGGGAATGG + Intergenic
1118118571 14:62809856-62809878 TTGGTTCACAGGAATGAGCAGGG - Intronic
1118487623 14:66228808-66228830 ATGGTTACCAGGAATGAACAAGG + Intergenic
1119904273 14:78287222-78287244 ATTGTGAAGAGGAAGTAGAAGGG + Intronic
1120556295 14:85932731-85932753 CTGGAGAACAGGCATGGGAATGG - Intergenic
1120691858 14:87601591-87601613 AAGGTGTAATGGAATGAGAATGG - Intergenic
1121371069 14:93359002-93359024 CTGGAGAACAGGCATGGGAATGG + Intronic
1121501639 14:94442772-94442794 ATGGTGGACATGAGTGAGAAGGG - Exonic
1121967089 14:98320374-98320396 ATGGTGAAATGGAATCATAAGGG - Intergenic
1122262960 14:100533656-100533678 ATGTGGAGCAGGAATGAAAAAGG + Intergenic
1123504609 15:20928062-20928084 TTGGTGAACAAGAAGGAAAATGG + Intergenic
1123561858 15:21501763-21501785 TTGGTGAACAAGAAGGAAAATGG + Intergenic
1123598100 15:21939044-21939066 TTGGTGAACAAGAAGGAAAATGG + Intergenic
1125273415 15:37965635-37965657 ATGGCAAACAGGCATGTGAAAGG + Intronic
1125413427 15:39428567-39428589 ATGGTGAAGTGGAATGATAATGG - Intergenic
1127546306 15:59996951-59996973 AAGGTTAGCGGGAATGAGAAGGG + Intergenic
1128867414 15:71125095-71125117 AAGGTGAAGAGGAAGGGGAAAGG + Intronic
1129961692 15:79692349-79692371 CTGGAGAACAGGCATGGGAATGG - Intergenic
1130690286 15:86076347-86076369 ATGTTGAATAGGAAAGAGCAAGG + Intergenic
1131059726 15:89397299-89397321 ATGGGGAACAGGGCTGTGAATGG + Intergenic
1131442547 15:92469871-92469893 ATGGTGAGGAAGACTGAGAAAGG - Intergenic
1131590572 15:93743641-93743663 ATGGTGAATAGAAATTAGAGAGG - Intergenic
1202970201 15_KI270727v1_random:228889-228911 TTGGTGAACAAGAAGGAAAATGG + Intergenic
1133084069 16:3348193-3348215 ACAGTGCAGAGGAATGAGAATGG + Intergenic
1134176367 16:12009944-12009966 ATTATGAACAGGAATGCTAACGG + Intronic
1134413210 16:14020719-14020741 ATTGGCAACAGGAAGGAGAATGG - Intergenic
1134416150 16:14045042-14045064 ATGGTGACGAGAAATGAGACAGG - Intergenic
1134439409 16:14288892-14288914 ATGGTGGAGATGGATGAGAATGG - Intergenic
1135945415 16:26860625-26860647 GTGGTCAACAGGAATGAGGGAGG + Intergenic
1136369864 16:29829696-29829718 AGGGTGGAAAGGAAGGAGAAGGG - Intronic
1138124255 16:54425899-54425921 ATGGTGGACATGATTGAGATGGG + Intergenic
1138719688 16:59065069-59065091 ATGATGAGCAGGAAAGGGAAAGG + Intergenic
1138868098 16:60848490-60848512 CTGGAGAACAGGCATGGGAATGG + Intergenic
1139088203 16:63614690-63614712 ATAGGGAACTGGAAAGAGAAAGG - Intergenic
1139132454 16:64162773-64162795 ATTGGGATCAGGAAGGAGAAAGG - Intergenic
1140512658 16:75519290-75519312 ATTGTGAAAAGGAATAAGCAAGG + Intergenic
1140597713 16:76435930-76435952 CTGGAGAACAGGGATGGGAATGG - Intronic
1140886354 16:79247306-79247328 ATGGAGAACAGAAATGAATATGG + Intergenic
1142118533 16:88374153-88374175 AGGGTGGACAGAAATGAGTAAGG + Intergenic
1143138294 17:4724882-4724904 ATTGAGAACAGGATTGTGAATGG - Intergenic
1143213918 17:5209974-5209996 ATGGGGAACAGGAAAGAAAAGGG - Exonic
1143762754 17:9116812-9116834 AAGGTAGACAGGAAGGAGAAAGG + Intronic
1144000247 17:11047538-11047560 ATGGTTGCCAGGAATTAGAAGGG + Intergenic
1144124709 17:12192309-12192331 AAGGAGAACAGGAATAATAAAGG - Intergenic
1144956867 17:19023073-19023095 GTGGTGAACAGGGAGGAGGATGG + Intronic
1145257714 17:21336419-21336441 AGACTGAACAGAAATGAGAAGGG + Intergenic
1145318923 17:21751604-21751626 AGACTGAACAGAAATGAGAAGGG - Intergenic
1145981716 17:29016517-29016539 ATAATGAACAGGCATGAGGAGGG - Intronic
1146220735 17:31017463-31017485 ATGGGAATCAGGAATGAGAAAGG - Intergenic
1146758534 17:35454867-35454889 CTGGAGAACAGGCATGGGAATGG + Intergenic
1146836201 17:36112882-36112904 CTGGAGAACAGGCATGGGAATGG + Intergenic
1146886276 17:36473089-36473111 ATGGAGGGCAGGAATGAGACTGG + Intergenic
1147036357 17:37684523-37684545 ATGTGAAACAGGAATGATAATGG - Intergenic
1147201667 17:38806363-38806385 AAGGTGAACAGGAGAGAGACAGG - Exonic
1148164536 17:45473960-45473982 AGGGAGAACAGGAATGGGAAAGG + Intronic
1149281578 17:55111080-55111102 ATAGTGAAGAGGAAGGAAAATGG + Intronic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1150367039 17:64597899-64597921 ATGGGAATCAGGAATGAGAATGG + Intronic
1150395757 17:64820614-64820636 AGGGAGAACAGGAATGGGAAAGG + Intergenic
1150427281 17:65086715-65086737 AGGGAGAACAGGAAGGGGAAGGG - Intergenic
1153131568 18:1859980-1860002 CTGGAGAACAGGCATGGGAATGG - Intergenic
1153210503 18:2758219-2758241 AAGGAAAACAGGAAAGAGAAGGG - Intronic
1153241764 18:3037585-3037607 AATGTAAACAGGAAGGAGAAAGG - Intergenic
1153394329 18:4601206-4601228 ATTTTCATCAGGAATGAGAAGGG + Intergenic
1153726240 18:7958440-7958462 ATGGTGGAAAGAACTGAGAAGGG + Intronic
1153823152 18:8849663-8849685 ATAGGAAACATGAATGAGAAAGG - Intergenic
1154166864 18:12022058-12022080 ATGCTGAAGAGTAATTAGAATGG - Intronic
1154505899 18:15040574-15040596 ATGGAGAACAGGAATGGGAATGG + Intergenic
1155573544 18:27220917-27220939 CTGGAGAACAGGCATGGGAATGG + Intergenic
1156192345 18:34734003-34734025 CTGGAGAACAGGCATGGGAATGG - Intronic
1156615488 18:38778725-38778747 ATTGTGAAAAAGAATGAGCATGG + Intergenic
1156988585 18:43379110-43379132 ATGGTAAACAGGAATTAGGAAGG - Intergenic
1157732249 18:50014256-50014278 ATGGAGAAAATGGATGAGAAAGG + Intronic
1157909512 18:51602291-51602313 TTGGAGAACAGGCATGAGAAGGG - Intergenic
1158525627 18:58210195-58210217 ATAGATAATAGGAATGAGAAAGG + Intronic
1158751631 18:60268156-60268178 ATGGTGAAAAGGAATAATTAGGG - Intergenic
1158938021 18:62383081-62383103 GTGGTAAACAGGAATGCCAACGG + Intronic
1159067877 18:63589798-63589820 CTGGGGAAAAGGACTGAGAAAGG + Intronic
1159559386 18:69977453-69977475 CTGGAGAACAGGCATGGGAATGG - Intergenic
1159561396 18:69999040-69999062 ATGGACATCAGGAAGGAGAAAGG - Intergenic
1159589155 18:70313182-70313204 ATGATGAAAAGGAAGAAGAAAGG - Intronic
1159624775 18:70679892-70679914 AATTTGAACAGAAATGAGAAAGG + Intergenic
1159866235 18:73708394-73708416 CTGGCAAACAGGGATGAGAATGG + Intergenic
1162467747 19:10852691-10852713 ATGGTGAACAAGGAGGAAAATGG + Intronic
1164594302 19:29523868-29523890 AGGGTGAGCAGGAAGCAGAAAGG + Intergenic
1164833230 19:31339243-31339265 AAAGAGAAAAGGAATGAGAAAGG + Intronic
1164912869 19:32026649-32026671 ATGGGCAACAGGAAAGAGCAAGG - Intergenic
1164960288 19:32422478-32422500 ATGTTGGACAGGACTGAGAGAGG + Intronic
1165545229 19:36529496-36529518 TTGGAGGACAGAAATGAGAAGGG - Intergenic
1166928887 19:46289090-46289112 AATGTGAACAGGAATGCCAAGGG + Intergenic
1167322753 19:48806596-48806618 ATGGTGGAATGGAATGACAAGGG - Exonic
1168332578 19:55578857-55578879 AGGGCGAACAGGAAGGGGAAGGG - Exonic
925460426 2:4058183-4058205 CTGGAGAACAGGCATGGGAATGG + Intergenic
925488003 2:4357764-4357786 ATGGGGAGCAGGAAAGAGCAAGG - Intergenic
925869932 2:8261302-8261324 GTGGTGAGATGGAATGAGAAAGG + Intergenic
926281889 2:11455897-11455919 ATAGGGAACAGGAAGGCGAATGG + Intronic
926603986 2:14878028-14878050 ATGGTGAACTGGGATGAAATGGG - Intergenic
926893104 2:17655227-17655249 ATGATGAAAATGAATGAGGATGG + Exonic
928248881 2:29657181-29657203 AAGGTGGACAAGAGTGAGAAGGG + Intronic
928478333 2:31654213-31654235 AGGATGAACAGGACTGAGATTGG + Intergenic
928667444 2:33564088-33564110 ATGGAGAAAAGAAAGGAGAAAGG - Exonic
929791103 2:45023747-45023769 ATTATGAACAGTTATGAGAAAGG - Intergenic
929988470 2:46762845-46762867 ATGAAGAAAATGAATGAGAATGG - Exonic
930086273 2:47499547-47499569 ATGGTGTAGTGAAATGAGAAAGG + Intronic
930532362 2:52605771-52605793 ATGGTGAGAGGGAATGAGAATGG - Intergenic
930620202 2:53635599-53635621 ATTGTAAACAGGAATCATAATGG - Intronic
932388572 2:71362535-71362557 ATGATGAAAAGGAATTATAAAGG - Intronic
932445027 2:71775226-71775248 ATGGTGAATAGGAACAAAAATGG - Intergenic
932870778 2:75395684-75395706 CTGGAGAACAGGCATGGGAATGG - Intergenic
933002700 2:76945917-76945939 GTGAAGAACAAGAATGAGAAGGG - Intronic
935509264 2:103950772-103950794 ATGGTGAACAACAAATAGAAAGG - Intergenic
935662738 2:105483708-105483730 ATTGTGAGCCGGAATGAAAAGGG + Intergenic
936941090 2:117884954-117884976 ATGTTGAAAAGAAATGAGACTGG + Intergenic
937555655 2:123152191-123152213 ATGATGAACTGGAAAAAGAAGGG + Intergenic
937928780 2:127188605-127188627 ATAGTGAATAGTAATGAAAAAGG + Intronic
938390273 2:130899456-130899478 ATGATGAGCAGGACTGGGAAGGG + Intronic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
939068791 2:137515566-137515588 CTGGAGAACAGGAATGGGAATGG + Intronic
939213524 2:139209622-139209644 CTGGAGAACAGGCATGGGAATGG + Intergenic
939751247 2:146049814-146049836 ATGGTAAACAGGTATATGAAAGG - Intergenic
940171624 2:150835016-150835038 CTGGAGAACAGGCATGGGAAAGG - Intergenic
940606215 2:155926654-155926676 CTGGAGAACAGGCATGGGAATGG - Intergenic
941241710 2:163046629-163046651 ATGTTGAAAAGAAGTGAGAAAGG - Intergenic
941330972 2:164176872-164176894 CTGGAGAACAGGCATGGGAATGG - Intergenic
941422274 2:165297403-165297425 ATGGTCAAAATTAATGAGAAAGG - Intronic
941972122 2:171362264-171362286 ATGGAGAACAGGAAGGAAAGGGG + Intronic
942173341 2:173308379-173308401 ATGGGGATCTGGAAAGAGAATGG - Intergenic
942275105 2:174315673-174315695 CTAGTGAGCAGGAAGGAGAAAGG - Intergenic
942375886 2:175337064-175337086 ATGTTGAATAGGAGTGAAAATGG + Intergenic
942391342 2:175496724-175496746 ATGGCAAACAGGCATGTGAAAGG - Intergenic
943173213 2:184431688-184431710 ATGTAGAAGAGGAATCAGAATGG + Intergenic
943307678 2:186285283-186285305 AAGGTGAACAAGAATGTGGAAGG - Intergenic
944033745 2:195268307-195268329 TTGGTGAACAGGAAAGTGACAGG - Intergenic
944472535 2:200069833-200069855 ATGTTGAAGAGAAATGAGAATGG - Intergenic
944663790 2:201942282-201942304 ATGGTGAAGAGGAAAAAGATTGG + Intergenic
945011650 2:205470268-205470290 ACTTTGAAGAGGAATGAGAAAGG - Intronic
945146427 2:206743043-206743065 CTGGAGAACAGGTATGGGAATGG + Intronic
945256811 2:207810049-207810071 ATGTGGAGCAGGAATGAGAATGG + Intergenic
945427430 2:209723787-209723809 ATGTGGAACAGCAGTGAGAAAGG - Intronic
945726111 2:213473762-213473784 CTGGAGAACAGGCATGGGAATGG - Intronic
946387970 2:219397222-219397244 ATGTGGAACAGGAAAGAGACGGG - Intronic
946555116 2:220847831-220847853 ATGATGGAGAGGAATGAGAAGGG + Intergenic
946559304 2:220894976-220894998 ATGGTGAAAAGGGAGGAGAGTGG - Intergenic
946807504 2:223485880-223485902 ATGGTGGAAGGGAAGGAGAAAGG - Intergenic
947061141 2:226167475-226167497 AGGGTGATCAGGGATGAGACTGG - Intergenic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
947476476 2:230452976-230452998 ATGTTGAATAGAAGTGAGAATGG + Intronic
948752639 2:240141372-240141394 AGGGTGACCAGGAATGACAGGGG - Intronic
1168862414 20:1055287-1055309 ATGGTGACAGGGACTGAGAAAGG - Intergenic
1169173145 20:3483024-3483046 ACGGTGAAGAGGATTAAGAAGGG - Intronic
1172292132 20:33784120-33784142 ATGGGGAAGAGGAGGGAGAAGGG - Intronic
1174541507 20:51293288-51293310 ATGATGATCAGGATTGAGGATGG - Intergenic
1174870974 20:54181796-54181818 ATGGAGGACAGGGAAGAGAAGGG + Intergenic
1174964395 20:55195063-55195085 AAGGTGAAAAGCAATGACAATGG - Intergenic
1175301105 20:57943373-57943395 CTGGTGAACAGGAAGAGGAAGGG - Intergenic
1176070280 20:63222626-63222648 AGGTGGGACAGGAATGAGAATGG + Intergenic
1176791963 21:13328452-13328474 ATGGTGAACAGGAATGGGAATGG - Intergenic
1176997858 21:15577933-15577955 CTGGAGAACAGGCATGAGAATGG + Intergenic
1177736508 21:25097498-25097520 ATTCTTAACAGGAATAAGAACGG + Intergenic
1177906262 21:26974465-26974487 AAGTTGAACAGAGATGAGAAAGG + Intergenic
1177991355 21:28039455-28039477 ATGGAGAACAGGAATGGGAATGG - Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178021665 21:28415281-28415303 GTGGTGGAGAGGAAAGAGAATGG + Intergenic
1178168070 21:30005488-30005510 ATAATGGAAAGGAATGAGAATGG + Intergenic
1178478865 21:32961935-32961957 ATAGTGTACAAGAACGAGAAAGG - Intergenic
1178536088 21:33411454-33411476 ATGGTGAACAGGCGTGTGGAGGG + Intronic
1178607194 21:34049142-34049164 ATGTTTAATAGGAATGAGAGTGG - Intergenic
1178764124 21:35433227-35433249 CTGGAGAACAGGCATGGGAATGG - Intronic
1181864829 22:25846736-25846758 AGGCTGAGCAGAAATGAGAATGG + Intronic
1181995927 22:26882471-26882493 ATGGAGAAAGGGAGTGAGAAGGG - Intergenic
1182247335 22:28969587-28969609 AGGGTGAACAAGAAAGAGACTGG + Intronic
1182965669 22:34519099-34519121 CTGGAGAACAGGTATGGGAATGG - Intergenic
1184603868 22:45560688-45560710 CTGGAGAACGGGCATGAGAATGG - Intronic
949638485 3:6010225-6010247 CTGGAGAACAGGCATGGGAATGG + Intergenic
949798959 3:7882154-7882176 ATGTTGAACAGAAGTGAGGAGGG - Intergenic
951051548 3:18099362-18099384 AACAGGAACAGGAATGAGAAGGG - Intronic
951384242 3:22025462-22025484 CTGGAGAACAGGCATGGGAATGG + Intronic
951919894 3:27842746-27842768 ATGGAGAACAGGAAAGCAAAGGG + Intergenic
952069291 3:29614313-29614335 AGGGTGGACAGGAATTAGAAAGG + Intronic
953012212 3:39037790-39037812 ATGGGGGATAGAAATGAGAATGG + Intergenic
954053814 3:48005403-48005425 CTGGAGAACAGGCATGGGAATGG + Intronic
954952064 3:54484270-54484292 ATGGAGAATAGGAAGGAGAATGG - Intronic
955555696 3:60134939-60134961 ATGGAGTAGAGGAAAGAGAAAGG + Intronic
956261334 3:67345586-67345608 ATGTTGAATAGAAGTGAGAATGG - Intergenic
956509347 3:69978068-69978090 CTGGAGAACAGGCATGGGAATGG + Intergenic
956695087 3:71911902-71911924 ATGGTGAAAAGAAATAAGGATGG + Intergenic
956995463 3:74822453-74822475 ATGGAGACCAAAAATGAGAAGGG - Intergenic
957247830 3:77735625-77735647 CTGGAGAACAGGCATGGGAATGG - Intergenic
957833071 3:85548822-85548844 AATGTGAACACGAAGGAGAAAGG + Intronic
958161695 3:89824715-89824737 ATGTTGATCAGGAATTAGAAAGG + Intergenic
958487591 3:94731845-94731867 TTGGGGAAGAGGTATGAGAATGG - Intergenic
958605932 3:96358471-96358493 ATGTTGAATAGGAATGAGGTGGG + Intergenic
958789140 3:98630881-98630903 CTGGAGAACAGGCATGGGAATGG - Intergenic
959146741 3:102555897-102555919 ATGATGGACTGGATTGAGAAGGG - Intergenic
959377686 3:105605460-105605482 ATGGAGAACCGGCATGGGAATGG - Intergenic
959986750 3:112581703-112581725 ATGGTGGAAAAGAAAGAGAAAGG - Intronic
960199838 3:114818840-114818862 ATATTAAACAGGAATAAGAAAGG + Intronic
960566917 3:119143474-119143496 ATACAGAAAAGGAATGAGAAAGG + Intronic
960758194 3:121042828-121042850 ATGGGGTACTGAAATGAGAAAGG + Intronic
961001999 3:123380259-123380281 GTGGTGAACAGGCTTGAGTAGGG + Intronic
961082809 3:124041089-124041111 ATGTAGAACAGGAATGGAAATGG + Intergenic
961091281 3:124114687-124114709 TTTGTGAGCAGGAATGAGCATGG + Intronic
962459432 3:135595570-135595592 GTGATGATCAGGAATCAGAATGG - Intergenic
963120069 3:141768894-141768916 AGGCTGAGAAGGAATGAGAAGGG - Intergenic
963380138 3:144519145-144519167 ATGGTTAAAAATAATGAGAATGG + Intergenic
963432652 3:145229638-145229660 CTGGAGAACAGGCATGGGAATGG - Intergenic
963453434 3:145514802-145514824 CTGGAGAACAGGCATGGGAATGG + Intergenic
963766084 3:149337306-149337328 CTGGTGAAAAGGAATGGAAAGGG + Intergenic
964181100 3:153887368-153887390 ATTGTGAGCAGGAATGTAAAAGG + Intergenic
964422509 3:156519013-156519035 TTGTTGAACAGGAATAAGGAAGG - Intronic
965057412 3:163739752-163739774 ATAGTTAACAGGAATGTGAATGG + Intergenic
965232498 3:166071693-166071715 ATGGGGAACACTCATGAGAAGGG + Intergenic
965251773 3:166351934-166351956 CTGGAGAACAGGCATGGGAATGG - Intergenic
965936218 3:174116199-174116221 GTGGTGTACAGCAATGAGAATGG - Intronic
966280255 3:178217862-178217884 ATGATCAGCAGGAGTGAGAAAGG + Intergenic
966281239 3:178231956-178231978 ATGGTGAAATGAAAAGAGAATGG - Intergenic
967112377 3:186305420-186305442 ATGCTGAAAAGGAATGAAGATGG + Intronic
967505578 3:190249473-190249495 CTGGGGAACAGGCATGGGAATGG - Intergenic
967831467 3:193923690-193923712 CTGGAGAACAGGCATGGGAATGG + Intergenic
968549350 4:1214296-1214318 ATGGTGGACAGGGAAGAGCAGGG + Intronic
968906562 4:3455330-3455352 CTGGAGAACAGGCATGGGAATGG + Intergenic
969809598 4:9637802-9637824 AGCGGGAACTGGAATGAGAATGG - Intergenic
969911128 4:10447463-10447485 ATGAGGAACAGCAAGGAGAATGG + Intronic
970050461 4:11908521-11908543 ATGGTGAACATGACTTAGAATGG - Intergenic
970086530 4:12353709-12353731 ATAGTCTACAGAAATGAGAAGGG + Intergenic
970110187 4:12629088-12629110 ATGTTGAACTGGAAGGTGAAAGG - Intergenic
970127844 4:12834361-12834383 AGGGTGAACAGTAATTAAAATGG - Intergenic
970263850 4:14259315-14259337 AGGGTGAAGAGGAAAGAGCATGG - Intergenic
970361557 4:15313709-15313731 ATGGTGACCAGGACTGACATTGG - Intergenic
970604086 4:17663320-17663342 ATGTTGAACAGGAGTGAGAGAGG - Intronic
971002839 4:22341551-22341573 CTGGAGAACAGGAATGGGAATGG + Intergenic
971101307 4:23468719-23468741 CTGGTGAACAGGTATGGAAATGG - Intergenic
971397893 4:26247138-26247160 ATGTTGAACAAGAATAATAAAGG - Intronic
971657966 4:29374159-29374181 ATGGTGAAAAGAGATCAGAAGGG + Intergenic
971670083 4:29545193-29545215 ATGGTGAGAAGGACAGAGAAAGG + Intergenic
971685256 4:29757289-29757311 CTGGAGAACAGGCATGAGAATGG + Intergenic
971711524 4:30119316-30119338 ATATTGAATAGGAATGAAAAGGG + Intergenic
971766523 4:30839264-30839286 ATAGCCAAAAGGAATGAGAAGGG + Intronic
972192614 4:36612982-36613004 CTGGAGAACAGGCATGGGAATGG + Intergenic
972600752 4:40570152-40570174 ATGGTGGATAGGGGTGAGAATGG + Intronic
973134112 4:46684892-46684914 ATGGTGCCGTGGAATGAGAATGG - Intergenic
974059548 4:57018886-57018908 ATGGTGAAGAGAAATCTGAAGGG + Intronic
974099863 4:57404837-57404859 GTGGAGAAAGGGAATGAGAAGGG + Intergenic
974289302 4:59910472-59910494 CTGGAGAACAGGCATGGGAATGG + Intergenic
974446013 4:61982776-61982798 ATGGTGAACATGAATAAAAATGG - Intronic
974644908 4:64677070-64677092 CTGGAGAACAGGCATGGGAATGG - Intergenic
974726788 4:65809170-65809192 CTGGAAAACAGGCATGAGAAAGG + Intergenic
975079141 4:70253882-70253904 ATGGTGAACAAGTATATGAAAGG + Intergenic
975104615 4:70553763-70553785 GTGGTGAACAGGAAAGACAATGG - Intergenic
975318598 4:72983307-72983329 ATGGAGAACAGGGACGATAAAGG + Intergenic
975784062 4:77868813-77868835 ATGGTGAACATGAGGGAGAGTGG + Intronic
975786144 4:77890590-77890612 ATGTTGAATAGGAGTGAGAGAGG - Intronic
975949997 4:79758883-79758905 ATGGTGAAGAGGACTGGAAAGGG - Intergenic
976536915 4:86228046-86228068 TTATTGAAAAGGAATGAGAAAGG + Intronic
977166485 4:93705217-93705239 ATGGTAAACAGGTATGTGAAAGG - Intronic
977204355 4:94153006-94153028 CTGGAGAATAGGTATGAGAATGG + Intergenic
977218161 4:94307925-94307947 TTGGTGAAAAGGAAGCAGAAAGG + Intronic
977313167 4:95412243-95412265 GTGGTGAAGAGGATTGAGAAGGG - Intronic
977430466 4:96925928-96925950 CTGGAGAACAGGCATGGGAATGG + Intergenic
977490381 4:97702351-97702373 CTGGAGAACAGGCATGGGAATGG - Intronic
977626895 4:99197618-99197640 CTGGAGAACAGGCATGGGAATGG - Intergenic
977702034 4:100032182-100032204 CTGGAGAACAGGCATGGGAATGG - Intergenic
978707522 4:111732138-111732160 ATTGTGAACAGAAATTGGAAGGG + Intergenic
979012685 4:115391362-115391384 ATGTTGAATAGGAATGATGAGGG - Intergenic
980388207 4:132113403-132113425 CTGGAGAACAGGCATGGGAATGG - Intergenic
980639451 4:135556575-135556597 ATGGTGAACAGAAGAGAGAGAGG - Intergenic
980649351 4:135689947-135689969 ATGGAGAATAGGAGTGAAAAAGG + Intergenic
980957472 4:139444078-139444100 CTGGAGAACAGGCATGGGAATGG + Intergenic
980981146 4:139655516-139655538 AGGGTGGACTGGAAGGAGAAAGG - Intergenic
981321194 4:143393961-143393983 AGGGGAAACAGGAATGAGAAAGG + Intronic
981673564 4:147314978-147315000 ATGGTGACCAGAAATGGAAAAGG - Intergenic
981751948 4:148101217-148101239 ATGTTTTACAGAAATGAGAAGGG - Intronic
981784247 4:148460120-148460142 ATGGTGAGCAAGCATCAGAAAGG - Intergenic
981834559 4:149040164-149040186 CTGGAGAACAGGCATGGGAATGG + Intergenic
982106577 4:152016609-152016631 ATAGTGCACAGGAGGGAGAAAGG - Intergenic
982304330 4:153914051-153914073 ATCCTGTACAGAAATGAGAAAGG - Intergenic
982337795 4:154259127-154259149 AAGGTGAACAGGCATGTGGACGG - Intronic
982544107 4:156711248-156711270 ATAGTGATCAGTAATGAGATTGG - Intergenic
982753892 4:159195675-159195697 ATGGTGACAAGGCATGAAAAGGG - Intronic
983329066 4:166301319-166301341 ATGTTTAAAAGGAATGAGTAGGG + Intergenic
983698669 4:170564926-170564948 ATGGTGAAATGGAAAGAGCATGG - Intergenic
983983260 4:174025324-174025346 ATGGTGAAAAAGGAAGAGAAAGG + Intergenic
984061361 4:174992102-174992124 CTGGAGAACAGGCATGGGAATGG - Intergenic
984400847 4:179261864-179261886 CTGGAGAACAGGCATGGGAATGG + Intergenic
984848938 4:184135804-184135826 TGGGTGAACAGTGATGAGAAGGG - Intronic
986124556 5:4873182-4873204 AAGTTGAACTTGAATGAGAATGG + Intergenic
986746585 5:10750243-10750265 CTGATGAACGGGAAGGAGAATGG + Intronic
987152876 5:15059382-15059404 CTGGAGAACAGGCATGGGAATGG + Intergenic
987206619 5:15634180-15634202 ATAATGAACAGGAATTAGCAAGG + Intronic
987885329 5:23805583-23805605 CTGGAGAACAGGCATCAGAATGG + Intergenic
988058092 5:26126863-26126885 ATGCTGAGCAGGGATAAGAATGG - Intergenic
988361192 5:30238952-30238974 TTGGTTCACAGGAATGAGCAGGG - Intergenic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
989742183 5:44786171-44786193 TTGGTGCACAGGAATAAGCAGGG + Intergenic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
990244976 5:53855285-53855307 ATGTTGAAAAGGAATGGTAACGG - Intergenic
990513036 5:56506378-56506400 ATGGTAAAAAGGAATCAGGAAGG - Intergenic
990528572 5:56652209-56652231 ATGGTGAAGAGTGAAGAGAAAGG - Intergenic
991945843 5:71897842-71897864 CTGGAGAACAGGCATGGGAATGG + Intergenic
992018265 5:72597239-72597261 ATGGTGAAATGAGATGAGAAAGG - Intergenic
992198530 5:74362884-74362906 ATGGTGATTAGGAAGAAGAAGGG + Intergenic
992756309 5:79909897-79909919 CTGGGGAAAAGGCATGAGAAGGG - Intergenic
992955494 5:81904072-81904094 ATAGTGGAGAGGAAGGAGAATGG - Intergenic
993232190 5:85249837-85249859 CTAGAGAACAGGCATGAGAATGG - Intergenic
993506693 5:88717258-88717280 AAGGTGGGCAGGATTGAGAAAGG - Intergenic
994310275 5:98261313-98261335 ATGAGGATCAGGAATGAGGAGGG + Intergenic
994417339 5:99489137-99489159 ATGGAGGGCAGGAAGGAGAAGGG - Intergenic
994462623 5:100086029-100086051 ATGGAGGGCAGGAAGGAGAAGGG + Intergenic
994984712 5:106918020-106918042 CAGGAGAACAGGCATGAGAATGG - Intergenic
995269846 5:110207761-110207783 CTGGAGAACAGGCATGGGAATGG - Intergenic
995465843 5:112448718-112448740 AGGGTGTCCAGGTATGAGAATGG - Intergenic
995873084 5:116762797-116762819 ATTGGGAAGAGGACTGAGAAAGG + Intergenic
996266272 5:121544284-121544306 CTGGAGAACAGGCATGGGAATGG + Intergenic
996825261 5:127675522-127675544 ATGGAGAACAGGCATGGGAATGG + Intergenic
997677303 5:135722505-135722527 ATGGTGAACAGGCAGGAACATGG + Intergenic
998219234 5:140262713-140262735 CTGGTGAATGGGAATGAGACTGG + Intronic
998298337 5:140993430-140993452 AAGGAGAACAGGAATGAATAAGG - Intronic
999541363 5:152576023-152576045 ATGGTGAGGAGGAATGGGAAGGG + Intergenic
999620150 5:153464671-153464693 TTGGTTTACAGGAATGAGCAGGG + Intergenic
1000046275 5:157524319-157524341 ATGGAGAACAGAATGGAGAATGG - Intronic
1002795315 6:466837-466859 ATGGTGGGAAGGAATCAGAATGG + Intergenic
1003696202 6:8408396-8408418 CTGGAGAACAGGCATGGGAATGG - Intergenic
1003758301 6:9147750-9147772 CTGGAGAACAGGCATGGGAATGG + Intergenic
1003902290 6:10665888-10665910 ATGTTGAATAGGAGTGAGAGAGG + Intergenic
1006001198 6:30966477-30966499 CTGGAGAACAGGCATTAGAATGG + Intergenic
1006062047 6:31430862-31430884 GTGGAGAACAGGCATGGGAATGG + Intergenic
1007948722 6:45850363-45850385 ATTGGAAACAGGAATGAGTAAGG - Intergenic
1010325612 6:74558893-74558915 CTGGAGAACAGGCATGGGAATGG - Intergenic
1010581016 6:77596039-77596061 CTGGAGAACAGGCATGGGAATGG - Intergenic
1010707940 6:79136368-79136390 ATGGAAAACAGGAAAAAGAAGGG + Intergenic
1011975810 6:93296674-93296696 ATGGTTACCAGGGATAAGAAGGG + Intronic
1011979856 6:93360216-93360238 ATGGTTAACAGAAAGGATAAAGG + Intronic
1012352475 6:98269633-98269655 ATTGTGAACAGGAATGAGTTTGG + Intergenic
1012921094 6:105221784-105221806 CTGGAGAACAGGCATGGGAATGG - Intergenic
1013270185 6:108537891-108537913 ATGCTGACTAGGACTGAGAAAGG - Intergenic
1013447845 6:110249022-110249044 ATGGTGAACATGAATCTGTAAGG - Intronic
1013515808 6:110884806-110884828 ATGGTGAATATAACTGAGAAAGG + Intronic
1014416706 6:121193085-121193107 CTGGAGAACAGGCATGGGAATGG + Intronic
1014456139 6:121636854-121636876 CTGGAGAACAGGCATGGGAATGG - Intergenic
1014534505 6:122598933-122598955 CTGGAGAACAGGCATGGGAATGG - Intronic
1014969958 6:127801915-127801937 CTGGAGAACAGGCATGGGAATGG + Intronic
1015259788 6:131223740-131223762 TTTTTTAACAGGAATGAGAAAGG - Intronic
1015467228 6:133560532-133560554 TTGGAGAACAGGCATGGGAATGG - Intergenic
1015681933 6:135818120-135818142 TTGGGGAACAGGAAAAAGAAAGG + Intergenic
1015720501 6:136236277-136236299 CTTGTGAAGAGGAAAGAGAAGGG + Intronic
1015720544 6:136236667-136236689 CTTGTGAAGAGGAAAGAGAAGGG - Intronic
1016120201 6:140334950-140334972 CTGGAGAACAGGCATAAGAATGG - Intergenic
1016249263 6:142020784-142020806 ATGGTGAACAGGAGTATGACTGG - Intergenic
1016420283 6:143875586-143875608 CTGGAGAACAGGCATGGGAATGG - Intronic
1016734567 6:147462689-147462711 ACGGTCAATAGGAATGATAAGGG + Intergenic
1016854222 6:148650217-148650239 ATGGTGGACAGCAATTAAAAGGG + Intergenic
1017228118 6:152043386-152043408 CTGGAGAACAGGCATGGGAATGG - Intronic
1017570754 6:155741999-155742021 GGGGTGAAGAGGGATGAGAATGG - Intergenic
1017589520 6:155963517-155963539 ATAGTGAACTGGAATGAGTGAGG + Intergenic
1018023260 6:159782973-159782995 ATGGAGAACAGGGCTGAAAAGGG + Intronic
1018107635 6:160504101-160504123 ATGGAGAACAGGCATGGGAATGG - Intergenic
1018123275 6:160657828-160657850 CTGGAGAACAGGCATGGGAATGG - Intronic
1018465906 6:164044690-164044712 ATGGAAAACAGAAATGAAAAAGG - Intergenic
1018511383 6:164527841-164527863 ATGGTGAACATGGATGGCAATGG - Intergenic
1018599572 6:165525222-165525244 CTGGAGAACAGGCATGGGAATGG + Intronic
1019023189 6:168936239-168936261 ATGGTGCCAAGGAAGGAGAAAGG + Intergenic
1020342795 7:7130977-7130999 AAGGGGAAGAGGAAAGAGAAGGG - Intergenic
1020632013 7:10650753-10650775 ATGCTAAAAAGGAATGAAAAAGG - Intergenic
1020679118 7:11215024-11215046 TAGGTGAACAGGAATGATAATGG - Intergenic
1021648096 7:22806691-22806713 ATGGTTCACAGGAATTAGCAGGG - Intergenic
1021772199 7:24015983-24016005 ATGGCTAACAGGTATGTGAAAGG + Intergenic
1022899814 7:34795374-34795396 ATGATGAAAAGGAATGTGAGAGG - Intronic
1023502265 7:40863568-40863590 ATGGTGAGCAGTTATGAGAAGGG - Intergenic
1023511241 7:40955668-40955690 ATGTTGAATAGGAGTGAGAGAGG + Intergenic
1024788308 7:52933763-52933785 ATGGTGAAGTGGGATGTGAATGG + Intergenic
1024834898 7:53505253-53505275 TTGGTGAACAGAAATAATAAAGG - Intergenic
1026525512 7:71150109-71150131 ATGGTGAACAGGAATGAGAAGGG - Intronic
1026593140 7:71713309-71713331 ATGGGGACGAGGGATGAGAAGGG + Exonic
1027503418 7:78984261-78984283 ATGCTGAACAGGAGTCGGAATGG - Intronic
1027958907 7:84918932-84918954 ATGGTGAAAAGCAAAGAGGAAGG + Intergenic
1028141442 7:87279684-87279706 CTGGAGAACAGGCATGGGAATGG + Intergenic
1028898511 7:96069073-96069095 AGGGTGTACAGGGATGAGGATGG - Intronic
1028980996 7:96967945-96967967 ATGGTCAATAGGAATGATTAAGG + Intergenic
1030278615 7:107745682-107745704 TTGGTGAAAATGAAGGAGAATGG + Intronic
1030368254 7:108670655-108670677 CTGGAGAACAGGCATGGGAATGG + Intergenic
1030648871 7:112095389-112095411 ATGGTGAACAGGACACAAAAAGG + Intronic
1030710021 7:112739182-112739204 ATGTTGAACATGAAAAAGAAAGG - Intergenic
1030921321 7:115392206-115392228 ATGGTGACAAGGAAGGAAAAAGG + Intergenic
1031291951 7:119949341-119949363 ATAGTGATGAGGAATGAGATTGG - Intergenic
1031959207 7:127973771-127973793 ATTTTGGAAAGGAATGAGAAGGG - Intronic
1031972988 7:128077208-128077230 ATGTTAAACAGGATTTAGAAAGG + Intronic
1032153418 7:129449231-129449253 CTGGAGAACAGGCATGGGAATGG - Intronic
1032619335 7:133511922-133511944 GTGGTGGGAAGGAATGAGAAGGG - Intronic
1032902785 7:136329708-136329730 ACGGAGAATAGGAGTGAGAAAGG + Intergenic
1032923721 7:136578094-136578116 CTGGAGAACAGGCATGGGAATGG - Intergenic
1033033990 7:137853892-137853914 ATGGAGAAAGGGAATGTGAATGG - Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034042327 7:147892445-147892467 ATGGTGTAAAGGAATGAGCCAGG + Intronic
1034169642 7:149053067-149053089 CTGGAGAACAGGCATGGGAATGG + Intergenic
1035101719 7:156402821-156402843 TTGGTGCACAGGAGTGGGAAGGG - Intergenic
1035431618 7:158827691-158827713 ATGGCAAACAAGAATTAGAAAGG - Intronic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035590273 8:807836-807858 CTGGTGCACAGGAATAAGGAAGG + Intergenic
1037849030 8:22310908-22310930 ATGTTATACAGTAATGAGAATGG - Intronic
1038693779 8:29786749-29786771 ATGGTGAGCAAAAATGAGCATGG - Intergenic
1039475736 8:37838594-37838616 GGGGTGACCAGGAAGGAGAAGGG - Intronic
1040359300 8:46649995-46650017 ATGGCTCACAGGAATGATAATGG + Intergenic
1041345779 8:56896568-56896590 ATGCAGGAAAGGAATGAGAAAGG + Intergenic
1041761638 8:61373685-61373707 AAGGAGAATAGGAAGGAGAAAGG - Intronic
1041943651 8:63417610-63417632 AAAGTGAAGATGAATGAGAAAGG - Intergenic
1041985889 8:63922181-63922203 ATGGAGAACAGGTATGGGAATGG + Intergenic
1042400882 8:68345202-68345224 ATGGTGAACACAAAGGAAAATGG + Intronic
1042425126 8:68639004-68639026 GTGGTGAACAGTAATGTGAGAGG + Intronic
1042614645 8:70634954-70634976 TTGGGGAACAGGGGTGAGAAGGG - Intronic
1042969502 8:74392589-74392611 ATGGGGAACATGAATGTTAACGG - Intronic
1043345064 8:79288580-79288602 ATAGTGAACAGGAGAGTGAAAGG + Intergenic
1043543399 8:81288477-81288499 ATGGTGAACAAGATAGAGTAGGG + Intergenic
1043887097 8:85613331-85613353 ATTATCAACAGAAATGAGAATGG - Intergenic
1044150512 8:88770825-88770847 ATGGAGAACAGGCATGGGAATGG + Intergenic
1044202100 8:89450186-89450208 CTGGAGAACAGGCATGGGAATGG + Intergenic
1044350578 8:91160601-91160623 ATGGTCAGCAGGAGAGAGAAGGG - Intronic
1044362295 8:91301256-91301278 ATGCTGAAAAGCATTGAGAAGGG - Intronic
1044487456 8:92769441-92769463 CTGGAGAACAGGCATGGGAATGG - Intergenic
1044633726 8:94302085-94302107 CTGGAGAACAGGCATGGGAATGG - Intergenic
1044751919 8:95424309-95424331 AAAGTGAACAGCAATCAGAATGG + Intergenic
1044817742 8:96130506-96130528 ACAGGGAACAGGAAGGAGAAAGG - Intergenic
1044897713 8:96910344-96910366 ATGGTGACAAGGATGGAGAAAGG - Intronic
1045186314 8:99841993-99842015 AGGGGGAACAGGAGTGAGACGGG - Intronic
1045221469 8:100204376-100204398 CTGGAGAACAGGCATGGGAATGG + Intronic
1045378536 8:101600169-101600191 ATGTAGAACAGGCCTGAGAAAGG + Intronic
1045395098 8:101753042-101753064 ATGTTGAACAGGAAAGATAGCGG + Intronic
1045540583 8:103080656-103080678 GTGGTAAACAGGCATCAGAATGG - Intergenic
1047009066 8:120651532-120651554 GTGGTGAAAAGAGATGAGAATGG + Intronic
1047339886 8:123970769-123970791 ATGGAGGACAGGAATGGGAAGGG + Intronic
1047444525 8:124907328-124907350 AAGGGGAACGGGAAGGAGAAGGG + Intergenic
1047632671 8:126725452-126725474 CTGGAGAAGAGGCATGAGAATGG - Intergenic
1047768315 8:128008495-128008517 GTAGGGAACAGGCATGAGAAGGG - Intergenic
1048084181 8:131159446-131159468 CTGGAGAACAGGCATGAGAAAGG - Intergenic
1048220154 8:132533714-132533736 AGGGTAGACAGGAAGGAGAATGG - Intergenic
1048654647 8:136522522-136522544 CTGGAGAACAGGGATGGGAATGG - Intergenic
1048748504 8:137643585-137643607 ATGTTGAAAAGGAGTGAGGAAGG + Intergenic
1048827151 8:138439392-138439414 ATGGTGTAGTGGAATGAGAATGG - Intronic
1048923175 8:139248694-139248716 GTGGCCAACAGGAATGAGAGGGG + Intergenic
1049120248 8:140730501-140730523 AGGGTGAACAGTGATTAGAAAGG + Intronic
1049333255 8:142066982-142067004 ATGGCCAACAGGCATGTGAAAGG + Intergenic
1049914947 9:308456-308478 AAGGTGCACAAGAATGAGAGTGG - Intronic
1050496055 9:6243724-6243746 TTGGTGAACAGGAAAGAAAATGG + Intronic
1050855752 9:10352384-10352406 AAGAAGAATAGGAATGAGAATGG - Intronic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1051754713 9:20386314-20386336 ATGTTGAAGAGTAAGGAGAAGGG + Intronic
1051881832 9:21848342-21848364 CTGGAGAACAGGCATGGGAATGG + Intronic
1051966115 9:22831938-22831960 CTGGAGAACAGGTATGGGAATGG + Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052358080 9:27527049-27527071 ATGGTGAAAATGAATGTAAAAGG - Intronic
1052368338 9:27638535-27638557 CTGGAGAACAGGCATGGGAATGG + Intergenic
1054719388 9:68589223-68589245 ATGTTGAATAGGAGTGAGAAAGG + Intergenic
1055206771 9:73740461-73740483 ATGATTAATAGGAATGATAATGG - Intergenic
1055785047 9:79863127-79863149 GGGTTGAACAGGAATAAGAAAGG - Intergenic
1055808922 9:80128416-80128438 CTGGAGAACAGGAATGTGCACGG + Intergenic
1056069824 9:82974536-82974558 TTGGAAAACAGGAATTAGAACGG - Intergenic
1056655865 9:88508572-88508594 ATTTTCAACAGGAATGAAAATGG + Intergenic
1058033908 9:100230056-100230078 CTGGGGTACAGGAATGAGCACGG - Intronic
1058176434 9:101740552-101740574 AAGGTGGACAAGAAGGAGAAAGG - Intergenic
1058213758 9:102205975-102205997 ATGTGGAAAAGGAATGAGATTGG - Intergenic
1058259536 9:102811971-102811993 CTGGAGAACAGGCATGGGAATGG - Intergenic
1058270091 9:102961428-102961450 ATGGTTAAGAGGAAAGTGAAGGG - Intergenic
1058296223 9:103311412-103311434 CTGGAAAACTGGAATGAGAATGG - Intergenic
1058732345 9:107862287-107862309 ATGGTGAGCAGGAATTACAAAGG - Intergenic
1058954164 9:109930186-109930208 TTGGGGAGAAGGAATGAGAAAGG - Intronic
1059234158 9:112748184-112748206 ATGGTGAATATGAATGGGCAGGG + Intergenic
1059743901 9:117181851-117181873 AAGGTGAGCAGGAAAGAGAGAGG - Intronic
1060233985 9:121848362-121848384 ATGTTGGACAGGAATGGTAAGGG - Intronic
1060668054 9:125444973-125444995 ATGAGCAACAGGAAGGAGAAGGG + Intronic
1060876579 9:127088210-127088232 ATGGTGAAAAGTCCTGAGAATGG + Exonic
1061173045 9:128973145-128973167 GTGGTGCACTGGAATGACAAAGG - Exonic
1062097958 9:134712417-134712439 AGGGGGAACAGGAAGGAGTAGGG - Intronic
1062314580 9:135960516-135960538 AAGGGGAAGAGGAAGGAGAAGGG + Intronic
1062550532 9:137084110-137084132 ATGAGGAACAGCTATGAGAAGGG - Exonic
1062632358 9:137469827-137469849 ATGATGAACAGGAAAGAAAATGG + Intronic
1186561568 X:10618918-10618940 ATGAGGAAAAGGAAGGAGAAGGG - Intronic
1187229503 X:17407294-17407316 ATGGTTTATAGGGATGAGAAGGG - Intronic
1187268477 X:17759069-17759091 ATGGGGAAAAAGAATGAAAAAGG - Intergenic
1187344138 X:18447624-18447646 ATGGAGAACAAGGATGACAATGG - Intronic
1187526604 X:20060500-20060522 ATGCTAAACAGAAAAGAGAAAGG - Intronic
1187941946 X:24391191-24391213 ATGGAGGACAGGACAGAGAAGGG + Intergenic
1188001623 X:24987864-24987886 ATGGTGACCTGGAATGGTAAGGG + Intronic
1188349045 X:29104456-29104478 ATGGTTACCAGATATGAGAAAGG + Intronic
1188624761 X:32269624-32269646 ATGGTGAGCCGGAATGAGTAAGG - Intronic
1189052516 X:37661386-37661408 ATACTGAACATGAATGATAAAGG - Intronic
1189086227 X:38027446-38027468 TTGGTTAACAGGAATAAGCAGGG + Intronic
1189110596 X:38286083-38286105 AGGGGGAAGAGGAAGGAGAAGGG - Exonic
1189110660 X:38286269-38286291 AGGGAGAAGAGGAAGGAGAAGGG - Exonic
1189110675 X:38286320-38286342 AGGGAGAAGAGGAAGGAGAAGGG - Exonic
1190154090 X:47973655-47973677 GTGGTGAACAGGGAAGAGTAGGG - Intronic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1191641657 X:63433722-63433744 AAGGTGAACAGGACTGATAGAGG + Intergenic
1191659108 X:63632291-63632313 CTGGAGAACAGGTATGGGAATGG - Intergenic
1191719544 X:64217958-64217980 CTGGAGAACAGGCATGGGAATGG - Intergenic
1191742823 X:64453601-64453623 CTGGAGAACAGGCATGGGAATGG - Intergenic
1191946079 X:66536712-66536734 CTGGAGAACAGGCATGGGAATGG + Intergenic
1192140170 X:68640099-68640121 ATGGGAAACTAGAATGAGAAAGG - Intergenic
1192195932 X:69028160-69028182 GTGGTGTAGAGGAAGGAGAAAGG + Intergenic
1192678435 X:73225290-73225312 ATGGAGAACAGGGATGGGAAAGG + Intergenic
1193155935 X:78174326-78174348 CTGGATAACAGGAATGGGAATGG - Intergenic
1193444383 X:81581970-81581992 ATGGTGAATAGGAGTGATGAGGG - Intergenic
1193517000 X:82478314-82478336 AGGGTGAACAGGACTGAGATCGG + Intergenic
1193602262 X:83521827-83521849 ATGGTGAACACAAAGGAGATAGG - Intergenic
1193832650 X:86307818-86307840 CTGGAGAACAGGAATGGGAATGG + Intronic
1193904301 X:87224261-87224283 CTGGAGAACAGGCATGGGAATGG + Intergenic
1193934032 X:87593125-87593147 ATGTTGAAAAGTAAAGAGAAAGG - Intronic
1194032294 X:88832157-88832179 CTGGAGAACAGGCATGAGAATGG - Intergenic
1194209982 X:91060055-91060077 CTGGAGAACAGGTATGGGAATGG + Intergenic
1194343024 X:92728808-92728830 CTGGAGAACAGGCATGGGAATGG + Intergenic
1194833645 X:98656495-98656517 CTGGAGAACGGGAATGGGAATGG + Intergenic
1195749147 X:108146978-108147000 CTGGAGAACAGGCATGGGAACGG - Intronic
1195782672 X:108482171-108482193 CTGGAGAACAGGCATGAGAATGG - Intronic
1195809957 X:108818129-108818151 CTGGAGAACAGGCATGGGAACGG - Intergenic
1196083575 X:111659681-111659703 ATGATGAACTGTAATGAAAATGG + Intergenic
1196205205 X:112931519-112931541 ATGGTGAACAAGAAAGAAGATGG - Intergenic
1196271419 X:113716342-113716364 ATGGGGAACCGGAAGGGGAATGG - Intergenic
1197002005 X:121450750-121450772 CTGGAGAACAGGCATGGGAACGG + Intergenic
1197084485 X:122455808-122455830 CTGGAGAACAGGCATGGGAATGG - Intergenic
1197097177 X:122610540-122610562 ATGGAGAACAGGCATGGGAATGG + Intergenic
1197245404 X:124161617-124161639 CTGGAGAACAGGCATGGGAATGG - Intronic
1197426031 X:126297913-126297935 CTGGAGAACAGGCATGGGAATGG - Intergenic
1197591559 X:128417040-128417062 CTGGAGAACAGGCATGGGAATGG + Intergenic
1197976761 X:132173855-132173877 CTGGTCAGCAGGAATGAGGAAGG + Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198140871 X:133802004-133802026 ATGGCGAACAGAAATGAAGAGGG - Intronic
1198659665 X:138954396-138954418 GTGTTGAACAGGGATGAAAATGG - Intronic
1198933671 X:141885234-141885256 CTGGAGAACAGGCATGGGAATGG + Intronic
1199275772 X:145940174-145940196 CTGGGGAACAGGCATGGGAATGG + Intergenic
1199549636 X:149044535-149044557 ATGGTGAACAGTTCTGAGAGAGG + Intergenic
1199627374 X:149752896-149752918 CTGGAGAACAGGCATGAGAATGG - Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic
1200340593 X:155391387-155391409 CTGGAGAACAGGCATGGGAATGG - Intergenic
1200651385 Y:5845474-5845496 CTGGAGAACAGGCATGGGAATGG + Intergenic
1201131182 Y:10953132-10953154 ATGGTGAAAAGAAATGTGAGCGG - Intergenic
1201412899 Y:13718840-13718862 AGTATGAAAAGGAATGAGAAAGG - Intergenic
1201892149 Y:18954278-18954300 AGGGTGAACAGGAAGAAGGATGG + Intergenic