ID: 1026526674

View in Genome Browser
Species Human (GRCh38)
Location 7:71159611-71159633
Sequence TGACAGGTATACAATTCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026526674 Original CRISPR TGACAGGTATACAATTCAAC TGG Intronic
906526030 1:46493752-46493774 TGACAGATGTACAACTCATCCGG - Intergenic
906966415 1:50461408-50461430 TGACAGGTATACACTTTGAAGGG - Intronic
907291099 1:53413540-53413562 TGACAATAATACAAGTCAACAGG - Intergenic
910352533 1:86315016-86315038 TGACAGATATGAAATTCCACTGG + Intergenic
910696503 1:90023996-90024018 TCACATGCATACAAATCAACAGG - Intronic
913060198 1:115197555-115197577 TGAGAGGTATGGAAATCAACTGG - Intergenic
921839493 1:219813216-219813238 CGCCAGGTGGACAATTCAACTGG - Intronic
922951701 1:229563144-229563166 TAACAGGTATTGAATTCAAAAGG + Intergenic
1066324747 10:34346684-34346706 TGACAGGTGTTCAACCCAACAGG + Intronic
1067057724 10:43061969-43061991 TGAGATGTATACAATGCACCAGG + Intergenic
1073663886 10:105508520-105508542 TGACAGGTAGACAGATTAACAGG + Intergenic
1075511796 10:123078462-123078484 TGCAAGGTGTACAATTCAATTGG - Intergenic
1080112303 11:28581900-28581922 TGGGAACTATACAATTCAACAGG - Intergenic
1087937204 11:104048751-104048773 TGAGAGTTATACAATGCATCTGG + Intronic
1091958554 12:4670414-4670436 TGAGAGGTATCAAATTCACCTGG + Intronic
1096421469 12:51462201-51462223 TGACAGAGATAAAAATCAACAGG + Intronic
1099399628 12:82186770-82186792 GGACAGGTACACAATTCATCAGG + Intergenic
1099824776 12:87761182-87761204 TAACAGTTATACAAGTCAATGGG + Intergenic
1101333548 12:103776894-103776916 TAACAGGATTCCAATTCAACTGG + Exonic
1101528574 12:105554353-105554375 TGACAGGGACACAATTAAAAAGG + Intergenic
1107734800 13:43387489-43387511 TGACAGATATGAGATTCAACAGG + Intronic
1111092042 13:83460804-83460826 TGAAAGGTAAACCATGCAACAGG - Intergenic
1111513127 13:89292669-89292691 TGCCAGGCATACAATACAATTGG + Intergenic
1112102220 13:96201529-96201551 TGGAAGGAATCCAATTCAACAGG - Intronic
1115487514 14:33926280-33926302 TGAGAGGTATACAGTCCAAATGG + Intronic
1120511891 14:85425367-85425389 AGACAGGTTGACAATTAAACAGG - Intergenic
1122392653 14:101400631-101400653 TGTAAGGTAAACAATTCCACTGG + Intergenic
1124165946 15:27325770-27325792 TTTCAGGTTTATAATTCAACTGG - Intronic
1127077699 15:55344175-55344197 TTACAGGTCTACATTTCAACTGG + Intronic
1129470523 15:75751110-75751132 TGACAGGTAGAAAATTAAAGTGG + Intergenic
1129647443 15:77449515-77449537 TGATATGCATACAATTTAACTGG - Intronic
1134374495 16:13659180-13659202 TGACAGGTATACAAACCAGCTGG + Intergenic
1136469417 16:30469268-30469290 TCTAAGGTATACAATTCACCAGG + Intergenic
1149407016 17:56362874-56362896 TGTAAGGAATTCAATTCAACAGG + Intronic
1149501364 17:57155108-57155130 TGACAGGTCTACCTTGCAACTGG + Intergenic
1150109598 17:62486905-62486927 TGACATGGCTATAATTCAACTGG - Intronic
1151117932 17:71759249-71759271 TGACAGGTATATAAGGCAAGTGG + Intergenic
1155135723 18:22990309-22990331 TAACATGCATACAAGTCAACTGG - Intronic
1156080087 18:33322531-33322553 TCACGGAAATACAATTCAACTGG + Intronic
1165010112 19:32839890-32839912 TGAAAGGCATACAATGTAACTGG - Intronic
1167139538 19:47640184-47640206 TGCCAGGTATACAATACAATAGG - Intronic
926325490 2:11782051-11782073 TGGCAGGTATAGAAATCACCAGG + Intronic
926571595 2:14535484-14535506 TGACAGCAATCCAATTGAACTGG - Intergenic
928610732 2:32989682-32989704 TGGCATGTCTACAATGCAACTGG - Intronic
931301476 2:60982948-60982970 TGAAGGGAATACAATTCAGCTGG - Intronic
933283009 2:80353484-80353506 TTAAATGTATCCAATTCAACTGG - Intronic
934102753 2:88668547-88668569 GGACAGGTAAACCATTCAAGAGG - Intergenic
937576752 2:123432606-123432628 TGTCAAGTATAAAATTCCACTGG + Intergenic
939835053 2:147119767-147119789 TGAAAGGGAGACAATTCAAAGGG - Intergenic
941156008 2:161979012-161979034 TGACAAGTACACATTTCAATGGG - Intronic
1170099394 20:12682112-12682134 TGTCAGGCATATAATTCACCTGG - Intergenic
1175458740 20:59134926-59134948 TGACAGGTATCCACCTCCACTGG + Intergenic
1178623283 21:34194789-34194811 TCACAGGTACACAAATCACCTGG - Intergenic
1179515857 21:41906202-41906224 AGACAGGTACAGAATTCAGCTGG + Intronic
949235491 3:1804361-1804383 TGCCAGGTATACTATTCTAGGGG + Intergenic
949697207 3:6712287-6712309 TGTCAGGTTTACAAATGAACTGG - Intergenic
951999456 3:28769129-28769151 TGACAGGTATATAATACAATGGG + Intergenic
952201426 3:31132314-31132336 TAACAGGTAGACTATTCATCTGG - Intergenic
955455371 3:59115333-59115355 TGGCAAGTATACAACTCAACTGG + Intergenic
959881054 3:111445728-111445750 TTTCAGGTATACAAATCAAATGG + Intronic
960387742 3:117040887-117040909 TGACAGGAATACAATTAATCAGG + Intronic
965873596 3:173289766-173289788 TGACAGTAGTACTATTCAACAGG - Intergenic
966985146 3:185173115-185173137 TGACAGGTATATAATTTTAGGGG + Intergenic
970122036 4:12765275-12765297 TGGCAGGAATAAAATTCAGCTGG - Intergenic
975809906 4:78156779-78156801 TGACAGGAACACAGTTGAACTGG - Intronic
978102279 4:104856828-104856850 GAACACATATACAATTCAACAGG + Intergenic
980174326 4:129326243-129326265 TGTCAGGTATCCAATGCACCCGG - Intergenic
984992066 4:185390603-185390625 TGGTAGGCATACAGTTCAACTGG + Intronic
986092753 5:4526360-4526382 TGAAAGGTAAATAATTCAAATGG + Intergenic
987089687 5:14499753-14499775 AGAAAGGTATACTATTCAGCTGG + Intronic
992278547 5:75148124-75148146 AGACAGATATACTCTTCAACTGG + Intronic
993293087 5:86100812-86100834 TGACAAGTATACACTGCAAAGGG + Intergenic
993372732 5:87112646-87112668 GGACAGGTACACAATTTAAATGG - Intergenic
996671468 5:126122899-126122921 TGACAGGGACACAGTTCAGCTGG + Intergenic
996982647 5:129518460-129518482 TGCCAGATATACTATTCAAGGGG + Intronic
997143009 5:131402961-131402983 TGTAAGGTATAAAAATCAACAGG + Intergenic
998638151 5:143980160-143980182 TGACATGTAGACAAAACAACTGG - Intergenic
999537867 5:152537765-152537787 TGACTGGAATAATATTCAACAGG + Intergenic
999559400 5:152784249-152784271 TGACAAGTCTACAATTATACTGG + Intergenic
1008832489 6:55782810-55782832 TAAGATGTATACAAATCAACTGG - Intronic
1009331919 6:62433427-62433449 TGAAAGGAATACATTTCAACTGG + Intergenic
1011111111 6:83837523-83837545 TGAAGGATAGACAATTCAACAGG + Intergenic
1015248866 6:131105591-131105613 TGAGAGTTAAACAGTTCAACTGG + Intergenic
1022020047 7:26390233-26390255 TGACAGGTAGACAATAAAATGGG - Intergenic
1023935406 7:44736556-44736578 TCACATTTATACAATTCACCTGG - Intergenic
1024806419 7:53147081-53147103 TGACAAGGATATAAATCAACTGG + Intergenic
1024857619 7:53799769-53799791 TGCCAGGTACATCATTCAACTGG - Intergenic
1026526674 7:71159611-71159633 TGACAGGTATACAATTCAACTGG + Intronic
1028096875 7:86771781-86771803 AGACAGGAATAGAATTGAACAGG + Intronic
1028272314 7:88807679-88807701 TGAGAGCTATACAATACAAAAGG + Intronic
1028536612 7:91894997-91895019 GGACAGTTATACAAATGAACTGG - Intergenic
1029046569 7:97635458-97635480 TGACACAGAGACAATTCAACAGG - Intergenic
1031436475 7:121738193-121738215 CGACAAATATACAATACAACAGG - Intergenic
1031749193 7:125549417-125549439 TGACAGATATAAAGTTAAACTGG + Intergenic
1031988052 7:128176429-128176451 TAACAGGTATACAAATCACCTGG - Intergenic
1032038629 7:128539436-128539458 TGACATGGCTATAATTCAACTGG - Intergenic
1038500749 8:28041640-28041662 TAACATGCATACAAATCAACAGG + Intronic
1042372703 8:68010188-68010210 TGACATGTATACCAAACAACTGG + Intronic
1044678937 8:94757758-94757780 TGACAGCTGTACAATCAAACAGG - Intronic
1051000443 9:12275566-12275588 TGACAGGCATTCAATCTAACAGG + Intergenic
1051871437 9:21742160-21742182 TGAAAGGTATTCAATTTAACAGG + Intergenic
1052625617 9:30973175-30973197 GTACAGCTATACAATTGAACTGG - Intergenic
1054750955 9:68905626-68905648 TGACAGGTACACAATGCACTGGG - Intronic
1057002365 9:91523151-91523173 TTTCAGGTGTACAATTCAATGGG - Intergenic
1059983085 9:119794730-119794752 TGGTAGGTATGCAATTCAGCTGG - Intergenic
1186588179 X:10899048-10899070 TGACAAGTATGCAAAACAACTGG - Intergenic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1188487123 X:30694189-30694211 TGACATGTTTACAGTTCAAAGGG - Intronic
1192538405 X:71948188-71948210 TGTCAGCAATTCAATTCAACCGG - Intergenic
1194639360 X:96384171-96384193 TGGTAGACATACAATTCAACTGG - Intergenic
1198202831 X:134439016-134439038 TGTCATGTCTACAATTTAACTGG + Intergenic
1199170386 X:144727953-144727975 TAACAGATAAACAATTCAAAAGG + Intergenic
1201340922 Y:12932928-12932950 AGACAGAAATACCATTCAACTGG - Intergenic