ID: 1026527319

View in Genome Browser
Species Human (GRCh38)
Location 7:71165825-71165847
Sequence AGCTAGTTCCTTAGGTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026527317_1026527319 1 Left 1026527317 7:71165801-71165823 CCGAGACTTTAGGAGTTCAGGTC 0: 1
1: 0
2: 0
3: 17
4: 191
Right 1026527319 7:71165825-71165847 AGCTAGTTCCTTAGGTTTGAAGG 0: 1
1: 0
2: 0
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026527319 Original CRISPR AGCTAGTTCCTTAGGTTTGA AGG Intronic
900868689 1:5286690-5286712 ATCTAGTTCCTTGGGTGTGTCGG + Intergenic
909698304 1:78491621-78491643 AGCGAGTTCGTTAGTTTGGAGGG + Intronic
911165344 1:94719818-94719840 AACCAGTTCTTTAGGATTGAAGG + Intergenic
914457493 1:147849765-147849787 AGTTAGTTCCTTGCGTTTGTAGG + Intergenic
918604101 1:186400669-186400691 AGCTAGTATGTTAAGTTTGATGG + Exonic
920224873 1:204431152-204431174 AGCTAGTTGCCCAGGTCTGAGGG - Intronic
921556825 1:216608709-216608731 AAACAGTTCCTTAGGTCTGATGG + Intronic
1064190153 10:13198850-13198872 AGCTAGCACCTTGGCTTTGAAGG - Intronic
1064635603 10:17363260-17363282 AGCTAGTTTCTTAGCATTAAAGG + Intronic
1066652085 10:37665839-37665861 AGGTATTTCCCTAGGTTTGTTGG - Intergenic
1067035864 10:42916076-42916098 AGGTATTTCCCTAGGTTTGTTGG - Intergenic
1068267702 10:54674896-54674918 AGTTGGTTCTTTATGTTTGAGGG + Intronic
1079543180 11:21600332-21600354 AGCTAATTCATAAGTTTTGATGG - Intergenic
1079746825 11:24142976-24142998 TGCTAGTTCTTTAGGTTTGCTGG - Intergenic
1085280369 11:75326038-75326060 AGCTGGTGCCCTAGGTTTGAGGG - Intronic
1097767871 12:63546174-63546196 AGTTAGTTCCATGGATTTGAAGG + Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1107204806 13:37771476-37771498 AGATAGTTTCTTAGGTTTGGAGG - Intronic
1109155299 13:58902032-58902054 AGGTAGATCCTTTGGTTAGAGGG - Intergenic
1109745676 13:66620906-66620928 AGGTAGTACGTTAGGTTTGGGGG - Intronic
1112594636 13:100796690-100796712 AGCCAGTTTTTCAGGTTTGAGGG + Intergenic
1116013188 14:39375194-39375216 AGCCAATTCCTTAGAATTGAAGG - Intronic
1116650809 14:47590019-47590041 AACTAGTTCATTAAGTTTGTAGG - Intronic
1116954658 14:50911621-50911643 AGCTAGTAACTTAGGATAGAAGG - Intronic
1117612280 14:57496869-57496891 AGCTCTTGCCTTAGTTTTGATGG + Intergenic
1121330520 14:93046784-93046806 AGCTAGTGACTGAGCTTTGATGG - Intronic
1121915852 14:97836454-97836476 AGCTATTTCCTTAGGGCTCATGG - Intergenic
1122424376 14:101597131-101597153 ACCTATTTCCATAGGTTTGGGGG + Intergenic
1126918377 15:53491714-53491736 AGCTAGTAGCTTAGGTTAGGGGG - Intergenic
1128938146 15:71765512-71765534 AGCAAGTTCCTGAGGTGTGTTGG + Intronic
1129109812 15:73330773-73330795 AGCTGGCTCCTTGGGTCTGATGG + Intronic
1132240009 15:100250361-100250383 AGCTGGATCCTGAGGTTTCAAGG + Intronic
1139787765 16:69407734-69407756 AGATATTTCCTTTGGTGTGAAGG + Intronic
1145812391 17:27772299-27772321 AGCCAGTACCTTGGGGTTGAAGG + Exonic
1146701789 17:34967414-34967436 AACTAGTGCATTAGATTTGAGGG - Intronic
1146749692 17:35367385-35367407 AGCTCTTTCCTTAGGATTAAAGG + Intronic
1151248469 17:72814964-72814986 TGCCAATTCCTTAGGATTGAAGG - Intronic
1153568637 18:6445974-6445996 AGCGATTTCCTTAGGCTTGGGGG - Intergenic
1157220093 18:45823250-45823272 AGCTTGGTCCTGAGGTTTTAAGG + Intergenic
1158864972 18:61629786-61629808 AGCTATTTCTTTACTTTTGAAGG - Intergenic
1158929585 18:62310495-62310517 TGCTGGTACCTTAGTTTTGAAGG - Intergenic
1165998148 19:39859917-39859939 AGCCACCTCCTTAGGTTTTAAGG + Intergenic
1167954274 19:53051601-53051623 TGCTAGTGCCTTAGTTTTTATGG - Intergenic
926385767 2:12334329-12334351 ACATTGTTACTTAGGTTTGATGG + Intergenic
926442333 2:12902866-12902888 AGCTCTGTCCTTTGGTTTGAAGG - Intergenic
927419516 2:22915627-22915649 AGGTAATTCATTAGGTTTCATGG - Intergenic
929284466 2:40119596-40119618 AACTACTGCCTTGGGTTTGAAGG + Intronic
933019246 2:77170380-77170402 ATCTAGTTCCTTATGGTTGTAGG - Intronic
939577192 2:143909760-143909782 AGCTAATTCCCAACGTTTGACGG - Intergenic
940689270 2:156894844-156894866 AGCAAATTCCTTAGGTTCAAAGG - Intergenic
943741089 2:191410043-191410065 ATCTAGTTCCTTATGTTGTATGG - Intronic
945160446 2:206884933-206884955 AGCTATTTTCTTAGGTTGGAGGG - Intergenic
945676753 2:212864145-212864167 AGATAGTTCCTTGGCTTAGAGGG + Intergenic
1171051988 20:21867931-21867953 CAGTAGTTCCTTAGCTTTGAAGG + Intergenic
1171298754 20:24041302-24041324 AGCTAATTTCCTAGGTTAGAAGG + Intergenic
1180114709 21:45693793-45693815 AGCAAGTTCTTTAGGTTGAAAGG + Intronic
1182407984 22:30154471-30154493 AGCTGATTCCTCAGTTTTGATGG - Intronic
1182701812 22:32246278-32246300 AACTAGCTGCTTAGGTTAGATGG - Intronic
955388562 3:58500455-58500477 AGTTTGTTCCTTTTGTTTGAGGG + Intronic
955900240 3:63745881-63745903 AGCTAGGTCCTTAGGTACAAGGG - Intergenic
956340255 3:68214592-68214614 AGCAAGTTCCTTAGTTTTTCTGG + Intronic
964062955 3:152546729-152546751 AGCTAATTCCTCAGGTCTGGTGG - Intergenic
966921545 3:184615002-184615024 ATCTAGTTCCATAGATTTGAGGG + Intronic
971514541 4:27469890-27469912 AGTTAGTTACTTAGTTTTTAAGG + Intergenic
975415018 4:74095917-74095939 TGCTAGTTACTTATATTTGAAGG + Intergenic
976502140 4:85803549-85803571 ATCTATTTCCTTATGTTTTATGG + Intronic
980325727 4:131342550-131342572 AGCTAGTTGCTTAGCATTGCTGG - Intergenic
982376679 4:154698554-154698576 TGCCAGTTCCTCAGCTTTGATGG + Intronic
982634073 4:157870099-157870121 ATCTAGTTCCTTATGGTTGCAGG + Intergenic
983313956 4:166102475-166102497 AGCACCTTCCTTAGGTTTCATGG + Exonic
985936173 5:3100229-3100251 AGGTGGTTCCTTAGGTGAGAGGG - Intergenic
986639936 5:9862357-9862379 AGCTAGTACCTTTAGTTTGTGGG + Intergenic
996770801 5:127083403-127083425 TGCCAGTTACTTAGGTTTTAAGG - Intergenic
999514302 5:152285569-152285591 AGCTAGTCCCTTGGCTTAGAAGG - Intergenic
999993999 5:157074648-157074670 AGATAGTTACTTAGATTTGGTGG + Intergenic
1009714858 6:67378205-67378227 AACTAGTTCCTTACCTTTGCTGG + Intergenic
1010369126 6:75087497-75087519 ATGAAGTTCCTTAGGATTGAAGG - Intronic
1011534482 6:88361370-88361392 AGCAAGTTCCCTAGGTTATATGG + Intergenic
1013736681 6:113235302-113235324 AGCTATGTCCTTAGCTCTGAGGG - Intergenic
1014936079 6:127386600-127386622 AGTTAATTCCTTTGTTTTGAAGG - Intergenic
1015180737 6:130359797-130359819 GGCTGTTTCCTTAGGTGTGAAGG + Intronic
1015326974 6:131934155-131934177 ATCTAGTTCCTAAGGGTTGAAGG - Intergenic
1019175961 6:170159694-170159716 AGCTGGCTCCTGGGGTTTGAGGG - Intergenic
1022399257 7:30021500-30021522 AATTATTCCCTTAGGTTTGAAGG + Intronic
1024662479 7:51511443-51511465 AGCTCGTTCCTTCCGATTGAGGG - Intergenic
1024994324 7:55260679-55260701 TGCTATTTCCTTTGATTTGAGGG + Intergenic
1026527319 7:71165825-71165847 AGCTAGTTCCTTAGGTTTGAAGG + Intronic
1026672633 7:72403216-72403238 ATCTAGGTCCTTGGGTTTGGGGG + Intronic
1028170148 7:87586423-87586445 AGCTAGTTCCTTGAGTTATAGGG - Intronic
1028918093 7:96281891-96281913 AGGTTGCTCCTTAGGATTGATGG + Intronic
1032535003 7:132655747-132655769 AGCTGGTTCATCAGGCTTGATGG + Intronic
1034777665 7:153845281-153845303 AGCTAGATTATTAGGTTTAAAGG + Intergenic
1034869438 7:154670583-154670605 AGAAAGTCCCTCAGGTTTGAAGG + Intronic
1035495911 7:159325961-159325983 AGCAAGCTCCTTAGATGTGAGGG - Intergenic
1038709697 8:29931848-29931870 TTCTAGTTCCTTAAGTTAGACGG - Intergenic
1043306171 8:78799243-78799265 TATTAGTTCCTTGGGTTTGAAGG - Intronic
1045137591 8:99238022-99238044 AGTTCCTTCCTTAGGTTTGTGGG + Intronic
1046136775 8:110037638-110037660 AGCTAGGGCCTTGGGTTGGATGG - Intergenic
1055100822 9:72463198-72463220 AACTAGTTCCATAGGATTAAGGG - Intergenic
1055722046 9:79186066-79186088 AGCTAATGCATTAGCTTTGAGGG - Intergenic
1055925062 9:81501506-81501528 ACCTACCTCATTAGGTTTGAGGG - Intergenic
1187083184 X:16013001-16013023 ATCTACTTCTTCAGGTTTGATGG - Intergenic
1190319110 X:49169445-49169467 AGCTCTTTCCTTAGTTTTGAGGG + Intergenic
1193659417 X:84238798-84238820 AACTATTTCCTTAGGTGTAATGG + Intergenic
1195792582 X:108604875-108604897 AGCTGGTTCGTGAGGTTTAAGGG - Intronic
1196975231 X:121151789-121151811 GTCTATTTCCTTTGGTTTGAGGG - Intergenic
1197523298 X:127526911-127526933 TGCTAGTTTCTTAAGTTTGAAGG - Intergenic
1199654567 X:149981563-149981585 GGCCCGTTTCTTAGGTTTGAAGG - Intergenic
1201248281 Y:12028887-12028909 AACTTGTGCTTTAGGTTTGAGGG - Intergenic