ID: 1026528019

View in Genome Browser
Species Human (GRCh38)
Location 7:71172640-71172662
Sequence CTGTGGAGTGGGAGCTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026528011_1026528019 2 Left 1026528011 7:71172615-71172637 CCAGAAGACACCGTAAGGACCAC 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1026528019 7:71172640-71172662 CTGTGGAGTGGGAGCTACCAGGG No data
1026528013_1026528019 -8 Left 1026528013 7:71172625-71172647 CCGTAAGGACCACTCCTGTGGAG 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1026528019 7:71172640-71172662 CTGTGGAGTGGGAGCTACCAGGG No data
1026528009_1026528019 20 Left 1026528009 7:71172597-71172619 CCATCACAACTGCTCAGTCCAGA 0: 1
1: 0
2: 2
3: 14
4: 195
Right 1026528019 7:71172640-71172662 CTGTGGAGTGGGAGCTACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026528019 Original CRISPR CTGTGGAGTGGGAGCTACCA GGG Intronic
No off target data available for this crispr