ID: 1026529522

View in Genome Browser
Species Human (GRCh38)
Location 7:71185046-71185068
Sequence AAGCAGAAGGAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6565
Summary {0: 2, 1: 53, 2: 312, 3: 1395, 4: 4803}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026529522 Original CRISPR AAGCAGAAGGAGGAGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr