ID: 1026531391

View in Genome Browser
Species Human (GRCh38)
Location 7:71200455-71200477
Sequence ACTGGTGTAAATGGTTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026531387_1026531391 -5 Left 1026531387 7:71200437-71200459 CCAGGTGACTGCATGTCCACTGG 0: 1
1: 0
2: 1
3: 13
4: 163
Right 1026531391 7:71200455-71200477 ACTGGTGTAAATGGTTTTAATGG 0: 1
1: 0
2: 0
3: 18
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026531391 Original CRISPR ACTGGTGTAAATGGTTTTAA TGG Intronic
901113574 1:6819597-6819619 ACTTGTGTAATTTGTTTAAATGG - Intronic
904422674 1:30404329-30404351 GCTGGTTTAAATGCTGTTAAAGG + Intergenic
905056652 1:35100496-35100518 ACTGGTGTAGCTGGGTTTACAGG - Intronic
907772292 1:57477698-57477720 TCTGATGTGACTGGTTTTAAGGG + Intronic
910070393 1:83206802-83206824 ACTGGTGAAAAGGGCATTAATGG - Intergenic
912123458 1:106503289-106503311 ACTGGTTTATGTGGTTTTCATGG - Intergenic
916392603 1:164346952-164346974 ACTGGTGTAAATGGTGAAACTGG + Intergenic
918657028 1:187040173-187040195 AATAATGTAAATAGTTTTAAAGG - Intergenic
923758980 1:236822280-236822302 GCTAGTGTAAATGGTTTTGTGGG + Intronic
1063987718 10:11523950-11523972 ACTGGTGTTAACAGTCTTAATGG + Intronic
1064966830 10:21022599-21022621 AATTGTGTAAAGGGTTTTGAAGG - Intronic
1065946958 10:30613673-30613695 ACTGGTGTATTTGATTTAAAAGG - Intronic
1066160878 10:32726548-32726570 AATGATGAAAATAGTTTTAATGG - Intronic
1066593458 10:37021750-37021772 CCTGGAGTAAGTGATTTTAAAGG - Intergenic
1067412308 10:46075956-46075978 ACTGGTGAACATGCTTTAAAAGG + Intergenic
1070517095 10:77218286-77218308 AATGGTTTAAATGGTTTAAATGG - Intronic
1070517096 10:77218295-77218317 AATGGTTTAAATGGTTTAAATGG - Intronic
1071082983 10:81834968-81834990 ACTTGTGGGAATGATTTTAATGG + Intergenic
1073892121 10:108113840-108113862 ATTGCTTAAAATGGTTTTAAGGG - Intergenic
1075995785 10:126875097-126875119 ACTGGTGTAAAATGTTCTCATGG - Intergenic
1078723085 11:13902048-13902070 ACTGGTGTAAATGCTTTACATGG - Intergenic
1080992047 11:37548177-37548199 ACTGGTTTGAATAGTTTTATTGG - Intergenic
1081729890 11:45363768-45363790 AATGGTGTAACTAGTTCTAAAGG + Intergenic
1084380001 11:68805747-68805769 AGTGGCCTAAATGGTTGTAATGG - Intronic
1085894839 11:80626593-80626615 CCTGGAGTAATTGATTTTAAAGG + Intergenic
1086331337 11:85757159-85757181 AATGTTGGAATTGGTTTTAATGG - Intronic
1086449457 11:86901552-86901574 ACTGGTCTAAAAAGTTATAAAGG + Intronic
1086746455 11:90433514-90433536 AGGGGTGTATATGGTTCTAAAGG + Intergenic
1087368746 11:97253990-97254012 ACTGGTGATAATGGTAATAATGG + Intergenic
1089947368 11:122490829-122490851 ACTGGTATAAATGTTTATATGGG - Intergenic
1090625231 11:128602472-128602494 AGTGGTTTAAATGGTTTAAGTGG + Intergenic
1092257043 12:6932361-6932383 ACTGATGTTAGTGGGTTTAAAGG + Intronic
1092310945 12:7351832-7351854 AATGATGTAAATGGGTCTAAAGG + Intronic
1093295509 12:17384731-17384753 ACAGGTGTATATAGCTTTAAGGG - Intergenic
1093797072 12:23325289-23325311 AAAGGTGAAAATGTTTTTAAAGG + Intergenic
1094268279 12:28583502-28583524 AATGGTATAAATGGTCTAAATGG + Intergenic
1098417822 12:70256381-70256403 TCTGAGGTAAATTGTTTTAAAGG + Intronic
1099921090 12:88957985-88958007 ACTGGCGTAAATGCTTATCATGG + Intergenic
1100124674 12:91408980-91409002 GCTGGTGGAAATGGTTTGAAAGG - Intergenic
1102562871 12:113775102-113775124 ACTGCTCTAAGTGCTTTTAAAGG + Intergenic
1106852328 13:33807719-33807741 GATGGTTTAAATGGTTTGAAAGG - Intergenic
1107066285 13:36217059-36217081 ACTGGTGTAAATTGTGTTGCTGG + Intronic
1107868305 13:44725190-44725212 ACAAGTGAAAATGGTTTTGAAGG - Intergenic
1108840330 13:54605236-54605258 ACTGGGGCTAATAGTTTTAATGG + Intergenic
1109963675 13:69664537-69664559 AGTGGTTAAAATGGTTTAAAAGG - Intergenic
1109973256 13:69798015-69798037 ACTGGTGAGATTTGTTTTAATGG + Intronic
1110167855 13:72465104-72465126 TCTTGTGTAAATTGTTTTACAGG - Intergenic
1111482253 13:88845784-88845806 AATGATATAAATGTTTTTAAGGG - Intergenic
1112078911 13:95945726-95945748 ACTGGTGTAAGAGTTTATAAGGG - Intronic
1112755301 13:102625598-102625620 ACTGGTGTAAGGTGTTTTGAAGG + Intronic
1114394774 14:22347910-22347932 ACTTGTAAAAATGGTTTTAGAGG + Intergenic
1120615384 14:86697771-86697793 GCTCTTGTAAACGGTTTTAATGG + Intergenic
1121385521 14:93519479-93519501 ACTAATGTAAATGGTCTAAAAGG - Intronic
1121388501 14:93553227-93553249 AAAGTTGTAAATGGTTTAAAAGG + Intronic
1126852776 15:52807474-52807496 ACTGTGGTAAATGGTCTTTAAGG + Intergenic
1127085149 15:55417694-55417716 ACAGGTGTATGTGATTTTAAGGG + Intronic
1127251511 15:57243505-57243527 ACTGGTGTTGATGGATTTGACGG - Exonic
1131929582 15:97425954-97425976 ACTGGTTTAACTGTTTTTAATGG - Intergenic
1132534414 16:470887-470909 TCTCATGTAAATGTTTTTAAAGG + Intronic
1136481211 16:30543121-30543143 GCTGCTGTAAGTGGTTGTAAAGG + Intronic
1137816124 16:51399290-51399312 AATGGTGCTAATGATTTTAAAGG + Intergenic
1139774285 16:69305042-69305064 TTTGCTGTAAATGGTTTTGATGG + Exonic
1140447148 16:75039211-75039233 AGTGGCCTAAATGTTTTTAATGG + Intronic
1140898829 16:79349730-79349752 ACAGGTGTAAAAGGTGTTCATGG - Intergenic
1141191207 16:81826098-81826120 ACTGGAGGAATAGGTTTTAAAGG - Intronic
1146109223 17:30072844-30072866 AATGGTTTATATGGTTTCAATGG - Intronic
1147446754 17:40479448-40479470 ACTGATGAAAATGGAGTTAACGG - Intronic
1149335888 17:55635504-55635526 ACTGGTGCAAATGGTTGCACGGG - Intergenic
1150999490 17:70358314-70358336 GCTGGTGTACTTGGTCTTAATGG - Intergenic
1156906190 18:42355073-42355095 TCAGGTGTAAATGGTTTATATGG + Intergenic
925699571 2:6621838-6621860 CCAGGTGTAAATGGCTTTACTGG - Intergenic
925862331 2:8191786-8191808 ATTGGTGTAAATGGATGGAAGGG - Intergenic
925987049 2:9225106-9225128 AATGGTGTTTATGGTTTTTAGGG + Intronic
926077749 2:9955115-9955137 ACTGCTGTTAAGGGTTTTAAAGG - Intronic
927323689 2:21778599-21778621 ACTGGTAGACATGATTTTAAAGG - Intergenic
928641702 2:33305985-33306007 AGTAGAGTAAAAGGTTTTAAGGG - Intronic
932474781 2:71996370-71996392 ACTTGTGTAAATATTTTTATAGG + Intergenic
932963112 2:76438889-76438911 ATTGGTGTTAATGGAATTAAGGG - Intergenic
933244455 2:79959703-79959725 ACTTGTGTAAATGGCTTAGAAGG - Intronic
936929438 2:117772360-117772382 ACTGGTGGAAGAGGTTTGAATGG - Intergenic
940399400 2:153229957-153229979 ACTGGAGCAAATGATTTTACTGG - Intergenic
948108349 2:235433553-235433575 GCAGGTTTAAATGGTTATAAGGG + Intergenic
1169285487 20:4304068-4304090 ACTGGTGAAGATGGCATTAATGG + Intergenic
1169715092 20:8607109-8607131 ACTGTGGTAAATGGTGCTAAGGG - Intronic
1171142869 20:22758241-22758263 TCTGGAGTATATGGGTTTAAAGG + Intergenic
1171921405 20:31101765-31101787 TCGTGTGGAAATGGTTTTAATGG + Intergenic
1171929911 20:31219930-31219952 TCGTGTGGAAATGGTTTTAATGG + Intergenic
1174370517 20:50084133-50084155 AATGGAGTAAATAGTTCTAATGG - Exonic
1177065202 21:16424441-16424463 ACTCGTGAAAATGGTGTCAAAGG + Intergenic
1177185778 21:17794571-17794593 GCTGGTGAAAATGGCTTAAAGGG + Intronic
1177336755 21:19738125-19738147 ACTGGTGTGAATGATTCAAAAGG - Intergenic
1178370356 21:32021930-32021952 ACTGGTCTAACTTGTTATAATGG - Intronic
1178934945 21:36853160-36853182 ACAGGTACAAATGGTCTTAAGGG + Intronic
1179541388 21:42085334-42085356 ACTGGTGAAAATGGACTTCAAGG + Exonic
1182582744 22:31324766-31324788 ACTGGAGTAACTGGGATTAAAGG - Intergenic
1183014343 22:34973523-34973545 ACTGGTGAGGATGGTATTAATGG + Intergenic
1184202398 22:42980026-42980048 ACTTGTTTTAATAGTTTTAATGG - Intronic
953153591 3:40347449-40347471 CCTGATGTAAATGATGTTAATGG + Intergenic
954438082 3:50506483-50506505 CCTGGTATAAGTGGTATTAATGG - Intergenic
955214044 3:56970200-56970222 AATGGTTTAAATGGTTGCAATGG + Intronic
955992068 3:64638642-64638664 ACTGGTATATATGGTGTTACAGG - Intronic
960794695 3:121473096-121473118 AATGGTGTAAAGGTTTATAAAGG - Intronic
962988331 3:140556452-140556474 AGTGATGTACATGGTTTTATGGG - Intronic
963112299 3:141697774-141697796 GCTGCTGTAAGTGGTTGTAAAGG + Intergenic
966057897 3:175718376-175718398 AATGGAGTAAATAGTTCTAATGG - Intronic
966192263 3:177281887-177281909 ACTGCTCTAAATGATTTTAAAGG + Intergenic
969385417 4:6843409-6843431 ACTGATGCAAACGGTTTTTAAGG + Intronic
970631195 4:17947714-17947736 ACTGGAGTTAATGGATTTACTGG - Intronic
970958945 4:21850408-21850430 AATGGTTTAATGGGTTTTAATGG + Intronic
971626475 4:28926590-28926612 TCTGCTGTGAATGTTTTTAAAGG + Intergenic
973815028 4:54611607-54611629 ACTGGTGAAAGTGTGTTTAAAGG - Intergenic
973927506 4:55754208-55754230 AGTTATGTAAGTGGTTTTAAGGG - Intergenic
976148238 4:82065465-82065487 ACTCCTGTACATGGTCTTAATGG - Intergenic
976866339 4:89731950-89731972 AATGGTGTAACTGCTATTAAAGG + Intronic
977944560 4:102896751-102896773 TGTGGTGAAAATGGTTTCAAGGG + Intronic
980064363 4:128168115-128168137 ACTTGGGTAAATGCTTTTGAGGG + Intronic
983292826 4:165827480-165827502 ACTGGTTTAAATGGTCTCAAGGG - Intergenic
984342231 4:178471811-178471833 TCTGTTCTAAATGGTATTAAGGG - Intergenic
984908730 4:184652315-184652337 AGTGATGAAAATGGTTTTAAGGG + Intronic
986636379 5:9825947-9825969 ACAGGGGTAAATGTTATTAAAGG + Intergenic
987964706 5:24856445-24856467 AATGGTGTAAATGCTTTTATAGG - Intergenic
988996286 5:36717862-36717884 ACTTTTGTAAAAGGTTTGAAAGG + Intergenic
989689949 5:44130281-44130303 ATTGGTTTAAATGGTGTTATTGG + Intergenic
990336686 5:54779915-54779937 ACAGGTGTAAATACTGTTAAAGG + Intergenic
991487816 5:67156129-67156151 ACTCTTGTCAATGGTTTTACGGG + Intronic
991656317 5:68907498-68907520 ACTGGGGTTAAAAGTTTTAAAGG - Intergenic
993542422 5:89168719-89168741 ACGAGTGTGAATGGGTTTAAGGG - Intergenic
994201419 5:96980487-96980509 TCTGGTGTAAATTTTTTTTAAGG + Intronic
994911049 5:105907976-105907998 ACTAGTTTAAATGGTTATGATGG - Intergenic
997622858 5:135310603-135310625 ACTGTTGACAATGTTTTTAATGG - Intronic
1002901565 6:1414349-1414371 AATGGAGTAATTGATTTTAATGG - Intergenic
1002929242 6:1622019-1622041 CCTGGTGTATGTGGTTTAAAAGG - Intergenic
1004111414 6:12722268-12722290 ACAGATGTAAATGTTTTTAAAGG + Intronic
1005516958 6:26564213-26564235 CCTGGTGTTAATGGTGGTAATGG - Intergenic
1008438370 6:51502922-51502944 AGTGGTGGAATTGGTTTAAACGG + Intergenic
1009786285 6:68344086-68344108 TCTGGTGGAAGTGGTGTTAATGG - Intergenic
1012726165 6:102813640-102813662 CCTGGTGTAACTGGTTATACAGG + Intergenic
1012836499 6:104276113-104276135 AATAATGTCAATGGTTTTAATGG - Intergenic
1014410334 6:121109707-121109729 TCCGGTGTAAATGATTTCAAAGG + Intronic
1020038506 7:4982306-4982328 ACTGATGACAATGGTTTTAAAGG + Intergenic
1020156798 7:5732158-5732180 ACTGATGACAATGGTTTTATAGG - Intronic
1020484011 7:8698177-8698199 ATTGGTGTAAATGTTTGTCATGG - Intronic
1021830385 7:24601758-24601780 CCTGGGGGAAATGTTTTTAAAGG + Intronic
1022771925 7:33482738-33482760 ACTGGCAGAAATGGGTTTAAAGG + Intronic
1024163227 7:46701991-46702013 ATTGGTTTAAATGATTATAATGG - Intronic
1026531391 7:71200455-71200477 ACTGGTGTAAATGGTTTTAATGG + Intronic
1027288109 7:76671662-76671684 ACTGGTGAAAAGGGCATTAATGG - Intergenic
1027413921 7:77953581-77953603 AATAGTTTTAATGGTTTTAAAGG - Intronic
1028340493 7:89713370-89713392 ACTGCTCTAAATAGTATTAAAGG - Intergenic
1029105735 7:98174069-98174091 ACAGCTGTCAATGGTTTCAAGGG - Intronic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1030774625 7:113518618-113518640 ACAGTTTTAAATGGTTTTAAAGG - Intergenic
1030839954 7:114337623-114337645 ACTGGGGTAAATGGTTTACTTGG + Intronic
1030917494 7:115334227-115334249 AATGGTGTACAGTGTTTTAACGG - Intergenic
1030969481 7:116037166-116037188 ACTGGTACAAATCTTTTTAACGG + Intronic
1030973622 7:116092964-116092986 ACTGGTTTAAATTGTTGTAAGGG - Intronic
1033419952 7:141196790-141196812 ATTGGTGTAATTGGTCTTCAAGG + Intronic
1034490540 7:151391003-151391025 AATGCTGAAAATGGTTTAAAGGG + Intronic
1038806329 8:30795689-30795711 CCAGGTGTAAATAGTTTTATAGG - Intronic
1039556622 8:38480860-38480882 ACTATGGTAAATGGTTTTATAGG + Intergenic
1040498879 8:47990369-47990391 GCTGGTGTAAGTGGTTGTAAAGG + Intergenic
1041185191 8:55292265-55292287 CCAGGTCTAAATGGTTTTATTGG - Intronic
1041473297 8:58234844-58234866 ACTGGAGACAATTGTTTTAAGGG + Intergenic
1042927932 8:73985931-73985953 AATTGTTTAAATGGTTTTTAAGG + Intergenic
1043355910 8:79412438-79412460 ACTGTTTTAAATGTTTTGAATGG + Intergenic
1044235731 8:89827995-89828017 ACTGATGTAACTTGTCTTAATGG + Intergenic
1044411316 8:91886701-91886723 AATGGTGTAAATGCTTTGAGAGG - Intergenic
1044776216 8:95691334-95691356 AATGTTGTGAATGGTATTAATGG + Intergenic
1046870529 8:119200661-119200683 AATGGTGTAAAGGGATTTGAAGG - Intronic
1047638585 8:126794175-126794197 ACTTCTGTAAATGTTGTTAAGGG + Intergenic
1049459823 8:142721142-142721164 ACTTGTGAAATTGGATTTAAGGG + Intergenic
1051203177 9:14653516-14653538 ACTGGAATAATTGGTTTTAAGGG - Intronic
1051403222 9:16706123-16706145 ACTGTTGTGATTGGTTATAAAGG - Intronic
1053543996 9:39003832-39003854 ACAGGTCAAAATGGTGTTAATGG + Intergenic
1053808430 9:41827329-41827351 ACAGGTCAAAATGGTGTTAATGG + Intergenic
1054622162 9:67360099-67360121 ACAGGTCAAAATGGTGTTAATGG - Intergenic
1055212133 9:73808971-73808993 ACGGATGTAAATGGTGTGAATGG + Intergenic
1055545028 9:77361543-77361565 ACTGGTGTACAAGTTTTTATTGG + Intronic
1058059034 9:100475342-100475364 ACGGATGGAAATGCTTTTAATGG - Intronic
1058273565 9:103008164-103008186 ATTGGTGAAAATAATTTTAAGGG - Intronic
1060233551 9:121843299-121843321 ACAGGTCTCAATGGTTTTTAGGG - Intronic
1186178431 X:6949428-6949450 AGTGGTGTATATGGGTTTAAGGG - Intergenic
1187323617 X:18265888-18265910 ACCTTTGGAAATGGTTTTAAAGG - Intronic
1189080638 X:37968411-37968433 TCTGGTGAAAAGGGTTTGAAAGG + Intronic
1189624867 X:42886173-42886195 ACTATGGTAAAGGGTTTTAAAGG + Intergenic
1189631404 X:42957784-42957806 ACCTGTATAAATGGTTTCAAGGG + Intergenic
1191661271 X:63653763-63653785 ATTTGTTTAAATGGTTATAATGG + Intronic
1192862471 X:75090995-75091017 ACTGGTCCAAATGGTTTCACTGG + Intronic
1195625014 X:106999030-106999052 ACTGGTGTAATTGGCTTGAAGGG + Intronic
1195793866 X:108621871-108621893 AGTGGTGTACCTGGTCTTAAAGG + Exonic
1196288209 X:113907390-113907412 ACTGATGTTGATGGTTGTAATGG - Intergenic
1198141836 X:133812183-133812205 ACTGATATAAATGGGTCTAAAGG + Intronic
1199067142 X:143432742-143432764 AATGGTGTAACTGCTATTAATGG + Intergenic
1199323788 X:146472963-146472985 AATGGTGTCAGTGGTTTTCAAGG - Intergenic
1200828826 Y:7670229-7670251 AAGGGTGTAAATAATTTTAAAGG - Intergenic