ID: 1026532980

View in Genome Browser
Species Human (GRCh38)
Location 7:71215845-71215867
Sequence CAAAATGCTTGTATTGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026532974_1026532980 10 Left 1026532974 7:71215812-71215834 CCCTTCACAATCTTACAATTTAT 0: 1
1: 1
2: 3
3: 31
4: 436
Right 1026532980 7:71215845-71215867 CAAAATGCTTGTATTGAGATAGG No data
1026532975_1026532980 9 Left 1026532975 7:71215813-71215835 CCTTCACAATCTTACAATTTATT 0: 1
1: 1
2: 2
3: 42
4: 437
Right 1026532980 7:71215845-71215867 CAAAATGCTTGTATTGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026532980 Original CRISPR CAAAATGCTTGTATTGAGAT AGG Intronic
No off target data available for this crispr