ID: 1026534369

View in Genome Browser
Species Human (GRCh38)
Location 7:71228022-71228044
Sequence GGCCTGAGAGGACCCCAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026534367_1026534369 -3 Left 1026534367 7:71228002-71228024 CCGATAGAGGAGGAGACAGTGGC 0: 1
1: 1
2: 0
3: 12
4: 221
Right 1026534369 7:71228022-71228044 GGCCTGAGAGGACCCCAGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 183
1026534361_1026534369 25 Left 1026534361 7:71227974-71227996 CCCTGGATATGCATAGGAGTAAT 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1026534369 7:71228022-71228044 GGCCTGAGAGGACCCCAGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 183
1026534365_1026534369 -2 Left 1026534365 7:71228001-71228023 CCCGATAGAGGAGGAGACAGTGG 0: 1
1: 0
2: 0
3: 28
4: 255
Right 1026534369 7:71228022-71228044 GGCCTGAGAGGACCCCAGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 183
1026534362_1026534369 24 Left 1026534362 7:71227975-71227997 CCTGGATATGCATAGGAGTAATT 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1026534369 7:71228022-71228044 GGCCTGAGAGGACCCCAGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026534369 Original CRISPR GGCCTGAGAGGACCCCAGTT TGG Intronic
900056428 1:634426-634448 GGGCTGAGAGGGCCCCTGTTAGG - Intergenic
900403612 1:2482960-2482982 GGCCTGCGAGGAGCCCAGAGTGG - Intronic
900529089 1:3144082-3144104 GGCCTGTGCAGACCCCAGCTTGG + Intronic
900566591 1:3335200-3335222 GGCCTGAGAGGAAGCGTGTTTGG + Intronic
900797124 1:4714860-4714882 GGGCTATGAGGAACCCAGTTAGG - Intronic
901691573 1:10976803-10976825 AGCCTGAGAGGACCTCTGATGGG + Intronic
902585878 1:17438466-17438488 GGCCTGGGAGGAGCCGAGCTCGG - Exonic
902776097 1:18675967-18675989 GTCCTGAGCGGACCCCGGCTTGG - Intronic
906508918 1:46400234-46400256 AGTCTGAGAGGACCACAGCTTGG + Intronic
907310343 1:53535480-53535502 GGACTGAGAGGCCCCAAGGTGGG - Intronic
908145617 1:61238626-61238648 AGCCTGAGAAGACCTAAGTTTGG + Intronic
908250134 1:62259124-62259146 AGCCAGACAGGACCCAAGTTAGG + Intronic
908845263 1:68318210-68318232 AGCCTGACATGACACCAGTTAGG - Intergenic
910451943 1:87356100-87356122 GGCCTAAGAGGGCCCATGTTAGG - Intergenic
915033418 1:152903109-152903131 GGGCTGTGAGGAGCACAGTTTGG - Intergenic
915355578 1:155253789-155253811 GGCCTGTGAGTACCCCAGCAGGG + Intronic
917170307 1:172165568-172165590 GGTCAGGGAGGAGCCCAGTTTGG - Intronic
918197484 1:182235750-182235772 GGCCTCACAGCACCACAGTTAGG + Intergenic
919799740 1:201346430-201346452 GGACTGAGAAGCCTCCAGTTTGG + Intergenic
919804515 1:201373170-201373192 GGCGGGAGAGGACCCCACTCAGG + Intronic
919921009 1:202166396-202166418 CAGCTGAGAGGACCCCAATTTGG + Intergenic
919982372 1:202650278-202650300 TGCCTGAGAGGACCCCAGAAAGG + Intronic
920367402 1:205455406-205455428 GGCCCCAGGAGACCCCAGTTTGG - Intronic
922822781 1:228495312-228495334 GGTCAGAGAGGAACCCAGTCAGG + Exonic
923338742 1:232990810-232990832 GGCCTGTGCAGGCCCCAGTTTGG - Intronic
1062946014 10:1462475-1462497 GGCTTGAGAGTTGCCCAGTTAGG + Intronic
1065276184 10:24088217-24088239 AGCCTGGGAGGACACAAGTTTGG - Intronic
1065814105 10:29469459-29469481 GACCTGTGAGGACCTCAGTGAGG - Intronic
1068933337 10:62613316-62613338 GGCCTTAGAGGACCCAAGGCTGG + Intronic
1070530314 10:77331204-77331226 GGCCTGAGAGTATGCCAGCTGGG - Intronic
1070713125 10:78697840-78697862 GGCCTGGTTGCACCCCAGTTTGG + Intergenic
1071471392 10:85986465-85986487 GGCCTGATAGGAGGCCAGCTGGG + Intronic
1072038562 10:91586492-91586514 GGCCTGAGAGAAGCCAAGGTGGG - Intergenic
1073358555 10:102877353-102877375 GGACTAAGAGGACACCAGCTTGG - Intronic
1074489857 10:113929905-113929927 GGCCAGAGAGGAATCCATTTAGG + Intergenic
1076526652 10:131116432-131116454 GGCCTGAGAGGCCGGCAGGTGGG - Intronic
1076786200 10:132751285-132751307 GGCCTGACCCGACCCCAGTGGGG - Intronic
1076802318 10:132836290-132836312 GACCTCAGAGGAGCCCAGTGAGG + Intronic
1077170641 11:1164489-1164511 GGCCTGTGAGGACCACTGTGTGG + Exonic
1077444431 11:2583738-2583760 TGCCTGCAAGGACCCCAGTGGGG - Intronic
1078933289 11:15929701-15929723 GGCCTGAGTGGACCCGGGTCAGG - Intergenic
1079042079 11:17068242-17068264 GGCCTGAGAGGGGCCCAGCTGGG + Intergenic
1084314336 11:68335854-68335876 GGCCTCAGTTGACCTCAGTTTGG + Intronic
1088734764 11:112719539-112719561 GGCCTGAAGGGAACCCATTTTGG + Intergenic
1089453094 11:118610435-118610457 CGGCCGAGAGGACCCCAGCTCGG + Intronic
1089656211 11:119948708-119948730 GGCTTGAGAGGCCACCAGTGGGG - Intergenic
1089732361 11:120527225-120527247 GGCCTGGCAGGACCCCAGCAGGG - Intronic
1091358510 11:134956681-134956703 GGCCTCAGAGGATTGCAGTTTGG - Intergenic
1091920450 12:4300001-4300023 GACCTGTGAGGATGCCAGTTGGG + Exonic
1094677487 12:32635198-32635220 TGCCTGAGAAAGCCCCAGTTTGG - Intronic
1096195367 12:49646033-49646055 GGCTTGAGGGGTACCCAGTTGGG + Intronic
1101866170 12:108521542-108521564 GGCTTGAGCAGAACCCAGTTAGG - Intronic
1102438909 12:112946651-112946673 GGCCTGGAAGGTCCCCAGTCTGG + Intronic
1104854518 12:131895500-131895522 GCCCTGAGATGATCCCGGTTGGG - Intronic
1105786816 13:23758168-23758190 GGCCTCAGAGCACCCCAGGTCGG - Intronic
1107872917 13:44763653-44763675 TGCCTGAGAGGCCACCAGGTTGG + Intergenic
1111364439 13:87223604-87223626 GGACTGAGGGGATCCCAGCTGGG - Intergenic
1112509043 13:99991989-99992011 GGCCTGGGAGGAGCCCAAGTTGG - Intergenic
1115975661 14:38993728-38993750 TGGGTGAGCGGACCCCAGTTTGG + Intergenic
1116456167 14:45123257-45123279 GGTCTCAGAGGACCCTAGCTAGG - Intronic
1118167869 14:63355937-63355959 AGGGTGAGAGGACACCAGTTGGG - Intergenic
1122717829 14:103706065-103706087 GGCGTGAGCAGACCCCAGCTGGG + Intronic
1202904287 14_GL000194v1_random:59599-59621 AGCCTGAGAGGACCCTGGCTGGG - Intergenic
1125579162 15:40773655-40773677 AGCCTGAGAGGAGCCCAGGTAGG + Intronic
1129879195 15:78995993-78996015 GGGCTGAGAGGGCCCCAGAAGGG - Intronic
1130899279 15:88194858-88194880 GTCCTGAGAGGAGACCAGTGAGG - Intronic
1132255703 15:100373923-100373945 GGGCGGTGAGGACCCCAGTGGGG + Intergenic
1132641139 16:979184-979206 GGCCTGAGAGGACGCCGGGACGG - Intronic
1132668273 16:1091591-1091613 GGGCAGAGAGGGCCCCATTTGGG - Intronic
1132980579 16:2736907-2736929 GGTCTGAGATGACCCAAGCTGGG + Intergenic
1133433382 16:5758051-5758073 AGCCTGACGGGACCCAAGTTGGG + Intergenic
1137054014 16:35734890-35734912 AGCCTCAGGGTACCCCAGTTCGG + Intergenic
1138425874 16:56931840-56931862 GACCTGCGAGGCCCCCAGCTCGG - Intergenic
1141689694 16:85589125-85589147 GGCCTGAAAAGTCCCCAGCTGGG - Intergenic
1142771669 17:2102102-2102124 TGCCTGAGAGCACACAAGTTAGG - Intronic
1143247980 17:5501732-5501754 GGCCTGAGTAGACCGCAGGTGGG - Intronic
1143464368 17:7126049-7126071 GCCCTCAGAGAACTCCAGTTAGG - Intergenic
1143857531 17:9863223-9863245 GTCCAGACAGGACCCCAGCTGGG - Intronic
1145001054 17:19304870-19304892 GGCGTGAGAAGACCCCATGTGGG - Intronic
1145797457 17:27664116-27664138 GAGCTGAGAGGCCCCCAGGTGGG + Intergenic
1145811854 17:27769052-27769074 GAGCTGAGAGGCCCCCAGGTGGG + Exonic
1147419634 17:40316068-40316090 GGCAGGAGAGGTCCCCAGGTGGG - Intronic
1149997947 17:61414668-61414690 GGCCTGCAAGGACCCCTGGTCGG + Intergenic
1150822366 17:68445831-68445853 GGCCTGAGGGGAGCCAAGTCAGG - Intronic
1151258339 17:72897205-72897227 GAACTGAGAGGACCCCAGTGGGG + Intronic
1152259709 17:79260377-79260399 GCCCTGAGTGGAACCCAGATGGG + Intronic
1154385956 18:13892075-13892097 GTCCTGAGAGGACCAGAGTCTGG + Intronic
1154496441 18:14964537-14964559 GGCCTCAGAGGATTGCAGTTTGG + Intergenic
1155845101 18:30695674-30695696 AGACTGAGAGGTCCTCAGTTTGG + Intergenic
1156470863 18:37376562-37376584 GGCTTGAGAGAACCCCAGGAAGG + Intronic
1158216770 18:55108865-55108887 GGAATGAGAGGAGCCCAGTGGGG - Intergenic
1159680096 18:71338635-71338657 GGCCTTGGAGGACCTCAGTGTGG - Intergenic
1161017815 19:1991834-1991856 GATCTCAGGGGACCCCAGTTGGG - Intronic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1161255747 19:3308303-3308325 GGGCTGTGAGCACCCGAGTTAGG + Intergenic
1163832776 19:19554947-19554969 GGCCTGTGAGGGTCCCAGGTAGG + Intergenic
1165443384 19:35843644-35843666 GGTGTGAGAGGGCCCCAGGTGGG + Intronic
1165732837 19:38157531-38157553 GGCCTCAGAGCACCCAGGTTGGG + Intronic
1165773276 19:38390329-38390351 GGCCCGAGATGACTCCAGTGGGG + Exonic
925838783 2:7970989-7971011 GGACTGAGAGGACCACAGGGTGG + Intergenic
926754832 2:16226504-16226526 GGCCTGACAGGACCTCTGTGAGG + Intergenic
927326293 2:21809626-21809648 GGTCTGAGAGGAAGGCAGTTTGG - Intergenic
930029039 2:47047222-47047244 GGCCTCAGGGGACCCCAGTCTGG + Intronic
934504395 2:94879667-94879689 GGCCTGAGAACAGCCCAGTGTGG - Intergenic
937319523 2:120952731-120952753 GGCCTCAGGGCACCCCAGCTTGG - Intronic
937863589 2:126731884-126731906 GGCCTGAGAGCAGCCCAGGGTGG - Intergenic
938341909 2:130541430-130541452 GGCCTGGAAGGACCCCAGAAGGG + Intronic
938347923 2:130579281-130579303 GGCCTGGAAGGACCCCAGAAGGG - Intronic
938698013 2:133852146-133852168 GTCCTGGGAGGAACCCAGTGGGG + Intergenic
942512646 2:176718578-176718600 GGACTCAGAGGAATCCAGTTGGG - Intergenic
943226477 2:185185251-185185273 GGCCTGAGAGCAGCTCAGTGTGG + Intergenic
1172029176 20:31969305-31969327 AGCCTGAGGGCTCCCCAGTTGGG - Intronic
1176243211 20:64084541-64084563 GGCCTGAGATCAACCCAGTGGGG - Intronic
1179885121 21:44310564-44310586 TGCCTGGGAGGACTCCAGTGGGG + Intronic
1181635560 22:24172823-24172845 GGCCTGAGCTGAACCCAGTCTGG - Intronic
1181669817 22:24420835-24420857 GGCCAGGGAGGAGCCCAGTAGGG + Intronic
1182117480 22:27765541-27765563 GGCCTCTGAGGACCCCCGTGTGG + Intronic
1182555296 22:31125720-31125742 GGCCTGAGGGGGCCCCAGGCCGG - Exonic
1183976624 22:41515960-41515982 GGCCTGATGGGTCTCCAGTTGGG + Intronic
1185224044 22:49643097-49643119 AGCCTGAGTGGACGCCAGCTGGG + Intronic
1185331768 22:50255152-50255174 GGCCTGTGTGGACCCAAGTGGGG - Intronic
949279474 3:2329341-2329363 GGCCTGAGAGGCTCACAATTTGG - Intronic
953608729 3:44429380-44429402 GGCCTGTGAGGACCCCATGTGGG - Intergenic
953733103 3:45466680-45466702 GGACTGAGGAGACCCAAGTTGGG - Intronic
954451897 3:50576177-50576199 GGCTTGAGAGGCCCCCAGGGAGG - Intronic
954713345 3:52515568-52515590 GCCCAGGGAGGAGCCCAGTTTGG + Intronic
961474561 3:127138562-127138584 GGCCTGTAAGGCCCCCAGGTGGG - Intergenic
962608917 3:137056523-137056545 GGCCTCAGAGGGCCCCTGTCTGG - Intergenic
962971372 3:140404773-140404795 GACCTCAGAGGACCCCTGTGGGG + Intronic
965813555 3:172614937-172614959 GGCCAGAGAGGGACCCAGTGAGG - Intergenic
966773385 3:183523427-183523449 GGCCTGAGAAGAGCCCAGGAGGG - Intronic
966929894 3:184669535-184669557 GGCTTGGGAGGAGCCCGGTTTGG + Intronic
969262656 4:6043564-6043586 GGCCTGCCAGGACCCCTGATGGG + Intronic
969652925 4:8478329-8478351 GGCCTGGCAGGACCCCACCTGGG - Intronic
969921324 4:10543047-10543069 GGCCTGTGAACACCCCAGCTAGG - Intronic
969990054 4:11252984-11253006 GGCCTGAGAGGACTCCTGAGAGG + Intergenic
970290794 4:14569952-14569974 GGCCTGTGATGACCTCACTTTGG - Intergenic
971835634 4:31759837-31759859 GGCCTGAGAGGTCCACAGCATGG - Intergenic
973741853 4:53926235-53926257 GGCCTGAGGGGTCCCCCGCTTGG - Intronic
980075321 4:128287858-128287880 TGGCTGAGAGGCCCCCAGATGGG - Exonic
981367490 4:143920059-143920081 GGCCACAGAGGCCCCTAGTTAGG - Intergenic
981625413 4:146748708-146748730 GGCCTGAGACAATGCCAGTTGGG - Intronic
983815903 4:172126798-172126820 GGACTGTTGGGACCCCAGTTAGG - Intronic
985727727 5:1524558-1524580 GGCCTGAGAGGTCCTGAGATCGG - Intergenic
994245552 5:97471767-97471789 GGCCAGAGAGGGGCCCAGTGAGG - Intergenic
994459191 5:100051845-100051867 GGGCTGAGAGGGCCCCCGTTAGG + Intergenic
995234688 5:109814299-109814321 GGCCTGAAAGGACTCATGTTTGG + Intronic
996386630 5:122915737-122915759 GGCCTGTGAGGCCCTCAGTGTGG + Intronic
997468667 5:134104525-134104547 GGCCTGAGGGGCCCCCAGGGTGG - Intergenic
998164915 5:139837361-139837383 GCCCTGAGAGGGCCCAAGTCTGG - Intronic
999112970 5:149138034-149138056 AGCTTGAGATGACCCCAGTTAGG + Intergenic
1002310768 5:178312514-178312536 GGCCTCAGAGGAAGCCTGTTGGG - Intronic
1003330200 6:5123158-5123180 GGCCTGACAGGGCCTCAGCTGGG + Intronic
1005990444 6:30898782-30898804 GGCCTGAGTGGAGCCCAGAGTGG + Intronic
1007237990 6:40404899-40404921 GGCCTGAGAGAATCCCAGAGAGG - Intronic
1007718303 6:43870013-43870035 GGCCTGAGAGGGCCCAAGCACGG - Intergenic
1008886227 6:56433381-56433403 GGCCTGGGAGGAGCCGAGCTCGG - Intergenic
1012818720 6:104057796-104057818 GGCCTGGGGAGGCCCCAGTTGGG + Intergenic
1015945413 6:138495367-138495389 AGGCTCAGAGGAGCCCAGTTGGG + Intronic
1017515464 6:155152348-155152370 GGCCTGAGAGGAGGCAAGCTGGG - Intronic
1018811154 6:167299402-167299424 GGCCTGAGGGGACCTGAGGTTGG - Intronic
1026223911 7:68424196-68424218 AGCATGAATGGACCCCAGTTTGG - Intergenic
1026534369 7:71228022-71228044 GGCCTGAGAGGACCCCAGTTTGG + Intronic
1035461296 7:159040829-159040851 GGCCAGAGAGGAGCCAAGCTGGG - Intronic
1037589326 8:20300108-20300130 GGCCTGAGATGGCCCCATCTAGG + Intronic
1037801770 8:22039928-22039950 GGCGTGAGACGACCCCAGCTGGG + Intergenic
1037836321 8:22216742-22216764 GGCCAGAAAGGACCCCAGGGCGG + Intergenic
1040768772 8:50948712-50948734 AGACTGAGAGAAGCCCAGTTTGG + Intergenic
1041384014 8:57279827-57279849 AGGAAGAGAGGACCCCAGTTGGG + Intergenic
1044719460 8:95131756-95131778 GGGCTGCGTGCACCCCAGTTTGG - Intergenic
1048973007 8:139655707-139655729 GGTGTGGGAGGAGCCCAGTTTGG - Intronic
1052269728 9:26615112-26615134 GGTCTGAGGGGACCCCAGAATGG + Intergenic
1053114573 9:35489993-35490015 GGCCTGAGGGCAACCCAGATCGG + Intergenic
1054934407 9:70671354-70671376 GGGCTGAGAGGAGCCTAGTGGGG + Intronic
1056831971 9:89924563-89924585 GACCAGAGAAGACTCCAGTTAGG + Intergenic
1057311912 9:93948264-93948286 GGGTTGAGAGGACCACATTTTGG + Intergenic
1060268772 9:122127139-122127161 GGCCTGAGAGAACACAGGTTTGG + Intergenic
1060401608 9:123353026-123353048 GGCCTTAGAGAAACCCAGTGAGG + Intergenic
1060902020 9:127267111-127267133 TGCCTTAGAGGACCTCAGCTAGG + Intronic
1061719302 9:132541997-132542019 GGCCTGAAAGGTCTACAGTTTGG + Intronic
1062192846 9:135256538-135256560 GGACAGAGAGGACCCCAGGGAGG - Intergenic
1202630086 M:9257-9279 GGGCTGAGAGGGCCCCTGTTAGG - Intergenic
1186057709 X:5667545-5667567 TGGGTGAGTGGACCCCAGTTGGG + Intergenic
1189408145 X:40744291-40744313 GTCCAGGGAGGAACCCAGTTGGG - Intergenic
1189629342 X:42934781-42934803 GGGCTGAGGGGACCACAGCTGGG + Intergenic
1190708408 X:53048916-53048938 GGCCTGGGAGAGCCCCAGGTTGG - Intergenic
1192344056 X:70286835-70286857 AGCCTGTGAGGAACCTAGTTAGG - Exonic
1192782485 X:74308182-74308204 GGACTGAGATGGCCCCACTTAGG - Intergenic
1193428377 X:81369108-81369130 GATCTGAGAGGACCACATTTTGG + Intergenic
1193920929 X:87425295-87425317 GGCCTGAGAGGTCCCCGTTTAGG + Intergenic
1194154653 X:90371995-90372017 GGCTTGAAAGAACCCCAGTGTGG - Intergenic
1194917455 X:99723053-99723075 GGTGGCAGAGGACCCCAGTTGGG - Intergenic
1196314831 X:114210448-114210470 TGGATGAGTGGACCCCAGTTAGG + Intergenic
1199047127 X:143187904-143187926 GGCCTCAGAGGAACCTAGTCTGG + Intergenic
1200501006 Y:3948881-3948903 GGCTTGAAAGAACCCCAGTGTGG - Intergenic
1201158166 Y:11150962-11150984 AGCCTGAGAAGAGCCCAGTGTGG + Intergenic
1201160167 Y:11159808-11159830 AGCCTGAGGGGACCCTAGCTGGG - Intergenic