ID: 1026534398

View in Genome Browser
Species Human (GRCh38)
Location 7:71228195-71228217
Sequence CCTGCTTGGCTGGGACATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 261}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026534398_1026534406 -7 Left 1026534398 7:71228195-71228217 CCCTGATGTCCCAGCCAAGCAGG 0: 1
1: 0
2: 0
3: 24
4: 261
Right 1026534406 7:71228211-71228233 AAGCAGGAGTACAGGATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026534398 Original CRISPR CCTGCTTGGCTGGGACATCA GGG (reversed) Intronic
900112407 1:1013977-1013999 CCTGCAGGGCTGGGACCTGACGG + Exonic
900202819 1:1419015-1419037 CCTGCCTGGAGGGGACATCAGGG - Exonic
901001586 1:6151549-6151571 CCTGTCTGACTGGTACATCACGG + Intronic
902370942 1:16006397-16006419 CCTGCTTAGCTGGGGAAGCAGGG - Exonic
902385087 1:16071878-16071900 CCTTCTGGGCTGGGACCCCAAGG + Intronic
903567047 1:24275480-24275502 CCTGCTTGGTGGGGACTGCAGGG - Intergenic
905198577 1:36300816-36300838 ACTGCTTGGCTGGGGCCTCATGG - Intronic
906252439 1:44321109-44321131 CTGGCTTTCCTGGGACATCAAGG - Intronic
908967100 1:69778528-69778550 CCTGCTTTGCTTGGGGATCAGGG + Intronic
911401751 1:97383982-97384004 CCTGAGTGGCTGGGACTACAGGG - Intronic
912996684 1:114537952-114537974 ACTGGTGGGCTGGGACACCAGGG + Intergenic
913559399 1:120002293-120002315 CAGTGTTGGCTGGGACATCAAGG + Intronic
913638463 1:120788249-120788271 CAGTGTTGGCTGGGACATCAAGG - Intergenic
914279993 1:146161736-146161758 CAGTGTTGGCTGGGACATCAAGG + Intronic
914541033 1:148612654-148612676 CAGTGTTGGCTGGGACATCAAGG + Intronic
914625609 1:149458592-149458614 CAGTGTTGGCTGGGACATCAAGG - Intergenic
917336324 1:173927811-173927833 CCTGAGTGGCTGGGACTACAGGG + Intergenic
919465429 1:197918386-197918408 CCTGCTTGGCTCGGACGCCTCGG - Intronic
919787896 1:201271498-201271520 CCTGCTGGGCTGTGACATAATGG - Intergenic
920237031 1:204514798-204514820 CCTGCATAGCTGGGAGATCCAGG - Intergenic
921645479 1:217610893-217610915 TCTGCTTGGGTGTGACATAAGGG + Exonic
922073068 1:222215565-222215587 CCAGGATTGCTGGGACATCAGGG + Intergenic
922570344 1:226631050-226631072 GCTACTTGGCTGGGGCATCCAGG - Intergenic
922637263 1:227186483-227186505 CCTGCTTAGTTGGGACAGGATGG - Intronic
922695221 1:227728099-227728121 CCTGCCGGGCTGGGAGAACAAGG + Intergenic
924162459 1:241246803-241246825 CATGCTTGGATGAAACATCATGG + Intronic
1063427548 10:5961839-5961861 CCTGTGTGGCTGGGAGACCATGG - Intronic
1063460430 10:6212030-6212052 CCTGCTCAGCTCGGACATCAGGG + Intronic
1063756880 10:9021301-9021323 CTAGCTTGCCTGGGACATTAGGG + Intergenic
1065191406 10:23212666-23212688 CCTACTTTGCTGTGACATGAAGG - Intronic
1066701836 10:38137743-38137765 ACAGCTTGGCTGGTACATTATGG - Intergenic
1068509369 10:57944791-57944813 CCTGCTGAGCTGGGACTACAGGG - Intergenic
1068696410 10:59972457-59972479 CCTGAGTAGCTGGGACAACAGGG + Intergenic
1069462958 10:68612212-68612234 CCTGACTAGCTGGGACAACAGGG + Intronic
1071480975 10:86064709-86064731 TCTGATTGGCTGGAGCATCATGG - Intronic
1071492369 10:86144511-86144533 CCTGCTTGCCCGGTACATCCCGG + Intronic
1072478132 10:95783394-95783416 GGTCCTTGGCTGGCACATCAAGG + Intronic
1073009630 10:100349127-100349149 CCTCCTTGCCAGGGACATCGAGG + Intronic
1073514629 10:104065457-104065479 CCTACTTGACTGGGACATGTTGG + Intronic
1075675779 10:124294900-124294922 CCTGCTTGGCTGGCACAGGTGGG + Intergenic
1076433058 10:130420957-130420979 TATGCTTGGCTGGGATGTCAAGG - Intergenic
1077297880 11:1834580-1834602 CCTGCATGGCTGGCAAACCATGG + Exonic
1078146594 11:8725928-8725950 CCTCCTGGAATGGGACATCAGGG - Intronic
1081839061 11:46182689-46182711 GCTTCTTGCCTGGGACCTCATGG - Intergenic
1083655433 11:64226947-64226969 GCTGCCTGGCTGCGACAGCAGGG + Exonic
1087015005 11:93545951-93545973 GCTGCATAGCTGGGACAGCAAGG - Intergenic
1089164951 11:116468684-116468706 CCAGCTTGCCTGGGCCATCAGGG - Intergenic
1091499941 12:1006505-1006527 CCTGCATAGCTGGGACTACAGGG + Intronic
1091916050 12:4272444-4272466 CCAGCTTGGCCAGCACATCAGGG + Intergenic
1093771976 12:23028818-23028840 CCTGCTAGAATGTGACATCAAGG + Intergenic
1098020137 12:66146354-66146376 CCTGCCTGGCTGGGAATTCCTGG + Intronic
1101375219 12:104165579-104165601 CCTGCTTGCCTGGCACAGTAAGG + Intergenic
1102337178 12:112091735-112091757 CCTGCATAGCTGGGACTACAGGG - Intronic
1103928907 12:124438589-124438611 CCTGCTTGGTTGAGACCCCATGG - Intronic
1103958329 12:124592127-124592149 CCTGATTGCCTGGGACTTCCCGG - Intergenic
1104420327 12:128629602-128629624 CCTGCAGGGCTGAGACTTCATGG - Intronic
1110278198 13:73662245-73662267 CCAGCTTGGCTGGGACAGGATGG - Intergenic
1112462340 13:99614009-99614031 CCTGGTTTGCTGGGACCTAAGGG - Intronic
1113418687 13:110152686-110152708 CCTGCATGGCTGGGGCCCCATGG + Intronic
1118036418 14:61873294-61873316 CCTGATTGGCTGTGACATGGTGG - Intergenic
1118750787 14:68806785-68806807 CTTCCTTGGCTGGGTCACCAAGG + Intergenic
1119437281 14:74605673-74605695 CCTGCCTGGCTGGGAGGTCATGG + Intronic
1122027391 14:98887567-98887589 CCTGCTTGACTCAGAGATCATGG - Intergenic
1123844189 15:24280706-24280728 CCTCTGTGACTGGGACATCATGG - Intergenic
1124223465 15:27869735-27869757 CCTCATTGGCTGGGACAGCGCGG + Intronic
1124373740 15:29117535-29117557 CCCCCTTGGCTGGGACGTCTGGG + Exonic
1124963071 15:34412482-34412504 GCTGCTCGGGTGCGACATCAGGG + Intronic
1124979694 15:34558708-34558730 GCTGCTCGGGTGCGACATCAGGG + Intronic
1125339660 15:38662103-38662125 CCAGCTTGGCTGGGGTAACATGG + Intergenic
1125510067 15:40288103-40288125 CCTGCTTGGCTGAGTCACAAGGG - Exonic
1126860554 15:52878576-52878598 CCTGCCTGTCAGGGAAATCAGGG - Intergenic
1127429128 15:58884754-58884776 CCTGCCTAGCTGGGACTACAGGG + Intronic
1132563429 16:609380-609402 CCTCCTTGCCTGGGAACTCAGGG + Intronic
1132679628 16:1134404-1134426 CCTGCTGGGCGGGGTCTTCAGGG + Intergenic
1132884226 16:2175493-2175515 CCTGCAGGTCTGGGACATCGTGG + Exonic
1133139090 16:3731380-3731402 CCTGCTCAGCTGTGACCTCATGG - Exonic
1133650229 16:7805848-7805870 CCTGCTTGGCTCGAACCTGAAGG + Intergenic
1133945808 16:10347245-10347267 CCTGAGTAGCTGGGACAACAGGG - Intronic
1134494014 16:14717829-14717851 CCTCCTAAGCAGGGACATCATGG + Intronic
1134499394 16:14756953-14756975 CCTCCTAAGCAGGGACATCATGG + Intronic
1134525945 16:14943580-14943602 CCTCCTAAGCAGGGACATCATGG + Intronic
1134546462 16:15112782-15112804 CCTCCTAAGCAGGGACATCATGG - Intronic
1134581177 16:15372066-15372088 CCTCCTAAGCAGGGACATCATGG - Intronic
1134713524 16:16342068-16342090 CCTCCTAAGCAGGGACATCATGG + Intergenic
1134721394 16:16385426-16385448 CCTCCTAAGCAGGGACATCATGG + Intronic
1134946032 16:18326458-18326480 CCTCCTAAGCAGGGACATCATGG - Intronic
1134953295 16:18366602-18366624 CCTCCTAAGCAGGGACATCATGG - Intergenic
1135312084 16:21413291-21413313 CCTCCTTAGCAGGGACATCATGG - Intronic
1135365033 16:21845747-21845769 CCTCCTTAGCAGGGACATCATGG - Intronic
1135446807 16:22525592-22525614 CCTCCTTAGCAGGGACATCATGG + Intronic
1135770750 16:25216739-25216761 CCAGCTTGGCTGTGTCATCTGGG - Intronic
1135847165 16:25929255-25929277 CCTGAGTGGCTGGGACTACAGGG - Intronic
1136140593 16:28285905-28285927 CCTGCTTCTTTGTGACATCACGG - Intergenic
1136151254 16:28351217-28351239 CCTCCTAAGCAGGGACATCATGG - Intronic
1136167486 16:28465057-28465079 CCTCCTAAGCAGGGACATCATGG - Intronic
1136195491 16:28649961-28649983 CCTCCTAAGCAGGGACATCATGG + Intronic
1136211829 16:28764077-28764099 CCTCCTAAGCAGGGACATCATGG + Intronic
1136234701 16:28906218-28906240 CCTGCTGGGCTGGGGCAGGAGGG + Intronic
1136256549 16:29044023-29044045 CCTCCTAAGCAGGGACATCATGG + Intronic
1136308787 16:29392282-29392304 CCTCCTAAGCAGGGACATCATGG - Intronic
1136322204 16:29493813-29493835 CCTCCTAAGCAGGGACATCATGG - Intronic
1136436883 16:30233785-30233807 CCTCCTAAGCAGGGACATCATGG - Intronic
1136535622 16:30897271-30897293 CTTGCATGGATGGGGCATCAGGG + Intronic
1136557084 16:31013602-31013624 CCTGAGTGGCTGGGACTACAGGG + Intergenic
1138082090 16:54100227-54100249 CTTGTTTGGCTGTGAAATCATGG + Intronic
1138569072 16:57856354-57856376 CCTGAATAGCTGGGACCTCAGGG - Intronic
1138629822 16:58284575-58284597 CCTGCTTGGTAAGAACATCATGG - Exonic
1139398804 16:66663379-66663401 CCTGATTAGCTGGGACTGCAGGG - Intronic
1139856491 16:69984717-69984739 CCTCCTAAGCAGGGACATCATGG - Intergenic
1140366240 16:74383346-74383368 CCTCCTAAGCAGGGACATCATGG + Intronic
1140971792 16:80020486-80020508 CCTGATTGGCTGGAACTTCAAGG - Intergenic
1141639545 16:85333376-85333398 CCTGGTGGGCTGGGCCAGCACGG - Intergenic
1142243971 16:88960218-88960240 CCTGCTGGGCTGGGAGGGCAGGG + Intronic
1142740956 17:1931836-1931858 CCTGATTAGCTGGGACTACAGGG - Intergenic
1143376931 17:6472467-6472489 CCTGCTTGTCTGAGGCATCTTGG - Intronic
1144008501 17:11123135-11123157 CCTGCTTGGCAGAGTCATAAAGG + Intergenic
1144417808 17:15068424-15068446 CCTGCGTAGCTGGGACTACAGGG + Intergenic
1144778900 17:17798225-17798247 CCTGCTTGGCCGGGTCAGCTGGG - Exonic
1144800288 17:17921614-17921636 CCTGCTAGGCTGGGACAAGCTGG - Intronic
1144852631 17:18251730-18251752 CCTGCTTGGCCTGGTCATCCTGG + Exonic
1145066329 17:19763729-19763751 GATGTTTAGCTGGGACATCAAGG - Intergenic
1146006818 17:29165865-29165887 CCTGCTTGACTGGGTAATCGGGG - Intronic
1148678569 17:49459451-49459473 CCCACTTGGCTGGGAGCTCAGGG + Intronic
1149777462 17:59369449-59369471 CCTGCTTCCCTCGGCCATCAGGG - Intronic
1150296222 17:64008995-64009017 CCTGCTTGGCTGGGACACACCGG + Intronic
1150317989 17:64186020-64186042 AATGCTGGGCTGTGACATCAGGG + Intronic
1150726294 17:67653996-67654018 CCTGCTTGGCTGGGACCACGAGG + Intronic
1151405170 17:73881519-73881541 CCTGAGTGGCTGGGACTACAGGG - Intergenic
1151678697 17:75613132-75613154 CCAGCGTGGCTGGGCCCTCATGG + Intergenic
1152284479 17:79404271-79404293 CCTGGTGGGCTGGGACATGGAGG - Intronic
1152603242 17:81276002-81276024 CCTGCATGGCAGGATCATCATGG + Exonic
1152987496 18:334058-334080 CCTGCGTAGCTGGGACCACAGGG - Intronic
1153147265 18:2047706-2047728 CCTGCTGGGCAGGGAGATCAAGG - Intergenic
1153292547 18:3515652-3515674 CCTGAGTAGCTGGGACTTCAGGG - Intronic
1154117965 18:11627980-11628002 CCTCCTAAGCAGGGACATCATGG - Intergenic
1154324921 18:13383064-13383086 CCTGCTTGGCTGGGACCCTCCGG - Intronic
1158536163 18:58309844-58309866 GGTACTTGGCTGTGACATCAGGG - Intronic
1159536389 18:69720062-69720084 CCTGAGTGGCTGGGACTACAAGG - Intronic
1159609285 18:70508523-70508545 CCTCCTTGGGTGGCACAGCAGGG - Intergenic
1159738174 18:72130346-72130368 CCTGCTGAGCTGGGACATGAGGG + Intergenic
1165670407 19:37673704-37673726 CCTGGATGGCTGGGAAAACAGGG - Intronic
1165707332 19:37985894-37985916 CATTCTTGGCTGGGAAGTCAGGG - Intronic
1167329386 19:48845486-48845508 CCTGGTTGGGTGGGACTTTACGG - Intronic
1168029948 19:53671495-53671517 CCTGAGTAGCTGGGACTTCAGGG - Intergenic
1168181842 19:54666908-54666930 CCTGCTGTCCTGGGACCTCATGG + Intronic
925090188 2:1148881-1148903 CCTGCCAGGCTGTGACACCAGGG - Intronic
925702829 2:6656111-6656133 CGTGCTTGCCTGGAACCTCAAGG - Intergenic
926299853 2:11594815-11594837 CCTGAGTGGCTGGGACTACAAGG + Intronic
927487467 2:23498461-23498483 CCTGCTTGGCAGGGAGGGCAGGG - Intronic
930768300 2:55107526-55107548 ACTGCCTGGCTGGTACATCTGGG + Intronic
932186440 2:69700347-69700369 CCAGCTTGGGTGACACATCAAGG + Intronic
937199020 2:120185052-120185074 GCTGCTTGTCTGGGGCAACATGG + Intergenic
938766047 2:134461057-134461079 CCTGCTGGGCTGGGGGCTCAGGG - Intronic
940429140 2:153567479-153567501 CCTGCTTTGCAGGCACAGCATGG + Intergenic
946099339 2:217305824-217305846 CCTGCCATGCTGTGACATCAGGG - Intronic
947679616 2:232018324-232018346 CCTTCTGGCCTGTGACATCATGG + Intronic
948395316 2:237640916-237640938 CCTGCTGGGATGGGACAGGAAGG + Intronic
948642270 2:239383242-239383264 CCTGCTTGTGAGGGGCATCATGG - Intronic
1169512373 20:6278096-6278118 CCTGCTGGGCTGAGACAACAAGG - Intergenic
1170980298 20:21206291-21206313 CCTTCTGGGGTGTGACATCATGG + Intronic
1171148146 20:22803634-22803656 ACTGCTTGGCTGGGCAATCGTGG + Intergenic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1172759311 20:37310984-37311006 CCTGTGTGGCTGGGACCCCAGGG + Intronic
1173419646 20:42889675-42889697 CCTGCTTTGCTGGGAGCCCAAGG - Intronic
1173448107 20:43138320-43138342 CCTGTTTGGCTGGAACACCCGGG + Intronic
1173795445 20:45856553-45856575 CCTGATTAGCTGGGACATACAGG - Intronic
1174082108 20:47977906-47977928 CCTTCCTGGCTGGGATTTCACGG - Intergenic
1174112183 20:48204648-48204670 CCTCCTGTGCTGGGACATCCCGG - Intergenic
1174134372 20:48368879-48368901 CCTTCCTGGCTGGGATTTCACGG + Intergenic
1175249069 20:57598070-57598092 ACTGCGTGGCTGGGAGATCCTGG - Intergenic
1175891024 20:62316002-62316024 CCTTCTTGGCCCGGACATCTCGG + Exonic
1176521040 21:7824578-7824600 CCTGCTAGGCTGGGTCGCCATGG + Intronic
1177797541 21:25794402-25794424 CCTGAATGGCTGGGACTACAAGG - Intergenic
1178472513 21:32905963-32905985 TCAGCTTGGCTGGGACATGGTGG + Intergenic
1178655060 21:34454590-34454612 CCTGCTAGGCTGGGTCGCCATGG + Intergenic
1179898549 21:44377093-44377115 CCTGCTTGACTAGGACATCTGGG + Intronic
1180908187 22:19430879-19430901 AATGCTGAGCTGGGACATCAGGG - Intronic
1181583770 22:23842036-23842058 CCTGCTTTGCTGGAAAACCAAGG - Intergenic
1182352497 22:29706715-29706737 CCTGATTGTCTGGGCCGTCATGG - Intergenic
1182663587 22:31942301-31942323 CCTCCTTGGCTTTGACAACAAGG + Intronic
1183793614 22:40096561-40096583 TCTCCTTGGCTGGGGCATAATGG - Intronic
1184928675 22:47663358-47663380 TCTGGATGGCTGGGACAACAAGG - Intergenic
1185368488 22:50447685-50447707 CCTCCTGGGCTGGGACAGCAAGG - Intronic
949496033 3:4633061-4633083 CCTGAGTAGCTGGGACTTCAGGG + Intronic
949876506 3:8629377-8629399 CCTGCTTGGCTCTGACCTCTAGG - Intronic
949984029 3:9525008-9525030 CCTCCTTAGGTGGGACAGCATGG + Intronic
954183121 3:48897280-48897302 CCTTCTTGGGAGTGACATCAAGG + Intronic
957725986 3:84067768-84067790 CAGGCTTGGCTGGGCTATCAAGG + Intergenic
959689095 3:109178959-109178981 ACTGCCTGGCTGGGAAATCATGG + Intergenic
960564622 3:119120071-119120093 CCTGCTTGGACAGGACCTCAAGG - Intronic
961556930 3:127702208-127702230 CCTGGCTGGCAGGGACAACAGGG + Intronic
962923762 3:139973580-139973602 CCTGCCTGGCTGGGAAAAAATGG + Intronic
964195768 3:154062662-154062684 CCTGCGTGTGTGGAACATCATGG + Intergenic
968929880 4:3573260-3573282 CCCGCGTGGCCGGGACACCAAGG + Intergenic
969450037 4:7267845-7267867 CCAGCTTGTCTGGGTCATCGGGG + Intronic
969493815 4:7514708-7514730 CCTGGTTGGCAGGTACCTCATGG - Intronic
969864882 4:10068691-10068713 CATCTCTGGCTGGGACATCAGGG - Intergenic
969875986 4:10135899-10135921 GCTGCTTGACTGGGAGCTCAAGG + Intergenic
973567286 4:52201054-52201076 CCTGAGTAGCTGGGACTTCAGGG + Intergenic
974088009 4:57281698-57281720 CCTGCTTGGATTGGGCACCAAGG - Intergenic
976203702 4:82604378-82604400 CCTCCTTGGCAGGAACAACAGGG - Intergenic
976410587 4:84708663-84708685 CCTGAGTAGCTGGGACATCTGGG + Intronic
979546085 4:121941657-121941679 CCTGCTTGCCAGGGAGATTATGG - Intronic
981697375 4:147572779-147572801 CCATCTTGGCTGGGAAGTCAAGG + Intergenic
981836278 4:149057958-149057980 CCTGCTTAGCTGGGGCTACAAGG - Intergenic
982059458 4:151589850-151589872 CCTGTTTGGCTTGGAAAACATGG - Intronic
984148911 4:176101225-176101247 CCTGCTTAGGTGGGACAGGATGG - Intronic
986529990 5:8726441-8726463 ACTGATGGGCTGGGACATAAGGG + Intergenic
987227122 5:15853633-15853655 CCTGCCTGCCTGGGGCATGAAGG - Intronic
990003912 5:50923374-50923396 CCTGTTTGCCTGGGACATACGGG + Intergenic
991939521 5:71837274-71837296 CCTGTTTGGCTGTGACATGTGGG - Intergenic
992546252 5:77816845-77816867 CCTGCTGAGCTGGCTCATCAGGG + Intronic
996312155 5:122118926-122118948 CCTTCTTGATTTGGACATCAGGG - Intergenic
997249075 5:132374927-132374949 CCTGAGTGGCTGGGACTACAGGG - Intronic
997257962 5:132443747-132443769 CTTGCATGTCTGGGTCATCAGGG - Intronic
997281693 5:132652579-132652601 CCTGCGTAGCTGGGACTACAGGG - Intergenic
997439479 5:133899110-133899132 CCTGCCTGGCTAGGACTGCAGGG + Intergenic
998026863 5:138824634-138824656 CCTTATAGGCTGCGACATCAGGG - Exonic
999346937 5:150831655-150831677 TCTGCTTGGCTGGGAAACCATGG + Intergenic
999972312 5:156877345-156877367 ACGGCTTGGCAGAGACATCAAGG + Intergenic
1002316103 5:178344510-178344532 CCTGCGTAGCTGGGACTACAAGG - Intronic
1002769411 6:278068-278090 CCTGTGTGTCTGGGACTTCAGGG + Intergenic
1002816758 6:688276-688298 CCAGCTCAGCTGGGCCATCAAGG - Intronic
1003218612 6:4136554-4136576 CATGCTTGGATGGGACAACTTGG - Intergenic
1003326775 6:5098081-5098103 CCTGAGTGGCTGGGACTACAGGG + Intergenic
1003628795 6:7768015-7768037 CCCGCTTGGGTGGGACAGGATGG + Intronic
1006482171 6:34304783-34304805 CCTGAGTAGCTGGGACAACAGGG + Intronic
1006519264 6:34562075-34562097 CCTGCCTGGCTGGGTCCACATGG - Intergenic
1007288205 6:40763347-40763369 CCTGCTTGTCCTGGAAATCAGGG + Intergenic
1009292688 6:61903917-61903939 CCAGCTTGACTGGGACAGGATGG - Intronic
1010865419 6:80970734-80970756 CCAGATTGGATGGGAAATCAAGG - Intergenic
1011639161 6:89403011-89403033 CCTGCTTGACTGAAACATCATGG - Intronic
1012530412 6:100229068-100229090 CCTGCCTGGCTGGGCCGCCAGGG - Intergenic
1014838994 6:126194989-126195011 CCTGAGTAGCTGGGACAACAGGG - Intergenic
1015215995 6:130750332-130750354 CCTGATTGGCTAGGATTTCATGG - Intergenic
1017165840 6:151407780-151407802 CCTGACTGGCTGGGACAACAGGG - Intronic
1019579189 7:1751623-1751645 GCTGCATGGCCAGGACATCAGGG + Intergenic
1019717985 7:2550036-2550058 CCTGGATGGCTGGGACTACAGGG - Intronic
1019777528 7:2921471-2921493 TCTGCTGGGCTGGAAGATCAGGG + Intronic
1019893343 7:3964075-3964097 CCTGCTAGACTGGGCCTTCAAGG + Intronic
1020651514 7:10882298-10882320 CCTGCATGTGTAGGACATCATGG + Intergenic
1024654012 7:51434082-51434104 CCTGCTAAGCGGGGGCATCAGGG - Intergenic
1026135467 7:67656863-67656885 CCAGCTAGGCAGTGACATCAGGG + Intergenic
1026534398 7:71228195-71228217 CCTGCTTGGCTGGGACATCAGGG - Intronic
1026534629 7:71229642-71229664 CTTGCTCAACTGGGACATCAGGG - Intronic
1028144130 7:87303335-87303357 CCTGCCTGGCAGGGACATGTGGG - Intergenic
1033227774 7:139574768-139574790 CCTGTCGGCCTGGGACATCAGGG - Intronic
1034633879 7:152552056-152552078 CCTGAGTAGCTGGGACTTCAGGG + Intergenic
1039392019 8:37189093-37189115 GCTGCTTGGCTGGAAATTCATGG - Intergenic
1039399496 8:37257233-37257255 CCAGGTTGGTTGGGGCATCAGGG - Intergenic
1041643439 8:60227164-60227186 CCTGAGTAGCTGGGACTTCAGGG - Intronic
1041812097 8:61922922-61922944 CATGCCTGGCTGGCACATTAAGG - Intergenic
1042166547 8:65951176-65951198 GCTGCTTGGCTGGGTGATGATGG - Intergenic
1042243319 8:66686764-66686786 CCTGAGTGGCTGGGACTACAGGG + Intronic
1043050263 8:75377121-75377143 ACTGGTGGGCTGGGACACCAGGG + Intergenic
1043723064 8:83572246-83572268 CCTGCTGGGCTCTGACATGATGG - Intergenic
1044707600 8:95024131-95024153 CCTGCTTGTCTGGGCCTCCAAGG - Intronic
1045344349 8:101281233-101281255 CCAGCTTGGCAGGTACATCCGGG - Intergenic
1046764112 8:118051210-118051232 CCTGATTAGCTGGGACTACAGGG - Intronic
1046976223 8:120281038-120281060 CCTGGTTGGCTGGGAAACCAGGG - Exonic
1047939570 8:129816135-129816157 GTTTCTTGGCTGTGACATCAGGG + Intergenic
1048006545 8:130424282-130424304 CCTCCTGGGCTGGGAGATCTGGG - Intronic
1048394068 8:133996630-133996652 CCTGCTTAGGTGAGACATAAAGG + Intergenic
1049312877 8:141942774-141942796 CCTGCTTGGCTGGTCCACCAAGG - Intergenic
1049573695 8:143381040-143381062 CAGGCATGGCTGGGACTTCAGGG + Intronic
1051226888 9:14908593-14908615 CATGCTTGGCTGGCAAACCAGGG - Intronic
1051583790 9:18705931-18705953 CCAGCCTGGGTGGGACCTCATGG + Intronic
1053310467 9:37015061-37015083 CATGTTTGCCTGGGAGATCAGGG - Exonic
1056125889 9:83536681-83536703 CCTACTTTCCTGGGAGATCATGG + Intronic
1056841309 9:89999887-89999909 CATGCCTGGCTGGGACAGCTGGG + Intergenic
1057942830 9:99299845-99299867 TCTGCATGGCTGGGGTATCAAGG - Intergenic
1058866842 9:109168452-109168474 CCTGATTGGCTGAGAGATAAGGG + Intergenic
1058877526 9:109257541-109257563 CCTGCATCTCTGGGACCTCAGGG - Intronic
1060265994 9:122111788-122111810 GCCGCTTGGCTGGGACAGAAAGG - Intergenic
1060969900 9:127731987-127732009 CCTGCATGGCCTGGCCATCAGGG + Exonic
1061517819 9:131099613-131099635 CCAGCTTGGCTGGCAGATCTAGG + Intronic
1061801303 9:133114746-133114768 CGTGCTTGGCTGTGTCCTCAAGG + Intronic
1188331042 X:28872130-28872152 CCTGATTAGCTGGGACTACAGGG + Intronic
1188466497 X:30487517-30487539 TCTGCTTGTCTGGGACAATAAGG + Intergenic
1190517954 X:51244072-51244094 CCTGCTTGGCTGGGATAAGCTGG - Intergenic
1190848618 X:54216667-54216689 CCTGCTTGCCTAGGAACTCAAGG - Intronic
1192209522 X:69118920-69118942 CCTGGTACCCTGGGACATCAAGG - Intergenic
1193639617 X:83995917-83995939 CCTGAGTGGCTGGGACTACAGGG + Intergenic
1197666694 X:129231777-129231799 CATGCATGGTTGGGGCATCAGGG - Intergenic
1198518629 X:137430924-137430946 GCTGCTTGGCTGGGAGTTAAAGG + Intergenic
1200674061 Y:6128704-6128726 CCTGAGTGGCTGGGACTACAGGG + Intergenic