ID: 1026534676

View in Genome Browser
Species Human (GRCh38)
Location 7:71229889-71229911
Sequence AGAGCGGCAGCCTGTGTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026534671_1026534676 11 Left 1026534671 7:71229855-71229877 CCGTGGCCGGAAGGGTAATAATG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1026534676 7:71229889-71229911 AGAGCGGCAGCCTGTGTCTGTGG 0: 1
1: 0
2: 1
3: 21
4: 218
1026534670_1026534676 14 Left 1026534670 7:71229852-71229874 CCTCCGTGGCCGGAAGGGTAATA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1026534676 7:71229889-71229911 AGAGCGGCAGCCTGTGTCTGTGG 0: 1
1: 0
2: 1
3: 21
4: 218
1026534673_1026534676 5 Left 1026534673 7:71229861-71229883 CCGGAAGGGTAATAATGGAAAAA 0: 1
1: 0
2: 3
3: 23
4: 289
Right 1026534676 7:71229889-71229911 AGAGCGGCAGCCTGTGTCTGTGG 0: 1
1: 0
2: 1
3: 21
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026534676 Original CRISPR AGAGCGGCAGCCTGTGTCTG TGG Intronic
900556229 1:3282276-3282298 GCAGGGCCAGCCTGTGTCTGGGG - Intronic
900642021 1:3692265-3692287 AGAGAGGCAGTGTGTGTGTGTGG + Intronic
901473493 1:9473461-9473483 AGAGCAGCAGCCTGTGGCCCTGG - Intergenic
903268151 1:22170952-22170974 AAAGCAGCAGCCTGTGACCGTGG - Intergenic
904687747 1:32273127-32273149 AGAGTGGGTGCCTGTGTGTGGGG + Intronic
904773927 1:32895419-32895441 AGAGCTCCAGCCTGTGCCTCTGG - Exonic
906207442 1:43994770-43994792 ACAGGGGTAGCCTGTGTCAGAGG + Intronic
911655111 1:100435047-100435069 GGCCCAGCAGCCTGTGTCTGTGG + Intronic
912312186 1:108633896-108633918 AGACCAGCAGGCTGTGTTTGGGG + Intronic
912502873 1:110133813-110133835 TGAGCTGCTGCCTGTGGCTGAGG - Intergenic
915366965 1:155322063-155322085 GGAGGAGCAGCCTGGGTCTGAGG - Exonic
916443233 1:164847773-164847795 AGAGAAGCAGTATGTGTCTGGGG + Exonic
916667067 1:166975841-166975863 AGCAGGGGAGCCTGTGTCTGCGG + Intronic
917491901 1:175505134-175505156 AGCGAGGCAGCCTGGGTTTGGGG - Intronic
917841862 1:178986728-178986750 AGAGCAGGAGGCTGTGGCTGGGG - Intergenic
918139648 1:181709617-181709639 AGAGCTGCAGACTGAATCTGAGG - Intronic
920653532 1:207856522-207856544 AGAACTGCAGGCTGTGGCTGAGG - Intergenic
923012947 1:230103562-230103584 GCAGAGGCAGTCTGTGTCTGTGG + Intronic
923398178 1:233588254-233588276 AGAGGGGTAACCTGTGCCTGGGG + Intergenic
924031830 1:239893431-239893453 TGAGAGCCAGCCTGTGTGTGTGG + Intronic
924655673 1:245973092-245973114 AGGGCAGCAGTTTGTGTCTGTGG - Intronic
924814401 1:247429357-247429379 AGAGCATGAGCCTGTGACTGTGG - Intronic
1065135238 10:22661000-22661022 AGAGCGGTTGTGTGTGTCTGGGG + Intronic
1066551628 10:36564918-36564940 AGAGCGCCAGCCTCTCTCAGAGG - Intergenic
1067926972 10:50519530-50519552 AGAGTGTCAGCCTGAGTCTCTGG - Intronic
1069501341 10:68956041-68956063 AAAGCAGCGGCCTGTGACTGTGG - Intergenic
1072148954 10:92669793-92669815 AGCGCTGCAGCCGGGGTCTGGGG - Intergenic
1072944393 10:99796812-99796834 AGAGAGGCAGCCAGTGTTTGAGG + Intronic
1074404667 10:113170533-113170555 AGAGAGGCAGAAGGTGTCTGGGG - Intergenic
1075411896 10:122234254-122234276 AGACCTGCAGGCTGTGCCTGGGG - Intronic
1076486014 10:130817760-130817782 AGAACGGGAGCCCGTATCTGTGG + Intergenic
1076887637 10:133269848-133269870 AGAGCGGCAGCCTCTGTGCAGGG + Intronic
1076995244 11:294525-294547 AGAGAGGCAGCCTGGGGGTGAGG - Intronic
1077005876 11:355929-355951 CGCGTGGCAGCCAGTGTCTGGGG - Intergenic
1077124524 11:926358-926380 AGAGCGGGGCCCTGGGTCTGGGG + Intronic
1077425271 11:2473149-2473171 GGAGCTGCTGCCTGTGGCTGAGG + Intronic
1078262610 11:9724816-9724838 GGACCGGCAGACTGTGTCTATGG + Exonic
1078391684 11:10940413-10940435 AGAGAGGGAGGCTGTGTGTGGGG + Intergenic
1078907874 11:15704340-15704362 AGAGATGCAGGCTGTGTTTGAGG - Intergenic
1081678557 11:44985838-44985860 GGAGCGGCAGCCTGTGTGCATGG - Intergenic
1083688684 11:64393031-64393053 GGAGCTGCACCCTGTTTCTGTGG - Intergenic
1084172448 11:67407020-67407042 AGTGGGGCAGCCAGTGGCTGGGG + Intronic
1085767372 11:79294960-79294982 AGAGGGCCAGCCAGTGTTTGTGG - Intronic
1085992631 11:81868649-81868671 AGAACGGCACTCTGTATCTGTGG - Intergenic
1092869721 12:12795541-12795563 GGAATGGCAGCCTGGGTCTGAGG - Intronic
1092933407 12:13338300-13338322 AGAACAGCAACCTGTGACTGAGG + Intergenic
1096069637 12:48767830-48767852 AGAGAGCAAGCCTGTGTGTGGGG - Exonic
1096516953 12:52161840-52161862 AGATCAACGGCCTGTGTCTGGGG + Intergenic
1096665947 12:53165199-53165221 AGTGTGGCAGCCTGTGCCTGTGG + Intronic
1099966148 12:89447900-89447922 AGAGAGGCAAACTGAGTCTGAGG + Intronic
1103610700 12:122122501-122122523 GGAGTGGTAGCCTGTGCCTGTGG - Intronic
1104392556 12:128403182-128403204 AGAGAGACATTCTGTGTCTGGGG + Intronic
1105882146 13:24614544-24614566 AGAGAGGCAGGTGGTGTCTGTGG + Intergenic
1106178652 13:27352270-27352292 GGAGAGGCAGCCTGTGCGTGAGG - Intergenic
1106764735 13:32902542-32902564 GCAGAGGCAGCCTGTGTTTGGGG + Intergenic
1107436184 13:40382535-40382557 AGAGCGGCAGGCAGTCGCTGCGG - Intergenic
1110763109 13:79252376-79252398 AGGGTGACAGCCTGGGTCTGGGG + Intergenic
1111816817 13:93164140-93164162 AGAACATCAGCCTGTGTCTCAGG + Intergenic
1114257868 14:21018088-21018110 AGAGCTGGAGCCTGAGGCTGCGG + Intronic
1115707344 14:36012811-36012833 GGAGAGTCAGCCTGTGTGTGGGG - Intergenic
1118458460 14:65966367-65966389 ACACAGGCAGTCTGTGTCTGTGG - Intronic
1119259869 14:73231773-73231795 TGAGAGACAGCCTGTGTCTCGGG - Intergenic
1120376013 14:83708326-83708348 AGAGTGCCAGCCCGTCTCTGGGG + Intergenic
1121219372 14:92274468-92274490 AGAGAGCCAGCCTGTGGATGAGG - Intergenic
1121219570 14:92275435-92275457 AGAGAGCCAGCCTGTGGATGAGG + Intergenic
1121407538 14:93728102-93728124 AGAGAGGCGCCCTGTGCCTGAGG - Intronic
1122694159 14:103544798-103544820 TGAGCGCCTGCCTGTGGCTGTGG - Intergenic
1122922609 14:104886192-104886214 GAAGAGGCAGCCTGTGTCCGTGG - Intronic
1124401528 15:29352666-29352688 TGAGCGGCAGCCAGGGTGTGGGG - Intronic
1124630282 15:31332577-31332599 AAACCAGTAGCCTGTGTCTGGGG + Intronic
1125348351 15:38742078-38742100 AGCCAGGCAGCCTGTGTCTGAGG + Intergenic
1126981418 15:54248354-54248376 AGAACGGGAGACTCTGTCTGTGG + Intronic
1129649871 15:77477015-77477037 AGAGAGGCAGCCTATCTTTGGGG - Intronic
1130036159 15:80363333-80363355 AGAGGGTCAGCCTGGGACTGTGG + Intronic
1130222700 15:82033933-82033955 AGAGAGGCTGCCTGTGTGTATGG - Intergenic
1131403407 15:92144569-92144591 AGAGGTTCTGCCTGTGTCTGTGG + Intronic
1132572495 16:650064-650086 AGAGCAGCACCCAGTCTCTGGGG + Exonic
1133965552 16:10528923-10528945 AGAGCGCCAGCCTGTTCATGAGG + Exonic
1134058561 16:11185203-11185225 GGAGCGGCAGCATGTGCCTGTGG - Intergenic
1135923580 16:26672851-26672873 AGAACTGCTGCCTGTGACTGTGG - Intergenic
1136287470 16:29252943-29252965 TCTGCTGCAGCCTGTGTCTGTGG + Intergenic
1138348675 16:56335108-56335130 GGAGGGGCAGCCTGTCCCTGAGG + Intronic
1140151654 16:72373317-72373339 AGAACAGCAGACTGTCTCTGGGG - Intergenic
1140219669 16:73034457-73034479 AAACCGGAAGCCTGTGTGTGTGG + Intronic
1141280610 16:82627308-82627330 AGAGTGGGAGCCTGTGTGTGGGG - Intronic
1141586463 16:85036862-85036884 GCAGCGGCAGCGTGTGTCTGAGG + Intronic
1142093087 16:88225572-88225594 TCTGCCGCAGCCTGTGTCTGTGG + Intergenic
1144466094 17:15498938-15498960 AGAGCAGCAGGCTGCGGCTGAGG + Intronic
1146281651 17:31549157-31549179 AGAGAGGGAGCCTGGGACTGGGG - Intergenic
1147356898 17:39905464-39905486 AGAGCAGCAGTTTGTGGCTGAGG - Exonic
1147889249 17:43705456-43705478 AGAGATGCAGCAGGTGTCTGAGG + Intergenic
1147986655 17:44310880-44310902 TGAGAGCCAGCCTGTGTTTGGGG - Intronic
1148133215 17:45274677-45274699 ACAGCAGCAGCCTCTGTGTGTGG - Intronic
1149333536 17:55610423-55610445 TTAACTGCAGCCTGTGTCTGAGG - Intergenic
1150971347 17:70031732-70031754 AGAGCAGCAGCCAGTGTCCAGGG - Intergenic
1151329548 17:73398781-73398803 TGAGGGGCAGCCTGGGTCTCTGG - Intronic
1151804693 17:76398094-76398116 TGAGCGGCAGCTTGACTCTGGGG + Intronic
1151948637 17:77334011-77334033 AGAGCAGAAGCCTGTAGCTGGGG - Intronic
1152153946 17:78620931-78620953 TGAGCGGCAGCCAGGGACTGTGG + Intergenic
1152797980 17:82317279-82317301 TGAGCGGCCTCCAGTGTCTGAGG - Intronic
1157718983 18:49908987-49909009 GGAGGGGCAGCCTGGGGCTGGGG - Intronic
1158221222 18:55152823-55152845 AGGGGTGCAGCCTGTGGCTGTGG + Intergenic
1158395683 18:57077151-57077173 GGAGCTGCAGCCTGAGTCTGTGG + Intergenic
1159072730 18:63644238-63644260 AGAGAGGCTGTGTGTGTCTGTGG + Exonic
1161861690 19:6802609-6802631 AGAGCAGATGGCTGTGTCTGTGG - Intronic
1162788889 19:13053028-13053050 GGAGGGGCAGCCTGTGGCTGTGG - Intronic
1163167821 19:15509610-15509632 AGAGAAGAAGCCTGTGCCTGTGG + Intronic
1163276012 19:16284688-16284710 AGAGCAAAAGCCTGTGTCTGGGG + Intergenic
1165121009 19:33558585-33558607 AGAGGGCCTGGCTGTGTCTGGGG + Intergenic
1166103215 19:40583487-40583509 TGAGCAGCAGCCTGTGTCCCGGG + Intronic
1166811769 19:45518678-45518700 AGAGCGAGATCCTGTTTCTGGGG - Intronic
1167370911 19:49081323-49081345 AGAGAGGCAGCCAGGCTCTGTGG + Intergenic
1168060276 19:53888071-53888093 AGAACAGCAGCCTCTGTCTGTGG + Intronic
1168264132 19:55212293-55212315 GGAGCAGCTGCCTGTGTATGGGG + Intergenic
925207519 2:2019705-2019727 GGTGTGGCAGCCTGTGTGTGAGG - Intronic
927647711 2:24888458-24888480 ACAGTGGCTGCCTGTGTCTGGGG + Intronic
928402437 2:30988684-30988706 AGAGCATCAGCCTGTACCTGTGG - Intronic
928935917 2:36677907-36677929 GGATCAGAAGCCTGTGTCTGGGG + Intergenic
928938195 2:36702317-36702339 TGAGCGGTAGGCGGTGTCTGGGG - Intronic
929938681 2:46314121-46314143 AGAGAGACAGCATGGGTCTGTGG - Intronic
931380947 2:61752767-61752789 AGAGCGAGAGACTCTGTCTGAGG + Intergenic
932103638 2:68923621-68923643 AGAGAGAAAGCCTGTGCCTGAGG - Intergenic
932458949 2:71869934-71869956 AGAGCAGCAGCATGTGTAAGAGG - Intergenic
934475398 2:94590049-94590071 AGAGAAGCAGCCTGGGACTGGGG - Intronic
935127641 2:100238591-100238613 AGAGCGGCAGCCCCTCCCTGGGG + Intergenic
937568810 2:123332662-123332684 GGAGCAGCAGCCAGTGTGTGTGG + Intergenic
938090030 2:128425411-128425433 AGAGTGGCAGCCAGGGGCTGTGG - Intergenic
938099586 2:128489702-128489724 AGAGGGGCAGCCTGGGGCCGAGG - Intergenic
942326665 2:174781921-174781943 AAAGCTGCAGCCAGGGTCTGGGG + Intergenic
944412067 2:199456005-199456027 GGAGCGAGAGCCCGTGTCTGCGG - Exonic
945014536 2:205501294-205501316 AGAGAGGCAGCCTGAGACTATGG + Intronic
946079783 2:217107605-217107627 ATAGCAGCAGCCTCTTTCTGTGG - Intergenic
948237215 2:236400215-236400237 GGAGCTGCAGCCTGACTCTGGGG + Intronic
948436447 2:237956822-237956844 AGAGCAGCAGCTGGTGTCTGTGG + Intergenic
1170124764 20:12950470-12950492 AGAGGGGCAAGCTGGGTCTGAGG + Intergenic
1173173182 20:40743565-40743587 AGAGCTGCTCACTGTGTCTGTGG - Intergenic
1174163388 20:48567532-48567554 GGAGCTGCAGCCTGTGTCTGGGG - Intergenic
1175339757 20:58221054-58221076 ATAGCTGCCGCCTGTGTCTTGGG + Intronic
1175751452 20:61500877-61500899 AGAGCGGCTGCGTGGGCCTGAGG - Intronic
1176047676 20:63101174-63101196 AGGGAGGCAGCCTGGGGCTGGGG + Intergenic
1178664509 21:34534662-34534684 TGAAGGGCAGCCTTTGTCTGTGG + Intronic
1179726171 21:43342272-43342294 AGGCTGGCAGCGTGTGTCTGTGG - Intergenic
1179797320 21:43792850-43792872 AGAGCGCCAGCTGGTGTCTGTGG + Intronic
1181015164 22:20064386-20064408 AGAGCAGCAGCCTCAGTCTTGGG - Intronic
1181169374 22:20999693-20999715 GGAGCTGCAGCCACTGTCTGGGG + Intronic
1183589019 22:38769281-38769303 AGAGGGCCTGCCTGTGTTTGGGG + Intronic
1183623430 22:38987709-38987731 GGAGGAGGAGCCTGTGTCTGGGG - Intronic
1183627735 22:39014907-39014929 AGAGGAGGAGCCTGTGTCTGGGG - Intronic
1183630240 22:39028166-39028188 GGAGGAGGAGCCTGTGTCTGGGG - Intronic
1183656859 22:39190974-39190996 AGAGCGGAAGCCTTTGTGTGGGG + Intergenic
1183935814 22:41261564-41261586 AGAGCTGCAGCCAGGATCTGTGG + Exonic
1184391883 22:44207527-44207549 GGAGCAGCAGCCTGGGGCTGTGG - Exonic
1184756734 22:46520341-46520363 GGAGCAGGTGCCTGTGTCTGTGG - Intronic
1184790501 22:46696800-46696822 AGAGCTGCAGCCACTGCCTGTGG + Intronic
1184799401 22:46750771-46750793 TCAGGGGCTGCCTGTGTCTGTGG - Intergenic
1185033738 22:48460058-48460080 TGAGCGGGAGTCTGTTTCTGAGG - Intergenic
1185095759 22:48805123-48805145 GGAGGGGCAGCCTGTGTCCCAGG + Intronic
949389033 3:3538218-3538240 AGAGCGGCACCATGTGTGGGTGG - Intergenic
953915931 3:46921291-46921313 AGAGAGGCCGCCTGGGGCTGGGG + Intergenic
954188310 3:48937423-48937445 AGAGTGACAGACTCTGTCTGGGG - Intronic
954853263 3:53621027-53621049 AGAGCTTCAGGCTGTGTCTGAGG - Intronic
956041728 3:65152154-65152176 AGAGGGGAAGCCAGTGGCTGTGG + Intergenic
958777416 3:98502900-98502922 AGGGAGGCAGTCTGTGTCTCAGG + Intronic
962172875 3:133121153-133121175 AGAAAGGCAGCTTGTTTCTGAGG - Intronic
962343335 3:134602794-134602816 AGAGCTGCAGCCTTGGTCTGAGG - Intronic
967104311 3:186242913-186242935 AGATCAGGAGCCTGTGTCTGGGG + Intronic
967447637 3:189585237-189585259 ATTGTCGCAGCCTGTGTCTGGGG - Intergenic
967620438 3:191627370-191627392 AGAGAGGCATCCTGTGTTTGCGG - Intergenic
968079517 3:195836326-195836348 TGAGGGGCTGGCTGTGTCTGGGG - Intergenic
968222916 3:196951680-196951702 AGAGCAGCAGCCTCTCTCTCTGG - Intronic
969336479 4:6513399-6513421 AGAGAGACAGTGTGTGTCTGGGG + Intronic
972704479 4:41528461-41528483 AGAGATGCAGCCTTTGTGTGAGG + Intronic
976388314 4:84484040-84484062 AGAGGGCAAGCGTGTGTCTGTGG - Intergenic
979965391 4:127070639-127070661 AGAAGGGCAGCATGTGGCTGAGG - Intergenic
982738799 4:159036375-159036397 AGAGCTGCCTCCTCTGTCTGAGG + Intronic
983683141 4:170375129-170375151 GGAGCGGTAGGCTGTGTGTGTGG - Intergenic
985009350 4:185566576-185566598 AGACCGGGAGCCTGCCTCTGAGG + Intergenic
986318578 5:6609054-6609076 AGAGCTCCAGCCTTTTTCTGGGG - Intronic
988780434 5:34516341-34516363 AGAGTGACAGCATGTGTGTGGGG + Intergenic
988808518 5:34762643-34762665 ATAGCTGCAGCCTGTGTTTATGG + Intronic
990984320 5:61626857-61626879 ACAGAGGCAGCCGGTGCCTGAGG - Intergenic
992965166 5:81992127-81992149 GGTGTGGCAGCATGTGTCTGTGG - Intronic
996542086 5:124640974-124640996 AGGGCGGTGGCCAGTGTCTGGGG - Intronic
997280496 5:132641022-132641044 GGAGCTGCAGGATGTGTCTGGGG - Intronic
997586982 5:135049055-135049077 AGAGGGGCTGCCAGTGTGTGTGG + Intronic
998158229 5:139798091-139798113 TGAGCGGCATCTTATGTCTGAGG + Intronic
998874133 5:146582285-146582307 AGTGCTGCAGCCTGGGTGTGGGG + Intronic
1001529728 5:172453825-172453847 AGAGGGGCTACCTGTGGCTGGGG + Intronic
1003278002 6:4668713-4668735 AGAGCGGCAGACTGAGTCCTGGG + Intergenic
1003641114 6:7875902-7875924 AGTACGGCAGCCAGTGTCTAGGG - Intronic
1004550726 6:16644674-16644696 AGAGCAGCACGCTGTGTCTCAGG - Intronic
1006166685 6:32069607-32069629 AGAGCAGCAGCTTGTACCTGTGG + Intronic
1006843549 6:37047521-37047543 AGAGCTGCAGCCTGGCTCTGAGG + Intergenic
1007337157 6:41162156-41162178 AGAGCACCAGCCTGTTGCTGGGG + Intronic
1013575861 6:111483173-111483195 AGAGCTGCAGCCTGGGACCGAGG - Exonic
1015473655 6:133635057-133635079 GAAGGTGCAGCCTGTGTCTGCGG - Intergenic
1017035581 6:150264108-150264130 CGTGCGGCATCCTGTGTGTGCGG - Intergenic
1018804404 6:167247932-167247954 AGAGGGGCTGCCTGTGTCCTGGG + Intergenic
1019453270 7:1110547-1110569 AGAGCGGGAGCGGGTGTCGGGGG + Intronic
1020003413 7:4768537-4768559 AGGGCTGCAGCCTCTGCCTGAGG - Exonic
1020921320 7:14268230-14268252 AGAGAGGCAGTGTGTGTGTGTGG - Intronic
1020923127 7:14290538-14290560 ACCGAGGCAGCCTGAGTCTGAGG - Intronic
1022945794 7:35282194-35282216 AGAGCACCATCCTGTCTCTGGGG + Intergenic
1025220694 7:57105017-57105039 AGAGTGGTGGCATGTGTCTGTGG + Intergenic
1025631509 7:63276829-63276851 AGAGTGGTGGCCTGTGTCTGTGG + Intergenic
1026534676 7:71229889-71229911 AGAGCGGCAGCCTGTGTCTGTGG + Intronic
1027946339 7:84749635-84749657 AGACCTGGAGCCTGTATCTGTGG - Intergenic
1029218873 7:98972179-98972201 GGTGTGGCAGCCTATGTCTGTGG - Intronic
1032105811 7:129028586-129028608 AGAGGGGCGGCCAGTGACTGTGG - Intronic
1035042068 7:155936224-155936246 AGAGCCCCATCCTGTGACTGTGG + Intergenic
1035827624 8:2661363-2661385 AGAGAGGCAGCCACTGCCTGAGG + Intergenic
1039582868 8:38681246-38681268 AGAACTGCAGCCTGTGTTGGTGG + Intergenic
1040636129 8:49275015-49275037 GAAGCGGCAGCCTCTGTCTAGGG - Intergenic
1040949221 8:52919281-52919303 GGAGCTGCAACCTATGTCTGCGG - Intergenic
1041809011 8:61887094-61887116 AGTCCTGCAGCCTGGGTCTGTGG + Intergenic
1041849634 8:62376151-62376173 AGAGAAGCTCCCTGTGTCTGGGG - Intronic
1044820673 8:96153873-96153895 AGAGCCGCAATCTCTGTCTGCGG + Intronic
1048469838 8:134696240-134696262 AGAGATGCGGCCTGGGTCTGGGG - Intronic
1051437177 9:17045111-17045133 AGAGAGGGATCCTGTATCTGGGG + Intergenic
1051667800 9:19481670-19481692 AGCGTGGCAGCCTGCGTCAGTGG + Intergenic
1052854650 9:33399732-33399754 AGAGAAGCAGCCTGGGACTGGGG + Intronic
1053682669 9:40496013-40496035 AGAGAAGCAGCCTGGGACTGGGG + Intergenic
1053932651 9:43124354-43124376 AGAGAAGCAGCCTGGGACTGGGG + Intergenic
1054281045 9:63128916-63128938 AGAGAAGCAGCCTGGGACTGGGG - Intergenic
1054295768 9:63331527-63331549 AGAGAAGCAGCCTGGGACTGGGG + Intergenic
1054393787 9:64636022-64636044 AGAGAAGCAGCCTGGGACTGGGG + Intergenic
1054428435 9:65141235-65141257 AGAGAAGCAGCCTGGGACTGGGG + Intergenic
1054501945 9:65880310-65880332 AGAGAAGCAGCCTGGGACTGGGG - Intronic
1060600089 9:124871458-124871480 AGAGCGGCAGCATGGGATTGTGG + Intronic
1061123238 9:128657046-128657068 AGGGCGGCAGCCTGCGGCCGTGG + Intergenic
1061877817 9:133553763-133553785 AGAGGGGCAGCAGGGGTCTGTGG + Intronic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1062519194 9:136950607-136950629 AGAGCGGGACCCTGGGGCTGCGG + Intronic
1186428888 X:9487547-9487569 GGAGGAGCAGCCTGTGTCTCTGG - Intronic
1188090492 X:25958683-25958705 AGAGCAGGACCCTGTCTCTGGGG - Intergenic
1190213996 X:48468293-48468315 AGAGAGACAGCGTGAGTCTGGGG - Intronic
1190290357 X:48988373-48988395 AGAGGGGTTGACTGTGTCTGAGG - Intronic
1192313108 X:70032600-70032622 ACAGCGGAAGCCAGTGTGTGAGG - Intronic
1192659596 X:73028904-73028926 AGAGAGGCAGCCTGCTTCTCTGG + Intergenic
1192737536 X:73863441-73863463 AGGCCTGGAGCCTGTGTCTGTGG - Intergenic
1197297588 X:124737950-124737972 AGAGGGGCAGCCTGGGACAGCGG + Intronic