ID: 1026538054

View in Genome Browser
Species Human (GRCh38)
Location 7:71256629-71256651
Sequence CACCTTGCGCACGTGTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2589
Summary {0: 1, 1: 28, 2: 499, 3: 841, 4: 1220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026538051_1026538054 14 Left 1026538051 7:71256592-71256614 CCAAAAACAAAAAAACAAAACTG 0: 1
1: 12
2: 133
3: 1610
4: 20275
Right 1026538054 7:71256629-71256651 CACCTTGCGCACGTGTTCTCAGG 0: 1
1: 28
2: 499
3: 841
4: 1220
1026538050_1026538054 21 Left 1026538050 7:71256585-71256607 CCAAAAACCAAAAACAAAAAAAC 0: 1
1: 69
2: 370
3: 2156
4: 24237
Right 1026538054 7:71256629-71256651 CACCTTGCGCACGTGTTCTCAGG 0: 1
1: 28
2: 499
3: 841
4: 1220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026538054 Original CRISPR CACCTTGCGCACGTGTTCTC AGG Intronic
Too many off-targets to display for this crispr