ID: 1026556092

View in Genome Browser
Species Human (GRCh38)
Location 7:71409854-71409876
Sequence GCTTTGAAGGGGATCATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026556081_1026556092 2 Left 1026556081 7:71409829-71409851 CCTCCCCAACGATTTCTGGGCTG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1026556092 7:71409854-71409876 GCTTTGAAGGGGATCATGGAAGG No data
1026556079_1026556092 5 Left 1026556079 7:71409826-71409848 CCACCTCCCCAACGATTTCTGGG 0: 1
1: 0
2: 2
3: 22
4: 194
Right 1026556092 7:71409854-71409876 GCTTTGAAGGGGATCATGGAAGG No data
1026556087_1026556092 -3 Left 1026556087 7:71409834-71409856 CCAACGATTTCTGGGCTGGGGCT 0: 1
1: 0
2: 6
3: 13
4: 137
Right 1026556092 7:71409854-71409876 GCTTTGAAGGGGATCATGGAAGG No data
1026556077_1026556092 13 Left 1026556077 7:71409818-71409840 CCTCAAATCCACCTCCCCAACGA 0: 1
1: 8
2: 26
3: 84
4: 316
Right 1026556092 7:71409854-71409876 GCTTTGAAGGGGATCATGGAAGG No data
1026556086_1026556092 -2 Left 1026556086 7:71409833-71409855 CCCAACGATTTCTGGGCTGGGGC 0: 1
1: 0
2: 2
3: 19
4: 88
Right 1026556092 7:71409854-71409876 GCTTTGAAGGGGATCATGGAAGG No data
1026556084_1026556092 -1 Left 1026556084 7:71409832-71409854 CCCCAACGATTTCTGGGCTGGGG 0: 1
1: 0
2: 7
3: 29
4: 136
Right 1026556092 7:71409854-71409876 GCTTTGAAGGGGATCATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026556092 Original CRISPR GCTTTGAAGGGGATCATGGA AGG Intronic
No off target data available for this crispr