ID: 1026556797

View in Genome Browser
Species Human (GRCh38)
Location 7:71415553-71415575
Sequence ACAAGGATTCTGGCCAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026556791_1026556797 1 Left 1026556791 7:71415529-71415551 CCCATATAGAATTTGATAAACCG 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1026556797 7:71415553-71415575 ACAAGGATTCTGGCCAAGTTTGG No data
1026556792_1026556797 0 Left 1026556792 7:71415530-71415552 CCATATAGAATTTGATAAACCGG 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1026556797 7:71415553-71415575 ACAAGGATTCTGGCCAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026556797 Original CRISPR ACAAGGATTCTGGCCAAGTT TGG Intronic
No off target data available for this crispr