ID: 1026557018

View in Genome Browser
Species Human (GRCh38)
Location 7:71417397-71417419
Sequence TTTTTGCTGTCATCAAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026557011_1026557018 7 Left 1026557011 7:71417367-71417389 CCATCTCGGCCGCCAATTTTCCC 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1026557018 7:71417397-71417419 TTTTTGCTGTCATCAAACCCTGG 0: 1
1: 0
2: 0
3: 19
4: 174
1026557013_1026557018 -5 Left 1026557013 7:71417379-71417401 CCAATTTTCCCTCCCAGTTTTTT 0: 1
1: 0
2: 6
3: 75
4: 708
Right 1026557018 7:71417397-71417419 TTTTTGCTGTCATCAAACCCTGG 0: 1
1: 0
2: 0
3: 19
4: 174
1026557012_1026557018 -2 Left 1026557012 7:71417376-71417398 CCGCCAATTTTCCCTCCCAGTTT 0: 1
1: 0
2: 3
3: 26
4: 340
Right 1026557018 7:71417397-71417419 TTTTTGCTGTCATCAAACCCTGG 0: 1
1: 0
2: 0
3: 19
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026557018 Original CRISPR TTTTTGCTGTCATCAAACCC TGG Intronic
901964087 1:12851898-12851920 TTTTTGCTTTTCTCAAACCATGG - Intronic
902442789 1:16441907-16441929 TGTTTTCTGTCATCAAACTGTGG + Intronic
906181232 1:43821410-43821432 TTTTTGCTTTCATAGAAACCTGG - Intronic
907115286 1:51962765-51962787 TCCTTGCTGTAATCAAAGCCCGG + Intronic
907564790 1:55424807-55424829 TAATTGCTGTCTTCAAACCCTGG + Intergenic
908855404 1:68421239-68421261 TTTTTGTTGTAACCAAAACCTGG + Intergenic
912359374 1:109082205-109082227 TTTTTGCTGTAATGAAAAACAGG - Intergenic
915286236 1:154854383-154854405 TTTTTCCTGTTATCTAACTCTGG + Intronic
915288217 1:154866270-154866292 TTTTTCCTGTTATCTAACTCTGG - Intronic
915369945 1:155340569-155340591 TGTTTGCTCTAATAAAACCCTGG - Intronic
915383380 1:155465098-155465120 GTTTTACTGTCTTCACACCCAGG - Intronic
915539953 1:156559278-156559300 TCTGTGCTGTCATCAAGCCTTGG - Intronic
915847402 1:159281059-159281081 TTTGTGCAATCATCTAACCCTGG - Intergenic
917177190 1:172248995-172249017 TTAAAGCTGTCATCAAACCAAGG + Intronic
922799475 1:228358457-228358479 GTTTTGCTTTCATCTAACTCAGG - Intronic
1064107530 10:12512667-12512689 TTGTAGCTGTCATCAAGCCTGGG + Intronic
1064715383 10:18171505-18171527 TTTTTTCTGCTATCAAAGCCGGG - Intronic
1065777954 10:29139736-29139758 TTTTCTATGTCAACAAACCCTGG + Intergenic
1065926228 10:30435462-30435484 TTTTTGCTCTCAAAAAGCCCCGG - Intronic
1068071903 10:52206597-52206619 TCTTTGATGCCCTCAAACCCTGG + Intronic
1069929853 10:71875006-71875028 TTCTTTCTGTCAGAAAACCCTGG - Intergenic
1069994458 10:72333913-72333935 TTACTGCTGCCATCAAAACCAGG + Exonic
1070528544 10:77316217-77316239 ATTTTGCTGTCTTCAAGCTCAGG + Intronic
1071864551 10:89712906-89712928 TTTTTACTGCCTTAAAACCCTGG - Intronic
1072985652 10:100137672-100137694 TTTTTGCTGTCTCCATACTCTGG - Intergenic
1074457079 10:113604547-113604569 TTTCTCCTTTCACCAAACCCGGG - Intronic
1075802810 10:125162850-125162872 TTTTGGCTGTAAACAAACCGCGG + Intergenic
1078432178 11:11296544-11296566 CTTCTTCTGTCATCAAAGCCTGG + Intronic
1079675049 11:23216858-23216880 TTTATGCTGTCAGCATCCCCAGG + Intergenic
1087912391 11:103768764-103768786 TTTTGGCTGGCAACAACCCCAGG + Intergenic
1088065044 11:105707145-105707167 TTTCTATTGTCATCAAAGCCAGG - Intronic
1090467567 11:126948643-126948665 TTTTTGCTTTCTTCAAAATCTGG + Intronic
1090497274 11:127225874-127225896 TTGTTGCTTTCAGCAAACCAGGG - Intergenic
1090831425 11:130423412-130423434 TTTCTGTTGTCATCCAAACCAGG + Intronic
1093240296 12:16662141-16662163 TTTTTTCTTTCATTAAACTCAGG - Intergenic
1094152214 12:27297477-27297499 TCTTTGCTGTCATTAACTCCTGG + Intronic
1095737005 12:45568626-45568648 TTTTGGCTGACATAAAAGCCTGG + Intergenic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097133526 12:56832063-56832085 TATTTGATGTCATCAACCCATGG - Intergenic
1098023933 12:66183222-66183244 TTTTTCCTGTCATGATTCCCAGG + Intergenic
1099667705 12:85653369-85653391 TTTATGCTGTCATCAAAGCTGGG + Intergenic
1100039912 12:90302946-90302968 TTTTTGTTCTCTTCAGACCCTGG + Intergenic
1100847103 12:98670996-98671018 TTTTTGCTTTAATCCAATCCAGG - Exonic
1102743916 12:115232962-115232984 TATCTGCTGTCATCACATCCAGG + Intergenic
1103014805 12:117485619-117485641 TTTTGGATGTCAACAAAACCAGG - Exonic
1104388584 12:128372772-128372794 ATTTGGCTGTCATCAATCTCGGG - Intronic
1107005896 13:35611244-35611266 TATTTGCTTTCATCAAAAGCTGG + Intronic
1107197638 13:37672579-37672601 TTTGTGCTGTCATGAAATTCTGG - Intronic
1108352766 13:49602308-49602330 TATTTGCTGTCTTCTATCCCAGG - Intergenic
1112676872 13:101711759-101711781 TTTTTGCTGGCTTCCATCCCTGG - Exonic
1113454671 13:110439692-110439714 ATTTTGCTGTGATCACAGCCAGG + Intronic
1113505027 13:110810842-110810864 TTTATGCTGTCATCTAACACAGG - Intergenic
1113699504 13:112374263-112374285 TTTCTGCTGTGACCAAGCCCAGG + Intergenic
1116091615 14:40314474-40314496 TTTTTGCAGTCAACAAACAGAGG + Intergenic
1117243721 14:53862186-53862208 TCTTTTCTGTGCTCAAACCCTGG - Intergenic
1117389306 14:55247879-55247901 TTTTAGCTGTCATTAATCCCTGG - Intergenic
1118330058 14:64807978-64808000 CCTCTGCTGCCATCAAACCCCGG + Intronic
1120981268 14:90291409-90291431 CTTTTTCTGTAATCAAAGCCTGG - Intronic
1122389556 14:101370943-101370965 TTTGTGCAGTCACCAAACACAGG + Intergenic
1125006705 15:34824801-34824823 TTTTTGGTGACCTCAAACCATGG - Intergenic
1125283472 15:38068628-38068650 TTTTTGATGGCAGCAAACACTGG + Intergenic
1128342230 15:66830570-66830592 TTTTTGCTCTCATGACACCCAGG + Intergenic
1130740922 15:86599341-86599363 TTTTAGCTGCCATAAAGCCCAGG + Intronic
1131878219 15:96833914-96833936 TGTTTGCTGTCCTCAATACCTGG + Intergenic
1138916312 16:61469072-61469094 TTTTTGCTGTCTTGGAACCCAGG - Intergenic
1139024152 16:62793243-62793265 CTTTTGCTGTTATCCAAACCTGG + Intergenic
1144597986 17:16587592-16587614 TGTTTGCTTTCATTAAAGCCAGG + Intergenic
1146041091 17:29455464-29455486 TTTTTCCTGTCTTGATACCCTGG + Intronic
1149630472 17:58117773-58117795 TCTCTGATGTCAGCAAACCCTGG + Intergenic
1151107512 17:71633987-71634009 ATTTTTGTGTCTTCAAACCCAGG - Intergenic
1151595519 17:75076086-75076108 TTTAAGCTGCCATCACACCCTGG + Intergenic
1154088366 18:11329996-11330018 TCTTTGCTATCATCAATCCAAGG - Intergenic
1154111924 18:11577656-11577678 GTTTTGCTATTATTAAACCCAGG - Intergenic
1155911839 18:31512818-31512840 TTATTGCTCTTATCAAAACCTGG + Intronic
1161735455 19:5989682-5989704 TTTTTGATGTAATCAAAGCTGGG - Intergenic
1165329278 19:35132377-35132399 TTATCACTGTCATCAACCCCAGG + Intronic
925561634 2:5202661-5202683 TTTTGGCTGTCATGAAAGCAGGG - Intergenic
927577989 2:24216417-24216439 TCTTTGCTGACATCACACCCCGG - Intronic
928190064 2:29156349-29156371 TTTTTGATGTCATTAATCCTTGG - Exonic
930368674 2:50476349-50476371 TTTTCTCTGTCTACAAACCCTGG + Intronic
933038884 2:77435107-77435129 TTTTTGTTGTCATCACAACTTGG - Intronic
934096782 2:88614199-88614221 TTTTTGCTCTCATAGAAACCGGG + Intronic
937437164 2:121890116-121890138 CTTTTGCTGCCACCAAACCCAGG - Intergenic
938254527 2:129845844-129845866 TCTTTCTTGTCATCAATCCCAGG + Intergenic
940455247 2:153889906-153889928 TTTTTGCAATTATAAAACCCTGG + Intronic
942581443 2:177423130-177423152 CTTGTTCTGTCTTCAAACCCTGG + Intronic
942821714 2:180122788-180122810 TTTCTGCTGCCATCAATCCAAGG + Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
944912623 2:204325270-204325292 TTTTTTCTATCAACAAACACAGG + Intergenic
945895126 2:215472733-215472755 TTTTCCCTGTCATCAATTCCTGG + Intergenic
945965800 2:216185159-216185181 TTCTTGCTGTTACCAATCCCGGG + Intronic
946716652 2:222560128-222560150 TTTTTGCTTTCATACAAACCTGG + Exonic
948337849 2:237224473-237224495 TTTCTGCTTTCACCAAACCCAGG + Intergenic
1169970006 20:11259587-11259609 TTTTAGCTTTAATTAAACCCTGG + Intergenic
1170352759 20:15460102-15460124 TTTCTGCTGTAATTGAACCCAGG + Intronic
1170866047 20:20159348-20159370 GTTTTGCTGTCATCATTTCCAGG + Exonic
1174242038 20:49144649-49144671 TTTTTGCTTTCATTGAACCCAGG - Intronic
1174533441 20:51232719-51232741 CTTTTTCTGTCATCAAACTGAGG + Intergenic
1174747311 20:53076238-53076260 TTTCTGCTGTCATCCAGTCCAGG - Intronic
1175046963 20:56116105-56116127 TTTTTGCTCCCATTATACCCTGG - Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1180966252 22:19789324-19789346 ATTCTGCTGCCATCAAGCCCGGG - Intronic
949237752 3:1831023-1831045 TTTATGTTGGCTTCAAACCCTGG - Intergenic
951187858 3:19735157-19735179 TTTTTGCTGTCATTTATCTCAGG - Intergenic
952594402 3:34998518-34998540 TTTTTGCTATGATAAAAACCAGG - Intergenic
952599615 3:35064589-35064611 TTTTTTCTGTCATCAAACAAAGG - Intergenic
954532169 3:51330450-51330472 CTTTTCCTGTCAGCAAATCCAGG - Intronic
955294362 3:57721514-57721536 TTTTTGCTGTAATAAATCACAGG + Intergenic
957876380 3:86152146-86152168 ATTTGGCTGTCATCAAAGCTGGG - Intergenic
962274503 3:134001840-134001862 TTGTTGCTGTCATCTAAACACGG - Intronic
962476332 3:135758520-135758542 TTTTTCATGTCATCACACCCTGG + Intergenic
965664971 3:171083533-171083555 TTTTAGCTGACCTCAAACTCAGG - Intronic
967858764 3:194136548-194136570 TTCTTTCTGTCTTGAAACCCCGG + Intronic
969752253 4:9120190-9120212 TTTTTGCTGTTATCGAAACAGGG - Intergenic
969871691 4:10108683-10108705 TTTTTGCTGTCATTCAGCCTTGG - Intronic
970270665 4:14343891-14343913 TTTATGCTGTAATAAAACACAGG + Intergenic
970554174 4:17214895-17214917 TTCTGGCTGTCTTCAAGCCCTGG + Intergenic
971094051 4:23377933-23377955 TTTGTGCTTTCCCCAAACCCTGG - Intergenic
971259281 4:25041753-25041775 TTTTTGCTGTCATTAATCAGTGG - Intergenic
972124802 4:35750261-35750283 CTTTTGCTATCATAAAACTCTGG + Intergenic
977249205 4:94670515-94670537 ATATTGATGTCATCTAACCCCGG + Intergenic
980212813 4:129811703-129811725 TCTTTGCTGTCTCCAAACCCAGG + Intergenic
980713566 4:136602240-136602262 TTTGTGCTGCCATCAAATTCTGG + Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
984259631 4:177428781-177428803 TATTTGCTTTGATCAATCCCTGG - Intergenic
984310067 4:178046717-178046739 TTTTTGCTGCCTTCAGTCCCTGG + Intergenic
985885531 5:2674843-2674865 AGTCTGCAGTCATCAAACCCAGG + Intergenic
986414432 5:7514505-7514527 TTTATGCTGTAAGCAAACCAGGG - Intronic
986541768 5:8851864-8851886 ATTTTACTATCATCAATCCCTGG - Intergenic
986928599 5:12790960-12790982 TCGATGTTGTCATCAAACCCAGG - Intergenic
987335950 5:16898012-16898034 CTCTTGCTGTCATCAACCCCAGG + Intronic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
988093973 5:26578887-26578909 TTGCAGCTGTCATCAAGCCCAGG + Intergenic
989191262 5:38671910-38671932 TTTTTTCTGAGATCAAAACCAGG + Intergenic
990043578 5:51400355-51400377 TTTTCGCTGTCACCAAACCTGGG - Intergenic
991078496 5:62568842-62568864 TTTTTTCTGTCTTCACAGCCTGG + Intronic
992246894 5:74835147-74835169 TCTTTGCTGTCAACAAAGACGGG + Intronic
992836731 5:80648767-80648789 ATTTTCCTGTCCTCCAACCCAGG - Intronic
999132324 5:149293842-149293864 TTTTGCCTGTCATAAAACCAGGG + Intronic
1001744917 5:174085011-174085033 TTTCTGCTCTGATCAAACCATGG + Intronic
1006231697 6:32593594-32593616 TTTTGGCTATCAGCAAGCCCTGG + Intergenic
1006463314 6:34176664-34176686 CTTTTGCTGTCATCTGACCCTGG + Intergenic
1007747436 6:44051607-44051629 CTTTTGCTGCCACCAGACCCAGG + Intergenic
1008253265 6:49266354-49266376 GTTTTGAGGTCATCTAACCCTGG - Intergenic
1012638712 6:101581439-101581461 TGTTTCCTGTCCTCAAACACTGG - Intronic
1014726486 6:124977910-124977932 TTTTTACTGTGGTCAAACCTTGG + Intronic
1014913598 6:127119925-127119947 GTTTTGCTGTCTTCAACCCTCGG - Intronic
1017059867 6:150472218-150472240 TTTTTGCTGTCACCAAACATGGG + Intergenic
1017775521 6:157677584-157677606 TTTTTGATCTCATAAACCCCAGG + Exonic
1018461954 6:164007113-164007135 TATTTACTGTCATCAAGCCAAGG + Intergenic
1023258127 7:38331916-38331938 TTTTTGCTGACATCACAGCTGGG + Intergenic
1023258779 7:38337606-38337628 TTTCTGCTGTCATCACAGCTGGG + Intergenic
1023259309 7:38342270-38342292 TTTCTGCTGTCATCACAGCTGGG + Intergenic
1023259767 7:38346591-38346613 TTTCTGCTGTCATCACAGCTGGG + Intergenic
1023260242 7:38350920-38350942 TTTCTGCTGTCATCACAGCTGGG + Intergenic
1023261219 7:38360071-38360093 TTTCTGCTGTCATCACAGCTGGG + Intergenic
1023261735 7:38364883-38364905 TTTTTGCTGTCATCACAGCTGGG + Intergenic
1023503956 7:40880762-40880784 TTTTTCCTGTCATGAAACATTGG - Intergenic
1026275830 7:68875243-68875265 TCTTTGCTCTCAACAAACCCAGG + Intergenic
1026557018 7:71417397-71417419 TTTTTGCTGTCATCAAACCCTGG + Intronic
1027484298 7:78741024-78741046 TTTTTTCTATCTTCAAATCCTGG - Intronic
1028206335 7:88021388-88021410 TTTTTGCTGGGAAGAAACCCCGG + Intronic
1028890351 7:95980284-95980306 TTTATGTTGGCATCAAACTCTGG + Intronic
1029233530 7:99091952-99091974 ATTTTGAAGTCATCAAATCCTGG + Intronic
1034891357 7:154841898-154841920 TTATCGCTGACATCAAACCTGGG - Intronic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1037023535 8:14003974-14003996 TTTATGCGGTCAACAAACACAGG + Intergenic
1037247885 8:16857627-16857649 TTTTTGCTTACATGAAACCATGG + Intergenic
1038154682 8:24977943-24977965 TTTTTGCTTTCAAAAAAACCGGG + Intergenic
1039762421 8:40591709-40591731 TTATTCTTCTCATCAAACCCTGG + Intronic
1040660750 8:49572547-49572569 TATTTGCTGTCATAGAAACCTGG - Intergenic
1041427930 8:57743710-57743732 TTACTGCTCTCAGCAAACCCAGG - Intergenic
1043083191 8:75792989-75793011 TTTTTCCTGGCTTCAGACCCAGG - Intergenic
1045499710 8:102735675-102735697 TTTTTCCTGTAAGGAAACCCTGG - Intergenic
1046238411 8:111457676-111457698 TTTTTTTTGTCATTAAACCTTGG + Intergenic
1047018596 8:120750253-120750275 CTTTTGCTATCACCAGACCCTGG - Intronic
1048222013 8:132550782-132550804 GTTTTCCTGTCATAAAACCAAGG - Intergenic
1053413081 9:37928288-37928310 ATTTTGCTGTCCCCAAGCCCAGG - Intronic
1056671262 9:88629306-88629328 TTTTTGTTTTCATCAAGCCGTGG + Intergenic
1056706429 9:88955948-88955970 TCTTTGCAGTCAATAAACCCAGG - Intergenic
1059619264 9:115985347-115985369 TTTTTGCAGTCTGCAAATCCTGG - Intergenic
1061338870 9:129962682-129962704 TTTTTGGTCTCTGCAAACCCAGG + Intronic
1061768976 9:132902813-132902835 TTTTAGCTGTCTTCCAACACAGG + Intronic
1185980605 X:4774055-4774077 TCTTTGCTCTCCTCAAACCATGG + Intergenic
1190163372 X:48050725-48050747 ATTTTGCTGTAATAAAACCTAGG + Intronic
1190596666 X:52059240-52059262 TTTTTGTCGTCATCAGGCCCTGG - Intergenic
1190612158 X:52194833-52194855 TTTTTGTCGTCATCAGGCCCTGG + Intergenic
1194081529 X:89472569-89472591 TTTTTTCTGTCAGCAAATCTAGG - Intergenic
1195700523 X:107702231-107702253 TTTTTGCTGTTATTACAGCCAGG + Intergenic
1199545820 X:149006558-149006580 TTTTTGCAGCCATGAAACTCAGG + Intergenic
1200434203 Y:3128762-3128784 TTTTTTCTGTCAGCAAATCTAGG - Intergenic
1200924428 Y:8641819-8641841 TTTTTGCTCTCTGAAAACCCTGG - Intergenic
1201523648 Y:14905733-14905755 CTCTTGCTGTCATAAAACCAGGG - Intergenic