ID: 1026558476

View in Genome Browser
Species Human (GRCh38)
Location 7:71428416-71428438
Sequence ATGTCCACCAAGAAAAGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 288}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026558476_1026558479 28 Left 1026558476 7:71428416-71428438 CCATTGCTTTTCTTGGTGGACAT 0: 1
1: 0
2: 0
3: 24
4: 288
Right 1026558479 7:71428467-71428489 TCTCTCCCTGTCACCCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026558476 Original CRISPR ATGTCCACCAAGAAAAGCAA TGG (reversed) Intronic
900831731 1:4970312-4970334 CTCTCCAACAAGGAAAGCAAAGG - Intergenic
903651442 1:24924900-24924922 GTGTGAACCAAGAAAAGGAAGGG - Intronic
905335469 1:37241633-37241655 ATGTCCAGCAATTAAAGCCATGG + Intergenic
905477701 1:38240513-38240535 ATGTGAACCAATAAAAGCAGGGG - Intergenic
905990283 1:42331420-42331442 ATGTCCATCAACTAAAGCAATGG + Intronic
907049909 1:51322999-51323021 ATATCCACCAAAAAAAAGAAAGG - Intronic
907109233 1:51911512-51911534 AACTCCAACAAGCAAAGCAAAGG + Exonic
907644095 1:56224209-56224231 ATGACGACTAAGCAAAGCAAGGG + Intergenic
908563444 1:65330348-65330370 ATGTGCACAAAGAAAAAGAAAGG - Intronic
909095622 1:71284174-71284196 AAGTCAACAAAGACAAGCAATGG - Intergenic
910254384 1:85232814-85232836 ATGTCTACAAAAACAAGCAATGG - Intergenic
914860686 1:151383439-151383461 CTGTCCACCCAGCAAAGCATGGG - Intergenic
916613844 1:166419674-166419696 ATGTCAACAAAGAGAAGGAAAGG - Intergenic
916616187 1:166443355-166443377 CTGTCCTCCAAGAAATGCTAAGG - Intergenic
916720469 1:167481740-167481762 ATTTCCTCCAGGAAAAGCAGTGG + Intronic
916856467 1:168755451-168755473 CTGGCCACAAGGAAAAGCAAAGG - Intergenic
917943306 1:179944992-179945014 ATGTCCATCAATAAAAGAATGGG - Intergenic
918867703 1:189924793-189924815 ATGTCAACAAAAACAAGCAATGG + Intergenic
918955456 1:191201047-191201069 ATGTAAACCAAAAAAAGCAGGGG + Intergenic
920519355 1:206612195-206612217 ATGTCGGCCAAGAATAGCGAGGG + Intronic
921373743 1:214451850-214451872 ATGACTCCAAAGAAAAGCAAAGG + Exonic
921534914 1:216335788-216335810 ATTTCCACAAAGAAAAGCTTAGG + Intronic
922589183 1:226760672-226760694 ATGTAGAAAAAGAAAAGCAATGG + Intergenic
1064184676 10:13151114-13151136 AGATCCACCAAGAAGAACAATGG - Intergenic
1064876392 10:19999527-19999549 ATGTCAACCTAGATAAGAAATGG - Intronic
1065156072 10:22871302-22871324 ATGTGCACCAAGAGAAGCTCTGG - Intergenic
1065319732 10:24498188-24498210 ATGTCCAGCAAGAAGAGAAGTGG + Intronic
1065457996 10:25927677-25927699 ACGTGCACAAAGAAAAGCCAGGG + Intergenic
1065738861 10:28778560-28778582 ATGTTCACCCCGAAAAGCACTGG + Intergenic
1067387198 10:45826891-45826913 ATCTCCACCTCTAAAAGCAATGG - Exonic
1068187562 10:53605724-53605746 GTGTCCACCAAGAATAGAAAAGG - Intergenic
1072903011 10:99426230-99426252 ATGTCCAGGAAGAAGAGCAGTGG - Intronic
1073837475 10:107461364-107461386 ATCTACACCACGAAAAGGAAGGG + Intergenic
1074008510 10:109453376-109453398 ATGTCAACAAATAAAAGCAGTGG - Intergenic
1074144667 10:110706480-110706502 ATATCCGCCAGGAAATGCAACGG + Intronic
1076560724 10:131361607-131361629 ATGGGCACCAAGAAAGGCAGGGG - Intergenic
1078275853 11:9845618-9845640 TTGTCCAGCAGCAAAAGCAAAGG + Exonic
1078393387 11:10956081-10956103 CTGTGCACCTGGAAAAGCAATGG - Intergenic
1079713330 11:23713680-23713702 AAGTCCACAAAAATAAGCAATGG - Intergenic
1080256931 11:30300782-30300804 AAGTCAACCAAAACAAGCAATGG + Intergenic
1080570390 11:33551025-33551047 ATGTCCACCTACAAAACAAATGG - Exonic
1082264662 11:50106021-50106043 ATGTCCATTATGAAAAGCCAAGG - Intergenic
1084395907 11:68909948-68909970 ACGTTCTCCAAGAACAGCAAAGG - Intronic
1084747818 11:71184361-71184383 CTGGCCCCCACGAAAAGCAATGG + Intronic
1085303867 11:75474146-75474168 ATTTCCTCCAGGAAGAGCAAGGG - Intronic
1086241832 11:84703420-84703442 ATTTCTACCAAGATAAGCAGTGG + Intronic
1086986793 11:93260039-93260061 ATGCCCAACCAAAAAAGCAAAGG - Intergenic
1087250894 11:95898440-95898462 AAGTTCACCAACAACAGCAAGGG - Intronic
1087320682 11:96654243-96654265 ATGTCCAACATGAAAAGAACTGG - Intergenic
1088416501 11:109595028-109595050 AAGTCCACCAAGAGACGCATGGG - Intergenic
1088784953 11:113173060-113173082 ATGTTCCCTCAGAAAAGCAATGG + Intronic
1091869086 12:3872623-3872645 CTGTCCACCAAGAAGGGAAAAGG + Intronic
1092146398 12:6217701-6217723 TTGTCCTCCTGGAAAAGCAATGG - Intronic
1092629204 12:10360576-10360598 ATGCTTACCAAGAAAAACAATGG + Intergenic
1092955675 12:13547369-13547391 ATGGCCACCCAGAAGAGGAAAGG + Exonic
1093733860 12:22596068-22596090 ATCTCGATCAAGAAAAGTAATGG - Intergenic
1098441069 12:70518893-70518915 ATGCCCACCAAGACAGGAAATGG + Exonic
1098467257 12:70801555-70801577 ATGAGAACCAAGAAAGGCAATGG - Intronic
1098916821 12:76266097-76266119 AGGTCCACCAACAATATCAAGGG - Intergenic
1098937023 12:76491675-76491697 ATGTCTACCATGCAAAGCACTGG - Intronic
1099511371 12:83543022-83543044 ATGTCCACCAAGAAATTAAATGG - Intergenic
1099577434 12:84399367-84399389 ATGTCAACAAAAATAAGCAATGG + Intergenic
1100226912 12:92567206-92567228 ATGTCCTGAATGAAAAGCAATGG + Intergenic
1101272295 12:103160490-103160512 TTTTCCCCCAAGTAAAGCAAAGG + Intronic
1101488207 12:105187085-105187107 ATTTCCACCAAAAAGATCAAAGG - Intronic
1102538432 12:113600107-113600129 AAGTTAACCAAGAAGAGCAAAGG + Intergenic
1103242802 12:119428991-119429013 AGGTCCAGGAAGAAAAGCAGAGG - Intronic
1107331406 13:39304984-39305006 AGTTCTACCAAGAAATGCAATGG + Intergenic
1107654660 13:42579222-42579244 ATCTCTACCAAGAAAAAAAAAGG + Intronic
1107745832 13:43507242-43507264 ATTCCCAGTAAGAAAAGCAAAGG + Intronic
1107818013 13:44261658-44261680 ATGTCCATCAAGAAGAGGAAGGG + Intergenic
1108259767 13:48644939-48644961 ATGTGCACCAGGAGAAGAAATGG + Intergenic
1111369099 13:87292661-87292683 AAGTCAACCAAAATAAGCAATGG + Intergenic
1111508567 13:89229345-89229367 AGGTCAACAAAGACAAGCAATGG - Intergenic
1112344775 13:98579929-98579951 ATTTCCACCAAGGAAAGAAAAGG + Intergenic
1113369348 13:109708287-109708309 ATGACAACCAAGAAAAGACAGGG - Intergenic
1114138819 14:19887711-19887733 AAGTCAACAAAGACAAGCAATGG - Intergenic
1114308508 14:21444938-21444960 GAGTCTACCAAGAAAAGCTATGG - Intronic
1114602749 14:23969667-23969689 AGGCCCACAAACAAAAGCAATGG + Intergenic
1115264747 14:31489483-31489505 GTTTTCACCAAGAAAAGCTAAGG + Intergenic
1116014289 14:39387721-39387743 ATGTCCACAAAAAGAAGGAATGG + Intronic
1117118887 14:52547829-52547851 ACCTCCACCAGGAAAAGCCAAGG + Intronic
1117912258 14:60647609-60647631 TTTTCCACCAAGACAAGAAAGGG + Intronic
1117986608 14:61392425-61392447 ATGTCTACGATGAAAAGCAATGG - Intronic
1118266200 14:64296866-64296888 CTGTCCATCAAGAAAGACAATGG + Intronic
1118675745 14:68182939-68182961 GTGTCAACCAAGGAAAGAAAAGG - Intronic
1120120490 14:80673739-80673761 ATCTCCTTCAAGAAAACCAAAGG - Intronic
1120428694 14:84386179-84386201 ATGCCAACCAAGAAAAGCTCAGG + Intergenic
1120699728 14:87685808-87685830 ATCTCCTCCAAATAAAGCAAAGG + Intergenic
1121042820 14:90762914-90762936 ATGTCTACAAAGAAAAGCCCAGG + Intronic
1121899634 14:97682147-97682169 GGCTCCAGCAAGAAAAGCAATGG - Intergenic
1121971633 14:98362769-98362791 ATTTCAACTAAGACAAGCAAAGG + Intergenic
1122259669 14:100507171-100507193 AAGTCAACCAAAATAAGCAATGG - Intronic
1124024773 15:25955231-25955253 ATGCCCTCCAAGAAAAGCTCTGG - Intergenic
1124682442 15:31746291-31746313 ATGTCCATCAAGAAGAGAATGGG + Intronic
1126184044 15:45813311-45813333 ATGTCCTGCAAGAAATGCTAAGG + Intergenic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1126794049 15:52245458-52245480 ATGTCCACCTGGAAAATCAAAGG + Exonic
1128378669 15:67095158-67095180 TTGTCCACCCAGTAAAGCAGGGG - Intronic
1129556910 15:76519939-76519961 ATGTCCATCAAGAACATTAAGGG - Intronic
1129777862 15:78248528-78248550 ATGTCCACCAAGAGTAGAATGGG + Intergenic
1132670797 16:1101614-1101636 AAGTCCACCAAAAAAAGCCCCGG + Intergenic
1133621631 16:7532142-7532164 TTTTTCACTAAGAAAAGCAACGG + Intronic
1134821273 16:17249286-17249308 GTGTGCACCAAGCAAAGCAATGG - Intronic
1135409885 16:22225636-22225658 AGGTCCTACAAGGAAAGCAAGGG - Exonic
1138292494 16:55859939-55859961 ATATCTACCAAGAAAAACAGTGG + Intronic
1139026547 16:62824859-62824881 GGGTCCACCATGGAAAGCAATGG - Intergenic
1140628628 16:76824817-76824839 ATGTTTACCAAGAAATGAAAAGG - Intergenic
1142285422 16:89169662-89169684 AGGTCCACCAGGAAAGGGAAGGG + Intergenic
1144277815 17:13691228-13691250 ATGTTCACCTAGAAAAGTATAGG - Intergenic
1144633718 17:16889753-16889775 ATCTCCACCAAGAAGACCCAGGG - Intergenic
1146761808 17:35485762-35485784 AAGTCCACCAAAATAACCAATGG - Intronic
1147601239 17:41746926-41746948 ATATCTCCCAAGGAAAGCAATGG - Intergenic
1148630423 17:49103930-49103952 ATGCCAACCAAGAAAAAAAAAGG + Intergenic
1150418383 17:65006309-65006331 AAGTACACCAAGAAAACAAAAGG - Intergenic
1150470190 17:65430754-65430776 ATGTCCATCAAGTAAGACAATGG - Intergenic
1150513466 17:65781728-65781750 AAGTCAACCAAAATAAGCAATGG + Intronic
1151615297 17:75206065-75206087 ATGCCCAAGAGGAAAAGCAAGGG - Intronic
1151868135 17:76818541-76818563 AAGTTCACGTAGAAAAGCAAAGG - Intergenic
1152973512 18:189154-189176 ATCTCTAGCAAGAAAATCAAGGG - Intronic
1154367405 18:13724120-13724142 AGCTCCACCAAGACAAGGAAAGG - Intronic
1154999428 18:21672261-21672283 ATCTCCTCCAAGAATAGCTAGGG - Intronic
1158821209 18:61161143-61161165 ACGTCAGCCAAGGAAAGCAATGG + Intergenic
1160036795 18:75309380-75309402 AAGGACACCAAGAAAAGCAAAGG - Intergenic
1160250051 18:77195056-77195078 AAGTCAACCAAAACAAGCAACGG - Intergenic
1160354962 18:78219586-78219608 ATGTCAAACCAGAAAAACAACGG - Intergenic
1161247838 19:3264105-3264127 AAAACCACGAAGAAAAGCAAAGG - Intronic
1163799102 19:19354332-19354354 CTGTCAACCAAGAGCAGCAAGGG - Intronic
1164579083 19:29423232-29423254 ATGTCCACCCAGAAAATCAGAGG + Intergenic
1164767790 19:30784979-30785001 AGTACCACCAAGAAAAGCAGAGG + Intergenic
1166441323 19:42817826-42817848 AGGTCAAAAAAGAAAAGCAAAGG - Intronic
1166449502 19:42886138-42886160 AGGTCAAAAAAGAAAAGCAAAGG - Intronic
1166478096 19:43146421-43146443 AGGTCAAAAAAGAAAAGCAAAGG - Intronic
926306294 2:11639627-11639649 AGGGCCACCAAGGAAAGCGAAGG - Intronic
927234975 2:20864637-20864659 ATATTCACCAGAAAAAGCAATGG + Intergenic
927349438 2:22091322-22091344 AAGTCTACAAAAAAAAGCAATGG - Intergenic
927430432 2:23022451-23022473 TTGTCCACCCAGAAAACCCAAGG + Intergenic
927750218 2:25662295-25662317 ATGTCCATCAACAGAAGCATGGG + Intronic
928428550 2:31199391-31199413 AAATCCACCAAGATAAGCTAGGG + Intronic
930197070 2:48520770-48520792 ATGCCTAACAAGAAGAGCAAAGG - Intergenic
933981132 2:87551913-87551935 GGGTCCAGCAAGCAAAGCAAAGG - Intergenic
936228664 2:110680432-110680454 ATTTCCACCATGAAATACAAAGG + Intergenic
936312701 2:111398886-111398908 GGGTCCAGCAAGCAAAGCAAAGG + Intergenic
938049598 2:128156394-128156416 ATGTCCTCCAAGGAAATCTATGG + Exonic
941628283 2:167854733-167854755 ATTTCCAGGAAGAAAAGCTAAGG + Intergenic
942122669 2:172793618-172793640 ATATCCATCAAGAACAGCAGTGG + Intronic
942622408 2:177860463-177860485 ATTTCCACAAAGAAAAGCTCAGG + Intronic
943256133 2:185595689-185595711 ATGTCAACAAAAAAAAGCAGTGG + Intergenic
944013859 2:195008349-195008371 ATGTCCTGCAAGAATAGGAAAGG - Intergenic
944420401 2:199524157-199524179 CTGTCCAGCAACAGAAGCAAAGG + Intergenic
946441681 2:219702224-219702246 TTATCCCCCAAGAAAATCAAGGG - Intergenic
948733393 2:239981418-239981440 ATGTCTACAGAGAGAAGCAATGG + Intronic
1169263152 20:4152185-4152207 ATTTCTACCAAAGAAAGCAAAGG - Intronic
1170529733 20:17278964-17278986 ATGACAACCAAATAAAGCAATGG - Intronic
1173214125 20:41064177-41064199 AAGTCAACCAAAATAAGCAATGG - Intronic
1174102619 20:48138865-48138887 ATGTGCTCCAAGTAAAGGAATGG - Intergenic
1175379484 20:58552931-58552953 CAGTCCACCAAGAGAAGCACCGG - Intergenic
1176277563 20:64281177-64281199 ATGTCCACCAACAAATGAACAGG - Intronic
1177986668 21:27983958-27983980 ATGTGAGACAAGAAAAGCAAAGG + Intergenic
1178026251 21:28471614-28471636 AAGTCCACAAAAATAAGCAATGG + Intergenic
1178626044 21:34219737-34219759 ATCTCCACCAAGAAAACAAGTGG - Intergenic
1178991937 21:37364223-37364245 CTGTTCACCTTGAAAAGCAAAGG - Intergenic
1179453839 21:41484793-41484815 AGGTCCACCAAGAAGAGACAGGG + Intronic
1179648525 21:42791413-42791435 ATGTCCAGCAACAATGGCAATGG + Intergenic
1183387501 22:37523541-37523563 ATTACTACCAAGAAAAGTAAAGG - Intergenic
1184193679 22:42911939-42911961 ACCTCCACCAAAAAAACCAAAGG + Intronic
1185264131 22:49889643-49889665 ATGTCCACCAACGAAATGAAGGG - Exonic
949271504 3:2223196-2223218 TTGTCCACCTAGAACAGTAAAGG - Intronic
951102153 3:18701815-18701837 ATTGCCACAAAGAAAAGCACAGG - Intergenic
954079171 3:48202945-48202967 AAGTCCACAGAGCAAAGCAAAGG - Intergenic
954325780 3:49862555-49862577 ATGTCTAGCCAGAAAAGCAGGGG - Intronic
954538176 3:51376785-51376807 ATGTCCTCCATGATGAGCAAAGG - Intronic
955048287 3:55381999-55382021 ACAACCACAAAGAAAAGCAAGGG + Intergenic
955252029 3:57293190-57293212 ATATACACTAAAAAAAGCAAAGG + Intergenic
955753657 3:62206580-62206602 ATGTCCACAGACAATAGCAAAGG - Intronic
955776111 3:62435295-62435317 GTGTCCACCAAGCTAAACAAGGG - Intronic
956649558 3:71491507-71491529 ATGTCCACAATGAAAAGAAATGG - Intronic
957442102 3:80262388-80262410 ATTTCAACCCAGAAAAGTAAGGG - Intergenic
957580169 3:82061733-82061755 ATGTCAACAAAAATAAGCAATGG - Intergenic
958146944 3:89637562-89637584 ATGTTCACTAAGAATAGAAAGGG - Intergenic
963846294 3:150160984-150161006 ATGTCCACCAACAGAAGAATAGG - Intergenic
964397608 3:156262792-156262814 ATTTCCACAAAGAAAAGCCCAGG - Intronic
964595142 3:158418227-158418249 TTGTCCATCAATAAAAGCCAAGG + Intronic
964987427 3:162761536-162761558 ATGTCAACAAAAACAAGCAATGG - Intergenic
965437178 3:168666666-168666688 ATTTCCAAAAAGAAAAGCGATGG + Intergenic
965461860 3:168975722-168975744 AAGTCCTCCAAAAAAAGAAATGG - Intergenic
965472101 3:169106793-169106815 ATCTCTACCAGGAAAGGCAAAGG + Intronic
966026423 3:175288572-175288594 AGGAGCAGCAAGAAAAGCAATGG - Intronic
966198848 3:177340609-177340631 AGGACCACCAAGAATACCAATGG + Intergenic
966522173 3:180885715-180885737 ATATGCACCAATAAAAGGAATGG + Intronic
967696735 3:192541684-192541706 ATGTCCTCCAAGAAATGTAAGGG - Intronic
968856988 4:3132934-3132956 ATGTCCACTAAGTGAAGAAATGG - Intronic
969250341 4:5964004-5964026 ATGTGCAACTAGAAAAGCTAGGG + Intronic
969636496 4:8372453-8372475 AGGTGCACCAAGGAAAGCACGGG - Intronic
969644324 4:8418050-8418072 CTGTCCACGAAGAAAAACCAGGG + Intronic
971149829 4:24020364-24020386 TTGTCCCTCAAAAAAAGCAAGGG - Intergenic
971685871 4:29766882-29766904 AACTCCACCAACAAAAGTAATGG - Intergenic
971714443 4:30157524-30157546 ATTTCCTCCAAGAAAAGTTATGG - Intergenic
972363777 4:38354124-38354146 AAGTCAACCAATACAAGCAATGG + Intergenic
974094495 4:57348214-57348236 ATGTCAACAAAAAGAAGCAATGG - Intergenic
974627816 4:64446267-64446289 ATGGGCACCAAGAAAAATAATGG + Intergenic
976275528 4:83273540-83273562 CTGTCCCCCAAGAAAAACAAAGG + Exonic
976364756 4:84221150-84221172 GTGTACAGCAAGAAAAGCTAAGG + Intergenic
978147376 4:105391655-105391677 ATGTCCACCAAAGAAAGACAAGG + Intronic
978275682 4:106947042-106947064 GTGACTACCCAGAAAAGCAATGG - Intronic
979394753 4:120173758-120173780 ATGTAAGCCCAGAAAAGCAATGG + Intergenic
981948481 4:150377440-150377462 ATGTCTACCAAGTAAATTAAAGG + Intronic
984359363 4:178709156-178709178 ATGTCAAACACCAAAAGCAATGG + Intergenic
984631173 4:182062587-182062609 ATGACTACCAAAGAAAGCAATGG + Intergenic
985073225 4:186189512-186189534 ATGTCCACCATGAAATGTAATGG - Intergenic
985343868 4:188981267-188981289 AGGTCAAAGAAGAAAAGCAAGGG + Intergenic
985772521 5:1821822-1821844 AGGAGCACCAAGAAAAGCAAAGG - Intergenic
986908721 5:12527307-12527329 ATGAACACCAAGAGAAGCAGAGG - Intergenic
986990073 5:13542027-13542049 ATTTCTTCCAAGACAAGCAAAGG + Intergenic
987696397 5:21339355-21339377 ATTTCCACAAATAATAGCAAAGG - Intergenic
988755802 5:34247211-34247233 ATTTCCACAAATAATAGCAAAGG + Intergenic
990614809 5:57496838-57496860 ATGTGCTCCAAGAAAACCAGAGG + Intergenic
990860502 5:60321272-60321294 AAGTCAACAAAGACAAGCAATGG + Intronic
991151321 5:63374321-63374343 CTGTCCAAAGAGAAAAGCAAAGG + Intergenic
991744058 5:69713037-69713059 ATTTCCACAAATAATAGCAAAGG + Intergenic
991753649 5:69842201-69842223 ATTTCCACAAATAATAGCAAAGG - Intergenic
991795630 5:70292769-70292791 ATTTCCACAAATAATAGCAAAGG + Intergenic
991803266 5:70398926-70398948 ATTTCCACAAATAATAGCAAAGG - Intergenic
991823431 5:70588307-70588329 ATTTCCACAAATAATAGCAAAGG + Intergenic
991832967 5:70717322-70717344 ATTTCCACAAATAATAGCAAAGG - Intergenic
991887999 5:71292282-71292304 ATTTCCACAAATAATAGCAAAGG + Intergenic
992154046 5:73937183-73937205 ATGCCCACAAAGAAAAGGAATGG + Intronic
992920487 5:81511609-81511631 TTGTCCACCAAAATAAGCAGAGG - Intronic
993021003 5:82590769-82590791 ATGTTCAACATGAAAAGCACAGG - Intergenic
993160398 5:84283170-84283192 ATGTCCACTAAGCAAGGCTACGG + Intronic
993792724 5:92226566-92226588 AAGTAAACCAAAAAAAGCAATGG - Intergenic
994004143 5:94817928-94817950 ATGTCCACCACGCAGAGCCAGGG - Intronic
995918426 5:117279637-117279659 GTGTTCTTCAAGAAAAGCAAAGG - Intergenic
996522868 5:124447009-124447031 ATGTCCAGGTAGATAAGCAAAGG + Intergenic
996546309 5:124682407-124682429 ATGTGCACCACGAAAATGAAGGG + Intronic
996709772 5:126532806-126532828 ATGTCAACAAAGAAAATAAAAGG - Intergenic
997148691 5:131467397-131467419 ATGTCAACTTGGAAAAGCAATGG + Intronic
1002036398 5:176473770-176473792 ATCTCTACCAAGAAAAACAAAGG - Intronic
1003242931 6:4360254-4360276 AGGGCTACCAAGAGAAGCAAGGG + Intergenic
1005554447 6:26958999-26959021 ATTTCCACAAATAATAGCAAAGG + Intergenic
1008290977 6:49715770-49715792 ATGCCCTTCTAGAAAAGCAAAGG - Intergenic
1010865478 6:80971625-80971647 ATGTCCACAAAATAAAACAATGG - Intergenic
1011074550 6:83424648-83424670 ATGTCTACTAAACAAAGCAAGGG + Intronic
1011404234 6:87000729-87000751 CTGTCCTGCAAGAAATGCAAAGG + Intronic
1011615855 6:89197974-89197996 ATATTAACCAAGAAAAGCATTGG - Intronic
1013656060 6:112247840-112247862 ATGTCCATCAACAAAATGAATGG + Intronic
1013709339 6:112879408-112879430 ATGTCCACTAACAAAACAAAAGG + Intergenic
1014775485 6:125504249-125504271 ATGTGCACTCAGATAAGCAAAGG + Intergenic
1015830407 6:137362907-137362929 ATGTCCACCGAGAAAGGAGAGGG - Intergenic
1016845604 6:148565353-148565375 TTTTCCACCCAGAAAAACAATGG + Intergenic
1018660864 6:166086290-166086312 ACGTTCACATAGAAAAGCAATGG - Intergenic
1020672545 7:11135354-11135376 ATGTCCACAGGGAAAAGAAATGG + Intronic
1020828055 7:13056793-13056815 GAGACCAACAAGAAAAGCAAAGG + Intergenic
1021151320 7:17154088-17154110 CTGTCCACAAAGAAAAGTACAGG + Intergenic
1021402777 7:20228737-20228759 ATGTTCACACAGAAAAGCAGGGG + Intergenic
1021638676 7:22716890-22716912 ATGACCACCAAAAAAAAAAAAGG - Intergenic
1022420114 7:30212180-30212202 ATGTCTACCAGGGCAAGCAATGG - Intergenic
1023762759 7:43482156-43482178 GAGGACACCAAGAAAAGCAACGG + Intronic
1024497732 7:50067653-50067675 ATGTCCACCCAGCAATGAAAAGG + Intronic
1024734402 7:52288598-52288620 ATGCCCACCAAGTACAGCAATGG - Intergenic
1024916723 7:54509596-54509618 ATCCCTACCAAGAAAAACAATGG + Intergenic
1026558476 7:71428416-71428438 ATGTCCACCAAGAAAAGCAATGG - Intronic
1026930683 7:74221519-74221541 ATGGCCCCCAAGAGGAGCAATGG + Intronic
1028052726 7:86206678-86206700 ATGACCACCAAGAAAGGGAAGGG + Intergenic
1028748787 7:94358470-94358492 ATGTCAACAAAAATAAGCAATGG + Intergenic
1032200322 7:129817251-129817273 CTGTCCACAAAGAAAAGCTCAGG - Intergenic
1032351968 7:131172687-131172709 TTGTACACCATGAAAAGCCACGG + Intronic
1032845073 7:135745258-135745280 AGGTCCACCAAAAAATGGAAGGG + Intronic
1033348910 7:140546070-140546092 ATGTCCACCAAGCCATGCAAAGG + Intronic
1033497234 7:141911229-141911251 ATGTCCAAGAAGATAAGCACTGG - Intronic
1035927146 8:3740740-3740762 AGTTCCACAAAGGAAAGCAAAGG + Intronic
1036486213 8:9181605-9181627 ATTTCCAACAGGAAAAGCCAGGG + Intergenic
1036814761 8:11893564-11893586 CTGTCCTCCAAGAAATGCTAAGG - Intergenic
1039929970 8:41977148-41977170 AAGTTCAACAAGAAAACCAAAGG - Exonic
1040666331 8:49638685-49638707 ATGTCAAGGGAGAAAAGCAAGGG - Intergenic
1042104581 8:65312584-65312606 GTTTCCTTCAAGAAAAGCAATGG - Intergenic
1042704620 8:71653055-71653077 ATATCTACCAAGAACAGCTATGG - Intergenic
1044261322 8:90126200-90126222 ATATCCACCAAAATAAACAAAGG - Intergenic
1044309560 8:90678110-90678132 ATCTCCTCCATGAAAAACAAAGG + Intronic
1044593064 8:93932476-93932498 AGGTCAACCAAGACAAGCATGGG + Intergenic
1046712147 8:117521805-117521827 ATGTCCATCAACAGAAGAAAAGG - Intronic
1046769485 8:118103899-118103921 ATGTTCATAAAGTAAAGCAATGG + Intronic
1046813906 8:118563101-118563123 ATGCAAACCAAGAAAAGAAAAGG + Intronic
1046963253 8:120132324-120132346 ATGTCAACAAAAACAAGCAATGG - Intronic
1048938001 8:139372879-139372901 ATGACCTCCAAGAAAAGTCAGGG + Intergenic
1049135340 8:140892980-140893002 ATGTCTACCTAGAAATGGAATGG - Intronic
1049142223 8:140965322-140965344 ATGTACATCAAGTTAAGCAATGG - Intronic
1049560053 8:143305656-143305678 AAGTGCACCAAGAGCAGCAAGGG - Intronic
1051864490 9:21664150-21664172 ATTTACACCAAAAAAACCAATGG + Intergenic
1053379058 9:37634346-37634368 AATTACACCAAGAAAAGCTAAGG - Intronic
1055980232 9:81993634-81993656 CTGTCAACCAAGAAAAGCAGGGG + Exonic
1056110464 9:83389604-83389626 ATGTGGACCCAGAGAAGCAAAGG - Exonic
1057756808 9:97845751-97845773 ATTTCCACCAAGAGAAGAAAAGG - Intergenic
1058979444 9:110155617-110155639 GTGTACACCAACAAAGGCAATGG - Intronic
1061041473 9:128143364-128143386 ATGTGCACCAAGAAAAGAACAGG - Intergenic
1061159708 9:128886220-128886242 ACCTACAGCAAGAAAAGCAAAGG - Intronic
1185478040 X:426977-426999 ACGTCCCTCATGAAAAGCAATGG + Intergenic
1185793413 X:2944865-2944887 ATGGTCACGAAGAGAAGCAATGG + Intronic
1185874430 X:3690905-3690927 AACTCTACCAAGAAAAACAAGGG + Intronic
1186700734 X:12087213-12087235 GTGTCCACCAAGAATACCAAAGG + Intergenic
1186701254 X:12092617-12092639 AGGCCCATCAGGAAAAGCAATGG + Intergenic
1187647395 X:21363529-21363551 AGATCCAGCAAGAGAAGCAAGGG + Intergenic
1188200057 X:27286162-27286184 ATCGCCACCAATAAAAGAAACGG + Intergenic
1191078048 X:56476929-56476951 GTGTGAACCAAGAAAAGGAAAGG - Intergenic
1192985919 X:76398230-76398252 CTGTCAAAAAAGAAAAGCAATGG - Intergenic
1194791528 X:98157032-98157054 AAGTCGACCAAAACAAGCAACGG + Intergenic
1196043303 X:111229414-111229436 ATTTGCAATAAGAAAAGCAATGG + Intergenic
1196406496 X:115367894-115367916 ATATCCCCAAAGAGAAGCAAGGG - Intergenic
1197297018 X:124731202-124731224 ATTTAAACCAAGAAGAGCAAGGG + Intronic
1197631789 X:128869370-128869392 ATATGCACAAAGAACAGCAAGGG + Intergenic
1198733596 X:139761431-139761453 ATGTCAACCAAGAGAACCAGTGG - Intronic
1199322734 X:146460319-146460341 AAGTCGACAAAAAAAAGCAATGG + Intergenic
1199358947 X:146894863-146894885 TTGTCCAACAAGAAAATCATTGG + Intergenic