ID: 1026561685

View in Genome Browser
Species Human (GRCh38)
Location 7:71455681-71455703
Sequence CCACACTCCCCAGCCAGCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 1, 2: 1, 3: 39, 4: 471}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026561679_1026561685 26 Left 1026561679 7:71455632-71455654 CCAACAGTTCTTGTTCCCAGAGA 0: 1
1: 0
2: 1
3: 14
4: 201
Right 1026561685 7:71455681-71455703 CCACACTCCCCAGCCAGCACGGG 0: 1
1: 1
2: 1
3: 39
4: 471
1026561682_1026561685 10 Left 1026561682 7:71455648-71455670 CCAGAGAAGGCAGCTCTCTCTCA 0: 1
1: 0
2: 0
3: 20
4: 256
Right 1026561685 7:71455681-71455703 CCACACTCCCCAGCCAGCACGGG 0: 1
1: 1
2: 1
3: 39
4: 471
1026561681_1026561685 11 Left 1026561681 7:71455647-71455669 CCCAGAGAAGGCAGCTCTCTCTC 0: 1
1: 0
2: 5
3: 38
4: 314
Right 1026561685 7:71455681-71455703 CCACACTCCCCAGCCAGCACGGG 0: 1
1: 1
2: 1
3: 39
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026561685 Original CRISPR CCACACTCCCCAGCCAGCAC GGG Intronic
900286304 1:1902200-1902222 CCCCACCCCCCACCCAGCTCAGG + Intergenic
900391848 1:2437034-2437056 CCACAGTCCCCAGCCCAGACAGG + Intronic
900616950 1:3569751-3569773 GCCCACTCACCAGGCAGCACAGG + Intronic
901202884 1:7476564-7476586 CCACACACCTCACCCGGCACAGG + Intronic
901441694 1:9282088-9282110 GCACCCTCCCCAGCCGGCCCAGG + Intergenic
901659411 1:10789159-10789181 CCACACCCCCCACCCAAGACAGG + Intronic
902252038 1:15160209-15160231 CCCCACACCCTAACCAGCACAGG - Intronic
902359300 1:15933536-15933558 CCCACCTCCCCAGCCAGCACCGG + Exonic
902518483 1:17002434-17002456 CCATAGTCTCCAGCCTGCACAGG - Intronic
903215125 1:21839489-21839511 CCCCACTGCCCTGGCAGCACCGG - Exonic
903304197 1:22401196-22401218 CAACCCTCCCCAGGCCGCACTGG + Intergenic
903764873 1:25727703-25727725 CCACACTCCCTGCCCAGAACTGG - Intronic
903972958 1:27131033-27131055 CCAGTCTCAGCAGCCAGCACAGG - Intronic
904376544 1:30085648-30085670 CCACCCTCCCCACCCTGCCCTGG - Intergenic
904859047 1:33521152-33521174 CCACACCCTCCAGCCAGCCCTGG - Intronic
905548782 1:38819449-38819471 CCACCTTCCCCAGCCAGGTCAGG - Intergenic
906657927 1:47562100-47562122 CCACATGCACCAGCCAGCCCAGG - Intergenic
908847348 1:68338588-68338610 CCACCATGCCCAGCCAGCCCTGG - Intergenic
909734182 1:78935390-78935412 CCCCACTCCCCAGCAGGCCCTGG - Intronic
913278696 1:117164343-117164365 CCCCACCCCCCTGCCAGAACTGG - Intronic
914959692 1:152195762-152195784 GCACATGCCCCAGCAAGCACAGG + Intergenic
915244974 1:154550397-154550419 CCTCCCTCCCCAGGCACCACTGG - Exonic
915587914 1:156854345-156854367 CCAAATTCCCCATCCAGCCCTGG + Intronic
915658607 1:157382217-157382239 CCACACCCCCCAACAAGCCCTGG + Intergenic
916037548 1:160934379-160934401 CCAAACTCCCCATCAAGCACTGG + Intergenic
918542746 1:185649313-185649335 CCACACCTCCCAGCAAGCAGTGG + Intergenic
919989402 1:202698678-202698700 CCAGACTCACCAGGCAGAACAGG + Intronic
921024105 1:211260784-211260806 CCTCGCTCGCCAGCCAGCTCTGG + Intronic
922166183 1:223117321-223117343 CCACACCTCCCAGCAAGCAGAGG + Intronic
922228973 1:223669081-223669103 CCTCACACCCCAGGCACCACAGG + Intergenic
922307446 1:224356828-224356850 CCACACGCCTCAGCCAGCCCCGG + Exonic
922775976 1:228214355-228214377 CCACATCCTCCAGGCAGCACTGG - Exonic
923541777 1:234893448-234893470 CCACACTGCCCATCCTGCATTGG - Intergenic
924945274 1:248842360-248842382 CCACACTCCCCAGATTTCACAGG - Intronic
1062851144 10:744202-744224 CCACTGTCCCCACCCAGCCCAGG - Intergenic
1064620000 10:17205761-17205783 CCACAGTGCCCAGCCAGAAGAGG - Intergenic
1065812321 10:29453521-29453543 CCACCGTCCTCAGCCATCACAGG - Intergenic
1066613641 10:37275710-37275732 CCACACTTCCCTGCAAGCAGAGG + Intronic
1068461651 10:57337092-57337114 CCACACCTCCCAGCGAGCAGAGG + Intergenic
1068866930 10:61903898-61903920 CCACCCTCCCCGGCCAGCTTTGG + Intronic
1068911265 10:62380969-62380991 CCACACACCTCACACAGCACTGG - Intronic
1070504429 10:77100470-77100492 CCAGTCTCCACAGCCAGTACTGG - Intronic
1070537886 10:77393011-77393033 CTCCAGTCCCCAGCCAGCTCAGG + Intronic
1070544110 10:77439420-77439442 CCATACTCCCCAGCCACAAAGGG - Intronic
1070609710 10:77925388-77925410 CCACACTCCACGGCCAGGCCAGG + Intronic
1070759163 10:79012724-79012746 CCAAGCTCCTCAGCCAGCAGAGG + Intergenic
1070769956 10:79076442-79076464 CCACACTCCCCTGGCTGCAGAGG - Intronic
1070793602 10:79204076-79204098 CAACAGTCCCCAGCCAGCCGAGG - Intronic
1070811769 10:79301654-79301676 TCACATTCCCCAGCCAGAATGGG - Intronic
1072054463 10:91740623-91740645 CTCCCCTCCCCTGCCAGCACAGG - Intergenic
1072721268 10:97782388-97782410 GCACACCCCCCAGCCAGGAGAGG + Intergenic
1072804254 10:98414796-98414818 CCACACAGCAGAGCCAGCACCGG + Intronic
1073288804 10:102403260-102403282 CCAAACCCTCCAGCCAGCCCCGG - Exonic
1074130310 10:110567941-110567963 CCACAGTCCCCGCCCAGCCCTGG - Intronic
1074188619 10:111117002-111117024 CCCCAATCCCCAGCCAGCCGGGG - Intergenic
1074399412 10:113129407-113129429 CCATGTTCCCCAGCCAGCTCAGG - Intronic
1075264652 10:120990147-120990169 CCACATGCCCCAGCCAGGAGGGG - Intergenic
1075393942 10:122113395-122113417 CCACACTCCTCTGCCAGCAGGGG - Intronic
1075920039 10:126203817-126203839 CCACACTCCCAACACAGAACTGG - Intronic
1076027533 10:127128544-127128566 CCCCACTCCCCAGCAGGCCCCGG + Intronic
1076324223 10:129608859-129608881 CCACACTCCGCATTCAGCCCGGG - Intronic
1076704150 10:132292085-132292107 CCTCAGACCCCAGTCAGCACTGG + Intronic
1076856546 10:133118075-133118097 CCACCGTCCCCAATCAGCACTGG + Intronic
1076898154 10:133324488-133324510 CCGCCCACCCCAGCCAGCAGCGG - Intronic
1077031643 11:470873-470895 CCACCGCACCCAGCCAGCACCGG + Intronic
1077324720 11:1958777-1958799 CCTCACTCCCCAGTCGTCACTGG + Intronic
1077375702 11:2204258-2204280 CACCACTCCCCAGCCACCCCTGG - Intergenic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1081652238 11:44832194-44832216 ACACACTGCCCACCTAGCACGGG - Intronic
1083134085 11:60655228-60655250 CCACCATGCCCAGCCAGCAGAGG + Intergenic
1083444002 11:62695106-62695128 TCAGTCTCCCCAGCCAGCTCTGG + Intronic
1083879568 11:65541346-65541368 CCACCCTGCCCACCCACCACAGG + Intronic
1083949622 11:65946876-65946898 CACCACTCCCCAGGCAGCCCTGG - Exonic
1084490611 11:69476356-69476378 CCAGAGTCCCCACCCAGCCCTGG + Intergenic
1084965455 11:72742036-72742058 TCACCCTCTCCAGCCAACACAGG - Intronic
1085015126 11:73169063-73169085 TCCAACTCCCCAGTCAGCACTGG - Intergenic
1085082448 11:73646199-73646221 CCAGACTGCGCAGCCAGGACTGG + Exonic
1086601909 11:88643382-88643404 CCAGACTCCACATCCAACACTGG + Intronic
1087243967 11:95812516-95812538 CCACACTCCCCACCCCACCCGGG + Intronic
1088711347 11:112511681-112511703 ACACACTCCCCATCTACCACAGG + Intergenic
1088795185 11:113261495-113261517 ACACCCACCCCAGCAAGCACTGG - Intronic
1088997007 11:115009774-115009796 CCACACTCCCCCGCCATTTCAGG + Intergenic
1089110845 11:116054736-116054758 CCACACTGCCCACCCAGAACTGG - Intergenic
1089954427 11:122556784-122556806 CCACACCTCCCCGCCAGCAGAGG - Intergenic
1090005423 11:122998328-122998350 ACACACTCCCCAGCCAGGCAGGG + Intergenic
1090183064 11:124717974-124717996 CCAGGCTCCTCAGCCATCACAGG - Intergenic
1090404410 11:126468284-126468306 CCACTGTCCCCAGACAGCCCAGG + Intronic
1090480207 11:127061252-127061274 TGCCACTTCCCAGCCAGCACTGG - Intergenic
1091034623 11:132222107-132222129 CCACCCTCCCCAGCAACCTCAGG + Intronic
1202807700 11_KI270721v1_random:13954-13976 CCTCACTCCCCAGTCGTCACTGG + Intergenic
1091782940 12:3225298-3225320 CGCCACTCCCCAGCCTGCCCAGG + Intronic
1092229325 12:6767912-6767934 CCACACTCTTGAGACAGCACGGG - Intronic
1092378505 12:7975627-7975649 CCACTGTGCCCAGCCAGCAATGG - Intergenic
1092502241 12:9059970-9059992 CCACTGTGCCCAGCCAGCCCTGG + Intergenic
1092856368 12:12677784-12677806 CCACCCTGCCTAGCCAGCATAGG - Intronic
1093817064 12:23561744-23561766 TGACAATTCCCAGCCAGCACTGG + Intronic
1094108745 12:26839153-26839175 CCACACCCCACAGCAAGCAGAGG - Intergenic
1095774193 12:45994240-45994262 CCACCATGCCCAGCCACCACTGG - Intergenic
1096817685 12:54211616-54211638 CCACACTCCCCATCCTACTCAGG - Intergenic
1097593460 12:61599854-61599876 CCACTTTCAGCAGCCAGCACAGG - Intergenic
1099437288 12:82659602-82659624 CCACACCTCCCAGCAAGCAGAGG + Intergenic
1099653135 12:85455576-85455598 CCACCCTCCACAGACAGCAGAGG - Intergenic
1100544719 12:95590702-95590724 CCACCATGCCCAGCCAGCAGAGG + Intergenic
1101463855 12:104926794-104926816 CCACTGTGCCCAGCCAACACTGG - Intronic
1101683015 12:106987317-106987339 CCAGATGCCCCCGCCAGCACAGG - Intergenic
1101741317 12:107502355-107502377 CCACCGTGCCCAGCCAGCATTGG + Intronic
1103958166 12:124591066-124591088 CCTAACTCACCAGCCAGCCCCGG + Intergenic
1104880367 12:132066821-132066843 CCAGGCACCCCAGCCAGCCCAGG + Exonic
1104918951 12:132280655-132280677 CCAGACTCCTGAGCCAGCAGAGG + Intronic
1105510383 13:21047189-21047211 CCGCCCTCAGCAGCCAGCACAGG + Intronic
1105701578 13:22939023-22939045 CCACACCTCCCAGCAAGCAGAGG + Intergenic
1105786934 13:23759376-23759398 CCACCCCCACCAGACAGCACAGG + Intronic
1105786960 13:23759461-23759483 CCACACCCCCAAGACAGCACGGG + Intronic
1106193425 13:27473853-27473875 CCACACTGCCCTTCCAGCAAAGG + Intergenic
1106583840 13:31039726-31039748 CCACACTCCATCTCCAGCACTGG - Intergenic
1107630830 13:42341517-42341539 CCCCACTCCAGAGCCAGCCCTGG - Intergenic
1107945263 13:45412379-45412401 CCACTATGCCCAGCCACCACAGG + Intronic
1108090838 13:46848034-46848056 CCAAACTTCCCATCCAGCTCAGG + Intronic
1108686691 13:52826248-52826270 CCACACCTCCCAGCAAGCAGAGG - Intergenic
1109001380 13:56810638-56810660 CAACTCTCTCCAGCCAGCACAGG + Intergenic
1109273022 13:60274968-60274990 CCAGATTTCCCAGCCAGCATCGG - Intergenic
1109429409 13:62212445-62212467 CCACACCTCACAGCCAGCAGAGG + Intergenic
1110105714 13:71673597-71673619 CCACACCCCCCAACAGGCACCGG - Intronic
1110596945 13:77329520-77329542 CCCCACTCCCCCGCCATCCCAGG - Intergenic
1111197591 13:84894915-84894937 CCACACCTCCCTGCCAGCAGAGG + Intergenic
1112055101 13:95683637-95683659 CCACAGTGCCCAGCCGGAACTGG - Intronic
1112281189 13:98064415-98064437 ACACACTCTTCAGACAGCACGGG + Intergenic
1113330223 13:109319446-109319468 CCACACTTCCCTGCAAGCAGAGG + Intergenic
1113627369 13:111856906-111856928 CCTGACTCCCCAGGCAGCACTGG - Intergenic
1114737548 14:25057937-25057959 CAACACTCCCCAACCAGACCTGG + Intergenic
1115294793 14:31813272-31813294 CCACCGTGCCCAGCCAGCTCTGG + Intronic
1115349908 14:32382722-32382744 CCACACTCCCCATCTACCACAGG - Intronic
1117297771 14:54394737-54394759 CCACACTGCCCCGCAAGCAGAGG + Intergenic
1117742581 14:58833904-58833926 CCACACCTCCCAGCAAGCAGAGG - Intergenic
1118601236 14:67472642-67472664 CCCAGCTCCCTAGCCAGCACAGG - Exonic
1118642781 14:67807776-67807798 GCAGTCTCCCCAGCCAGCACAGG - Exonic
1118686077 14:68292457-68292479 CCACCCTCCCCTGCTAGCAAAGG + Intronic
1118857850 14:69637826-69637848 CCACACTCCCTCCCCTGCACAGG - Intronic
1119080740 14:71691302-71691324 CCACAGCACCCAGCCAACACAGG - Intronic
1119310022 14:73638288-73638310 CCACTGCGCCCAGCCAGCACTGG - Intergenic
1119863795 14:77956435-77956457 CCCCACTCCCCTGCCTGCCCGGG + Intergenic
1120030091 14:79631428-79631450 CCACACCTCCCCGCCAGCAGAGG - Intronic
1120121148 14:80681176-80681198 CCACACTCCCTAGCGAGGAAGGG + Intronic
1120878526 14:89396545-89396567 CCACCGTGCCCAGCCAGCAGTGG - Intronic
1121215230 14:92242522-92242544 CCAGACTCCTCAGCCAGGCCTGG - Intergenic
1121665490 14:95668951-95668973 CCTCACTCCCCAGCCTCCTCTGG + Intergenic
1121787397 14:96672647-96672669 CCACACTCCCCAACAGGCCCCGG + Intergenic
1121788186 14:96678719-96678741 GCATGCTTCCCAGCCAGCACTGG + Intergenic
1122127704 14:99588052-99588074 CCACACCCCCAGGCCTGCACAGG + Intronic
1122154210 14:99740643-99740665 CCACACACCACGGCCAGCAAAGG + Intronic
1122474519 14:101997639-101997661 CCACAATCCACTGGCAGCACTGG - Intronic
1122819721 14:104335362-104335384 CCCCACTCCCCAGTCTCCACTGG - Intergenic
1124023505 15:25944552-25944574 CCACACCTCCCCGCCAGCAGAGG + Intergenic
1124505605 15:30270463-30270485 TCTCACCCCACAGCCAGCACAGG - Intergenic
1124655966 15:31507623-31507645 CCCCGCCCCCCAGCCAGCAGCGG - Intronic
1124737948 15:32268169-32268191 TCTCACCCCACAGCCAGCACAGG + Intergenic
1124844979 15:33281338-33281360 CCATCCTCCCCACTCAGCACTGG - Intergenic
1126691107 15:51289619-51289641 CCCCACTCTCCAGCCAGCCAGGG + Intronic
1128528177 15:68426451-68426473 CCCCTCTCCCCACCCAGCTCAGG - Intronic
1129208783 15:74053450-74053472 CCCCCCGCCCCAGCCAGCAGTGG + Intergenic
1129460299 15:75697073-75697095 CCACCTTCCCCAGCCAGGCCAGG + Intronic
1129517161 15:76163711-76163733 CAACACCCCACAGCCTGCACTGG - Intronic
1130113317 15:80984580-80984602 CCCAACTCCCTAGCCAGCCCCGG - Intronic
1130164401 15:81437803-81437825 CCACAATCCCAAACCACCACAGG + Intergenic
1132149321 15:99448154-99448176 CCACACTCCCCACCCAGCTTGGG + Intergenic
1132915243 16:2340477-2340499 CCACCCTCGCCGGCCAGCTCGGG - Intronic
1134155554 16:11840112-11840134 ACAAACTCCCTAACCAGCACTGG + Intronic
1134638033 16:15807749-15807771 CCAGACTCCCCACCCAGCCTCGG + Intronic
1135035087 16:19070443-19070465 CCACCATGCCCAGCCAGCATTGG - Intronic
1135138377 16:19901419-19901441 GCAGAGTCCCCAGGCAGCACAGG - Intergenic
1135754916 16:25089217-25089239 CCTCATTCCCCAGCCTGCTCCGG + Intergenic
1135811994 16:25596054-25596076 CCCCACCCCCCAACCAGCCCCGG - Intergenic
1136084839 16:27877525-27877547 TCACCTTCTCCAGCCAGCACAGG - Intronic
1136136963 16:28262101-28262123 CCACCCTCCCCAGCCAGCACTGG - Intergenic
1136248130 16:28986591-28986613 CCAGACTCCCCACCCAGCCTGGG - Intronic
1136379113 16:29883642-29883664 CCACCCTGCCCAGCCAACAGAGG - Intronic
1137723441 16:50641294-50641316 CCACACTCCCCAGGAAGCTGTGG + Intergenic
1138015194 16:53421432-53421454 CCACACCTCCCGGCCAGCAGAGG + Intergenic
1138535002 16:57655201-57655223 CAAGACTCCCCAGCCAGAGCTGG + Intronic
1138556721 16:57775203-57775225 CCATGCTCCCCAGCCTGCCCTGG - Intronic
1140246576 16:73255367-73255389 CATCCATCCCCAGCCAGCACTGG + Intergenic
1141442956 16:84041251-84041273 CCACACTCCCCACACAGAGCCGG - Intronic
1141630867 16:85287293-85287315 CCCCACTCCCCAGCTTGCTCCGG - Intergenic
1141893578 16:86944279-86944301 CCACACCCCTCACCCAGCACTGG + Intergenic
1142216760 16:88833932-88833954 CCACAACCACCAGCCAGCAGGGG - Intronic
1142641725 17:1288904-1288926 CCAGACTCCCCATCCCCCACGGG + Intronic
1142641804 17:1289070-1289092 CCAGACTCCCCATCCCCCACGGG + Intronic
1143194331 17:5064004-5064026 CCACCGTGCCCAGCCAGCATTGG - Intergenic
1143252414 17:5533219-5533241 CCACTCTCCCCAGCATGCCCAGG + Intronic
1143514775 17:7414163-7414185 CCTCCCTCCCCAGCTAGCCCTGG - Intronic
1143541403 17:7571699-7571721 CCACACTCCCCTGCAAACAGAGG - Exonic
1143650070 17:8257926-8257948 CCAGCCTCACCAGCCAGCACTGG - Exonic
1144744435 17:17604263-17604285 CCCCACTCCCCTGTCACCACGGG + Intergenic
1144748063 17:17628888-17628910 ACACACTCACCAGCCAGCTCAGG + Intergenic
1144993310 17:19249059-19249081 CCAGACTCTCCAGGCAGGACAGG + Intronic
1147602456 17:41754865-41754887 CCTCACTCCCCAGGGAGCTCTGG - Exonic
1147805303 17:43126815-43126837 CCACACTTCCCCGCAAGCAGAGG - Intergenic
1148148806 17:45383976-45383998 CCACCGTGCCCAGCCAACACTGG + Intergenic
1148200484 17:45746832-45746854 CCACCGTACCCGGCCAGCACAGG - Intergenic
1151491109 17:74432670-74432692 CCCCAGTCCCCAGCCGGCTCGGG - Intronic
1151566551 17:74901648-74901670 CCTCACTCCCCTCCCAGCTCTGG - Intergenic
1151569968 17:74921266-74921288 CCACACTCCCCTCCCCGCCCAGG - Intronic
1151675273 17:75594407-75594429 ACACACTCCCCAGGCAGGGCAGG - Intergenic
1151807111 17:76412628-76412650 GCCCACTCCACTGCCAGCACAGG + Intronic
1151963502 17:77419544-77419566 CCACCATTCCCAGCCAGCCCTGG - Intronic
1152098960 17:78289834-78289856 CCCAACCCCCCAGCCAGGACGGG + Intergenic
1152193414 17:78902393-78902415 CCACCATGCCCAGCCTGCACTGG + Intronic
1152241492 17:79163622-79163644 TCACCCTGCCCACCCAGCACTGG + Intronic
1152298114 17:79480173-79480195 CCACACACCCCAGCCTGTATGGG - Intronic
1152633410 17:81420707-81420729 CCCCACTGCCCAGCCGGCCCAGG - Intronic
1152850298 17:82629972-82629994 CCACCCTACCCACCCACCACTGG + Intronic
1153665009 18:7360646-7360668 CCACACCTCCCCGCCAGCAAAGG - Intergenic
1155541502 18:26873179-26873201 CCACACTCCCAATCAATCACAGG + Intergenic
1157298359 18:46462088-46462110 CCACAGTCCCCAGGGAGCAAAGG - Exonic
1157910063 18:51608705-51608727 CCCCACTCCCCACCATGCACAGG - Intergenic
1158551461 18:58439587-58439609 CCCCACTCCCCAGCCTCCCCAGG - Intergenic
1160403457 18:78628540-78628562 CAAGACTCTCCAGCCAGCCCTGG + Intergenic
1160703523 19:518776-518798 CCCGACCCCCCAGCCAGCCCTGG - Intronic
1160831638 19:1107211-1107233 CCACACCCCCCAGCCAGGTGAGG - Intergenic
1160835589 19:1123137-1123159 CCAAACTGCCCCGCCAGCTCTGG - Intronic
1161084985 19:2330809-2330831 TCACACTCCTCAGCCCGCCCAGG - Intronic
1161699173 19:5785573-5785595 CCGCCCACCCCAGCCAGCCCCGG + Intronic
1161995720 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG + Intergenic
1163475750 19:17525200-17525222 CCCCACTCCCCAGCCAACGCTGG + Intronic
1163638570 19:18449292-18449314 CCACACCCCACAGCCAGACCTGG - Intronic
1164067579 19:21733626-21733648 CCAGATTCCTCAGCCAGCAGGGG - Intronic
1164653789 19:29905523-29905545 CCACAGTGCCCAGCCAGAATAGG - Intergenic
1164718528 19:30413802-30413824 CCACCGTGCCCAGCCAGTACAGG - Intronic
1165894593 19:39133917-39133939 CCACAGTCACCGGTCAGCACTGG + Intronic
1166838738 19:45683357-45683379 CCTCACTCCGCAGCCAGCAGTGG - Exonic
1167120211 19:47512291-47512313 CCCCACTCCCCAGCAAGTCCTGG + Intronic
1167281440 19:48571482-48571504 CCACAGTGCCCAGCCTGCCCAGG + Intronic
1167291878 19:48629159-48629181 CCCCAGTCCCCAGCCAGCTCTGG - Exonic
1167411620 19:49347474-49347496 CCACACAGTCCACCCAGCACTGG + Intronic
1167462183 19:49631315-49631337 CACCACTCCCCATCCAGCAGGGG + Intergenic
1167566404 19:50260137-50260159 CCACAGTGCCCAGCCAGTATTGG - Intronic
1168161540 19:54513400-54513422 CCACAGACCCCAGTCAGCTCAGG + Intergenic
925174140 2:1770617-1770639 CCAGACTCCCCAGCCCCCTCTGG + Intergenic
925363742 2:3296825-3296847 ACACACTGCCCATCCAGCTCTGG + Intronic
926977934 2:18533574-18533596 CCACATGGCCCTGCCAGCACAGG - Intergenic
927137398 2:20106913-20106935 CCACACCTCCCCGCCAGCAGAGG + Intergenic
927898225 2:26799366-26799388 CCACACACCCCACCCAGCCTGGG - Intronic
928203825 2:29269848-29269870 CCATGCTCCCCAGCCTTCACTGG - Intronic
928209311 2:29311940-29311962 CTCCTCTCCCCAGCCAGCATGGG - Intronic
928391009 2:30910919-30910941 CCTCACTCATGAGCCAGCACTGG - Exonic
929300968 2:40303366-40303388 CCACTTTCCCCAGCCAGTGCTGG - Intronic
929906491 2:46050621-46050643 CCTGCCTTCCCAGCCAGCACTGG + Intronic
930058468 2:47269918-47269940 ACACACACTCCAGCCAGCCCTGG + Intergenic
930089820 2:47523645-47523667 CCACAGACCACAGCCAGCACTGG - Intronic
930959266 2:57239056-57239078 CCACCGTGCCCAGCCAGTACTGG + Intergenic
931838642 2:66126589-66126611 CCAAAGTCCCTGGCCAGCACAGG + Intergenic
933415779 2:81985150-81985172 CCACACTTCCCTGCAAGCAGAGG - Intergenic
933531594 2:83518145-83518167 CCACACCTCCCAGCAAGCAGAGG - Intergenic
935408776 2:102736953-102736975 CCAGAACTCCCAGCCAGCACCGG - Intronic
936271068 2:111049456-111049478 CCGCACTCCGCAGGCAGCAGTGG - Intronic
936732424 2:115400176-115400198 CCACACGCCGCCTCCAGCACTGG + Intronic
937124192 2:119462783-119462805 CCACTGTCCCCAGGCAGCACCGG - Intronic
937159612 2:119747586-119747608 CCACCCTCCCCACCCAGCTCTGG - Intergenic
937221295 2:120344525-120344547 CCGCCCTCCCCAACCAGCAGAGG - Intergenic
938315900 2:130327851-130327873 CCACACCTCCCCGCCAGCAGAGG - Intergenic
938776312 2:134544501-134544523 CCACTGTGCCCAGCCAGAACTGG - Intronic
939989734 2:148865981-148866003 GGAAACTCACCAGCCAGCACAGG - Intergenic
940145520 2:150541703-150541725 CCCCCCCCCCCAGCCAGCAGTGG - Intergenic
940284890 2:152024030-152024052 CCACTGTGCCCAGCCAACACTGG - Intronic
941296355 2:163743774-163743796 CCACAGTTCACAGCCATCACAGG + Intergenic
941303381 2:163830545-163830567 CCACTAACCCCAGCCTGCACAGG - Intergenic
944490124 2:200250123-200250145 CCACCGTGCCCAGCCAACACAGG - Intergenic
945042607 2:205754875-205754897 CCAACCTCCCCAGCCTGCAGAGG - Intronic
946389132 2:219404999-219405021 CCCCACTCCCCAGCCAGAAAAGG - Intergenic
947749946 2:232526687-232526709 CCTCCCTCCCAACCCAGCACCGG - Intronic
948231492 2:236352218-236352240 CCAAACTCTCTGGCCAGCACAGG - Intronic
948709830 2:239818757-239818779 CCACACTGCCCATCCAGGGCAGG + Intergenic
949006862 2:241654678-241654700 CCACCCTCTCCAGACAGCCCGGG - Intronic
1168838698 20:894991-895013 CCACACCCGCCCACCAGCACAGG + Intronic
1169023746 20:2349859-2349881 GCACCCTCCCCAGCCAGGGCAGG + Intergenic
1169219535 20:3813757-3813779 CCACTGTGCCCAGCCAGCAGTGG - Intergenic
1169299565 20:4430513-4430535 CCACTGTGCCCAGCCAGCCCAGG - Intergenic
1169308565 20:4516040-4516062 CCTCTCTCTCCAGCCATCACAGG - Intergenic
1169630274 20:7622831-7622853 CCACACCTCCCAGCAAGCAGAGG + Intergenic
1169657453 20:7941282-7941304 CCAAACTCCCCAGCATGGACTGG + Intergenic
1170649458 20:18226740-18226762 CCACACTCCCCTGCAAGCTGAGG - Intergenic
1170725099 20:18919148-18919170 CCAGACTCCACCTCCAGCACTGG - Intergenic
1171948204 20:31397176-31397198 CCCCACTCCCCAACAAGCCCAGG + Intergenic
1172193791 20:33078232-33078254 CCCCACTCCTAGGCCAGCACAGG - Intergenic
1172581972 20:36055554-36055576 CCACCCTCCCCAGCCCGTCCCGG + Intergenic
1174248200 20:49197995-49198017 CCACACTGCCCAGCCATATCTGG + Intergenic
1175486903 20:59353401-59353423 CCACTCTCCCCACCCAGCTGTGG + Intergenic
1175941161 20:62538114-62538136 CCACGCTCCCTAGTCACCACCGG + Intergenic
1176231416 20:64034948-64034970 CCTCAATGCCCACCCAGCACTGG - Intronic
1177281591 21:18988395-18988417 CCACCGTGCCCAGCCAGGACTGG - Intergenic
1178259822 21:31088588-31088610 CCACACCTCCCCGCCAGCAGAGG + Intergenic
1179192771 21:39137333-39137355 CCACACTCCTGAGTCAGCAGAGG + Intergenic
1179216187 21:39368985-39369007 CCACTGTGCCCAGCCAGAACTGG + Intergenic
1179279109 21:39918812-39918834 CCACACTCCCCAAGCTGCAGAGG + Intronic
1179313689 21:40221255-40221277 CCACACTACCCAGCCTGCAGAGG + Intronic
1179988454 21:44933516-44933538 CCAGGCTGCCCAGCCTGCACTGG + Intronic
1179993333 21:44959844-44959866 CCACTCACCCCAGCCTGCCCCGG - Intronic
1180056951 21:45363901-45363923 CCACTCTCCACACCCAGCCCCGG + Intergenic
1180781594 22:18523208-18523230 CCCCAGCCCCCAGCCAGCCCTGG - Intergenic
1180797899 22:18616132-18616154 CCACTGCGCCCAGCCAGCACAGG - Intergenic
1180877830 22:19183262-19183284 CCAGATTCCCCAGCCAGCCCTGG - Intronic
1180979690 22:19872724-19872746 GCACACTGCCCAGCCACCTCAGG + Intergenic
1181022959 22:20113110-20113132 CCACTCACGCAAGCCAGCACGGG + Exonic
1181167474 22:20991450-20991472 CCTCTCACCCCATCCAGCACGGG - Intronic
1181223817 22:21379134-21379156 CCACTGCGCCCAGCCAGCACAGG + Intergenic
1181238478 22:21462551-21462573 CCCCAGCCCCCAGCCAGCCCTGG - Intergenic
1181277009 22:21693714-21693736 CCACCCTCTACAGCCAGCTCTGG - Intronic
1182295434 22:29309235-29309257 CCCCACTCCCCAGGCACCCCTGG + Intronic
1182369728 22:29802263-29802285 CCACAGGCCCCAGACAGCACTGG + Intronic
1183230763 22:36580499-36580521 CCACACTCCATAGCCAGAAGTGG - Intronic
1183422385 22:37719402-37719424 CCACACAGCACAGCCAGCGCTGG - Intronic
1183543108 22:38441258-38441280 CCTCCCTCCCCAGCCAGAAAGGG + Intronic
1183830337 22:40415551-40415573 CCACGCTCACCACCCAGCATCGG + Intronic
1184415394 22:44349218-44349240 CCTCGCTCCCTGGCCAGCACAGG + Intergenic
1184777992 22:46632854-46632876 GCACCCTCCCCAGCAAGCACAGG - Intronic
949125632 3:442873-442895 CTTCTCTCCCCAGCCTGCACTGG - Intergenic
949133644 3:536149-536171 CCACACCTCCCCGCCAGCAGAGG + Intergenic
949641366 3:6038671-6038693 CCACACTCCCCATGCATCAAGGG - Intergenic
950461615 3:13125520-13125542 CCACACTGCACTGCCAGCTCTGG - Intergenic
951601465 3:24380827-24380849 CCACCGTGCCCAGCCAGCAAAGG - Intronic
953556648 3:43951448-43951470 CCAGCCACCCCAGCCTGCACTGG + Intergenic
953927006 3:46987775-46987797 CCACAAGCCCCACCCAGGACAGG + Intronic
954052193 3:47989096-47989118 CCACCATGCCCAGCCAGAACAGG + Intronic
954186017 3:48917758-48917780 CCACAGCGACCAGCCAGCACAGG + Intergenic
954292858 3:49658839-49658861 TCACAGTCCCCATCCATCACTGG - Intronic
954396893 3:50297797-50297819 CCACACTCACCTGATAGCACAGG + Intronic
954744433 3:52779081-52779103 CTGCCCTCCCCAGCCAGGACAGG + Intronic
954902708 3:54033741-54033763 CCACATACCCCAGATAGCACTGG + Intergenic
955159250 3:56448028-56448050 CCACTATGCCCAGCCTGCACCGG + Intronic
955344617 3:58151888-58151910 CCATACTCCCCCACCAGCACTGG + Intronic
956459178 3:69454413-69454435 CCACACCTCCCAGCAAGCAGAGG - Intronic
956662734 3:71615207-71615229 CCACTGAGCCCAGCCAGCACTGG - Intergenic
957270966 3:78029913-78029935 CCACACCTCCCCGCCAGCAGAGG - Intergenic
957970948 3:87381235-87381257 ACACACTCCTGAGACAGCACAGG + Intergenic
958036442 3:88175100-88175122 CTGCACTCCCCAACCAGCCCTGG - Intergenic
960479497 3:118171372-118171394 CCACACCTCCCAGCAAGCAGAGG - Intergenic
961356294 3:126341997-126342019 CCCCAGGCTCCAGCCAGCACAGG + Intergenic
961445331 3:126977989-126978011 CCACACTCACGACCCGGCACAGG + Intergenic
961653611 3:128429534-128429556 TCAGACTGCCCAGCCAGCCCGGG + Intergenic
963533223 3:146497274-146497296 CCACACCTCCCTGCAAGCACAGG - Intergenic
963546147 3:146660970-146660992 CAACACTCCACTGACAGCACTGG + Intergenic
963934944 3:151042794-151042816 CCACCCTCCCCAGCCACAAATGG - Intergenic
964993541 3:162844984-162845006 CCACACCCCCCTGCAAGCAGAGG + Intergenic
965586947 3:170327417-170327439 CCACACCTCCCAGCAAGCAGAGG - Intergenic
968423456 4:504711-504733 ACAGCCACCCCAGCCAGCACTGG - Intronic
968544601 4:1192325-1192347 CAACCCTGGCCAGCCAGCACAGG - Intronic
968606226 4:1536979-1537001 TCACACTCCCCAAACAGCCCAGG + Intergenic
968672315 4:1858148-1858170 TCACCCTCCCTAGCCAGCATCGG - Intergenic
968799519 4:2733048-2733070 CCAGACTCACCATCCAGAACTGG - Intergenic
968832333 4:2939397-2939419 CCACACTCCCAAGCAGGCTCTGG - Intronic
969217654 4:5735054-5735076 CATCACTCACCATCCAGCACAGG + Intronic
969228181 4:5812490-5812512 CCACACACCACAGCCAGGAGAGG + Exonic
971666761 4:29496915-29496937 CCACACTCCCCAAATTGCACTGG - Intergenic
971862916 4:32131319-32131341 CCCCACTCCACACCCAGAACAGG + Intergenic
972550523 4:40128804-40128826 CCACAGCACCCAGCCAGCAATGG + Intronic
972894748 4:43606415-43606437 CCCAACCCCCCAGCCAGCCCTGG - Intergenic
974118956 4:57614674-57614696 CCAGGCTCCTCAGCCAGCACAGG + Intergenic
975176712 4:71297873-71297895 CCACCGTGCCCAGCCAGCATTGG + Intronic
976597029 4:86904293-86904315 TCACACTTCCCCGCGAGCACAGG + Intronic
977219197 4:94319113-94319135 CAACACTTCCCTGTCAGCACTGG - Intronic
977292794 4:95181566-95181588 ACACCCTCCCGAGCCAGCAGGGG + Intronic
978514892 4:109559721-109559743 CCGCACTCGCCAGCGAGCAGGGG + Intergenic
979829312 4:125280925-125280947 CCACACTTCCCCGCAAGCAGAGG - Intergenic
981170272 4:141615485-141615507 CCACACCTCCCAGCAAGCAGAGG - Intergenic
981439626 4:144768479-144768501 CCACAGTGCCCAGCCAGGAAAGG + Intergenic
982188086 4:152823491-152823513 CCACTGTGCCCAGCCAGAACTGG - Intronic
982402703 4:154985747-154985769 CCCCACTCCCCAACAGGCACTGG + Intergenic
983734669 4:171043145-171043167 CCACACTTCCCAGCAAGCTGAGG - Intergenic
984281903 4:177680426-177680448 CCACTGTGTCCAGCCAGCACTGG + Intergenic
984862438 4:184252915-184252937 CCACACCTCCCTGCCAGCAGAGG - Intergenic
984980357 4:185274344-185274366 CCACCATGCCCAGCCAACACTGG + Intronic
985538016 5:475298-475320 CCACACGCCACAGGCAGCACAGG + Intronic
985608306 5:871158-871180 CAGCACTGCCCTGCCAGCACTGG + Intronic
985732539 5:1557366-1557388 CTACACTCCCCTGTCAGCTCAGG + Intergenic
986257154 5:6109933-6109955 AAACACAGCCCAGCCAGCACTGG - Intergenic
986464652 5:8008758-8008780 CCCCAAGCCCCAGGCAGCACGGG - Intergenic
987696557 5:21341371-21341393 CCACACCTCCCCGCCAGCAGAGG - Intergenic
988020562 5:25614940-25614962 CCACACCTCCCAGCAAGCAGAGG + Intergenic
988500088 5:31777078-31777100 CCACACCTCCCAGCAAGCAGAGG - Intronic
988608717 5:32704794-32704816 CTGCACTCCCCAGCCAGGGCAGG + Intronic
988689811 5:33561039-33561061 TCCCACTTTCCAGCCAGCACAGG + Exonic
988755646 5:34245199-34245221 CCACACCTCCCCGCCAGCAGAGG + Intergenic
989255969 5:39366036-39366058 CTACACTCCACAGCAAGCTCAGG - Intronic
990512194 5:56499040-56499062 CCACACCTCCCAGCAAGCAGAGG + Intergenic
991743897 5:69710970-69710992 CCACACCTCCCCGCCAGCAGAGG + Intergenic
991753812 5:69844272-69844294 CCACACCTCCCCGCCAGCAGAGG - Intergenic
991795469 5:70290702-70290724 CCACACCTCCCCGCCAGCAGAGG + Intergenic
991803429 5:70400999-70401021 CCACACCTCCCCGCCAGCAGAGG - Intergenic
991823267 5:70586238-70586260 CCACACCTCCCCGCCAGCAGAGG + Intergenic
991833128 5:70719385-70719407 CCACACCTCCCCGCCAGCAGAGG - Intergenic
991887836 5:71290221-71290243 CCACACCTCCCCGCCAGCAGAGG + Intergenic
993068893 5:83133925-83133947 TCACACTGCCCCGCCAGCAGAGG - Intronic
994623156 5:102187253-102187275 CCCCACCCCCCAGCCAGCCCTGG + Intergenic
995400732 5:111738350-111738372 CCATTCTCCACATCCAGCACTGG - Intronic
995529100 5:113075032-113075054 CCACACTTCCCATCAAGCAGAGG - Intronic
995700323 5:114928811-114928833 CCACACCTCCCAGCAAGCTCTGG - Intergenic
997392899 5:133531469-133531491 CCACACTCCACACTCAGCTCTGG - Intronic
997403245 5:133619106-133619128 CACCTCTCCTCAGCCAGCACTGG - Intergenic
997431522 5:133844310-133844332 CCCCACTCCCAGGCCTGCACAGG + Intergenic
998252407 5:140561933-140561955 CCACCCTCCCCAACCAGGGCTGG + Intronic
998507985 5:142687294-142687316 CCACACTCCCCACAGAGCATGGG + Intronic
999462926 5:151772226-151772248 CCACGCGCCCCAGCCGGGACGGG - Intronic
999657609 5:153826131-153826153 CCACTGTGCCCGGCCAGCACAGG - Intergenic
1002053723 5:176586481-176586503 CCACCATGCCCAGCCAACACTGG + Intronic
1002467762 5:179416304-179416326 CCTCACACCCCAGCCAGCCAGGG + Intergenic
1002661073 5:180791557-180791579 CCACAGTCCCCAGGCTGCATCGG - Exonic
1003011888 6:2434286-2434308 TCACACAGACCAGCCAGCACTGG - Intergenic
1004346660 6:14855486-14855508 TCACTCTCCCCTGCCAACACTGG + Intergenic
1006425243 6:33959385-33959407 CAACACTCCCCAGGCAGTTCTGG + Intergenic
1007162563 6:39803748-39803770 CCCCACCCCACAGCCTGCACAGG - Intronic
1011795475 6:90947633-90947655 AGACACTCCCCAGCCTGCATGGG - Intergenic
1011954220 6:93005216-93005238 CCACACTCCTTGGCCAGCAGAGG + Intergenic
1012598817 6:101070239-101070261 CCACACCTCCCAGCAAGCAGAGG - Intergenic
1012700768 6:102453859-102453881 CAAATTTCCCCAGCCAGCACTGG + Intergenic
1013537567 6:111077345-111077367 CCACCGTGCCCAGCCAGCATTGG - Intergenic
1017105498 6:150884016-150884038 CCACTGTGCCCAGCCAGGACTGG - Intronic
1018371797 6:163175424-163175446 CCACTCCCCCCAGCCTTCACAGG - Intronic
1018510400 6:164518719-164518741 CCATACCCCACATCCAGCACTGG - Intergenic
1018925261 6:168201473-168201495 CAAGACTCCACAGCCAGCAGGGG - Intergenic
1019443222 7:1057785-1057807 CCACACTCCACAGCGCCCACCGG - Exonic
1019593474 7:1847464-1847486 CCACACAACCCAGCCCCCACTGG + Exonic
1019681141 7:2350317-2350339 CCTCTCTCCCCAGCCAGGTCAGG + Intronic
1019970475 7:4536613-4536635 CCACCCCGCCCAGCCAGGACAGG - Intergenic
1020005861 7:4783523-4783545 CCACACTCCCAACCCACCATGGG - Intronic
1020110712 7:5446409-5446431 CCCCACTGCCCCGCCAGCACTGG + Intronic
1020359190 7:7308844-7308866 CCACACTCCACACCCTCCACAGG + Intergenic
1020441912 7:8226249-8226271 CCCCACTCCTCATCCACCACTGG + Intronic
1022112329 7:27239416-27239438 TCACCCTCCCCAGCCTGCAGCGG - Intergenic
1023181764 7:37492067-37492089 CCACACCTCCCGGCCAGCAGAGG - Intergenic
1024691390 7:51806436-51806458 GCAGGCTGCCCAGCCAGCACTGG + Intergenic
1025258332 7:57400096-57400118 CCACACTGCCAGGCCAGCAGGGG - Intergenic
1026561685 7:71455681-71455703 CCACACTCCCCAGCCAGCACGGG + Intronic
1026966363 7:74442590-74442612 CCACAGTGCCCAGCCAGCCCAGG - Intergenic
1027198630 7:76048341-76048363 CCACAGTCTCCAGCCAGTGCCGG - Intronic
1029327736 7:99824158-99824180 GCAGTTTCCCCAGCCAGCACTGG - Intergenic
1029596367 7:101539613-101539635 CCACCACTCCCAGCCAGCACAGG + Intronic
1031221528 7:118972525-118972547 CCACAGTGCCCAGCCAGAAGTGG + Intergenic
1032950273 7:136901125-136901147 CCACACTCCCCGGGCTGTACAGG - Intronic
1032989894 7:137381968-137381990 CCACTCTCCCCACCCATCATTGG - Intronic
1033171982 7:139092555-139092577 CCACACTCCTCAGCTAGGACAGG - Intronic
1033860203 7:145615279-145615301 CCTTCCTCCCCATCCAGCACAGG + Intergenic
1034285197 7:149879488-149879510 CCAGTCTTCCCAGCCAGCCCGGG + Exonic
1034391627 7:150791893-150791915 CCACATTCCCCAGACAGCAAAGG + Intronic
1034478856 7:151304391-151304413 CCCCACGCTCCCGCCAGCACCGG - Intergenic
1034548706 7:151806678-151806700 CCACTGTACCCAGCCAGCTCTGG - Intronic
1034567777 7:151929328-151929350 CCACACCACTCAGCCAGGACTGG + Intergenic
1034991021 7:155548318-155548340 CCACGCTCCCCTGGCAGCCCTGG - Intergenic
1035522320 8:284701-284723 GCACAGGTCCCAGCCAGCACCGG - Intergenic
1036961888 8:13253713-13253735 GCCCACTCTCCAGCCATCACAGG - Intronic
1037238749 8:16752681-16752703 CCACTGTGCCCAGCCAACACAGG + Intergenic
1037458056 8:19083304-19083326 CCACCCTCTCCACCCAGCTCAGG - Intronic
1038545142 8:28420416-28420438 CCACTTCGCCCAGCCAGCACTGG + Intronic
1038770911 8:30478783-30478805 CCACCCTGCCCAGCCAGCACAGG + Intronic
1039272052 8:35892657-35892679 CCACCATGCCCAGCCACCACTGG + Intergenic
1039880601 8:41623147-41623169 CCTCACTGCCCGGCCCGCACAGG - Exonic
1040413966 8:47181228-47181250 CCCAGCTCCCTAGCCAGCACAGG + Intergenic
1041145838 8:54875204-54875226 CCACACCTCCCAGCGAGCAGAGG - Intergenic
1042249276 8:66739681-66739703 CCACAGTACCCAGCCGACACTGG + Intronic
1043621079 8:82192634-82192656 CCACACCTCCCAGCAAGCAGAGG + Intergenic
1044044651 8:87416451-87416473 CCACATTCCCTATCCAGCTCTGG + Intronic
1044894353 8:96874461-96874483 CCACTCTCCCCTGCCAGTCCTGG + Intronic
1045933695 8:107655581-107655603 CCACACCTCCCAGGAAGCACAGG - Intergenic
1046055258 8:109071206-109071228 CCACACCTCCCTGCCAGCAGAGG + Intergenic
1046149226 8:110202176-110202198 GCAGACTGCCCAGCCAGCAGTGG - Intergenic
1046397954 8:113665191-113665213 CCCCACCCCCCAACCAGCCCCGG + Intergenic
1047300669 8:123611224-123611246 CCCCACTCCCCAGCAGGCCCTGG + Intergenic
1048442138 8:134467999-134468021 CCTCACTCCCAACCCTGCACAGG + Intergenic
1049007367 8:139863942-139863964 CCACAGTTCCCAGCCAGGACTGG + Intronic
1049476150 8:142797819-142797841 CCTCTCTCCACAGCCAGCCCCGG - Intergenic
1049549717 8:143251446-143251468 CCACAGTCCCTAGAGAGCACAGG - Intronic
1049758471 8:144321190-144321212 CCACACACCCCAGCCCACAGGGG + Intronic
1050019824 9:1271226-1271248 CCACAGTTCCCACCCAACACTGG + Intergenic
1050136044 9:2465770-2465792 CCACCATGCCCAGCCAGCACAGG + Intergenic
1050476071 9:6042438-6042460 CAACACTCCACTGACAGCACTGG - Intergenic
1052224244 9:26065480-26065502 CCACATTACACAGCCAGCAAAGG + Intergenic
1052967175 9:34348912-34348934 CCACTGTGCCCAGCCAACACTGG - Intergenic
1053269224 9:36738892-36738914 CCTCACTCCACAGCCAGGCCTGG - Intergenic
1053452481 9:38204559-38204581 CCACTCTCCCCACCCACCCCTGG + Intergenic
1055640495 9:78315601-78315623 CCTACCTCCCCAGACAGCACTGG - Intronic
1056627771 9:88267893-88267915 CCCCACTCCTCAGCCAGCCAAGG + Intergenic
1057467967 9:95332833-95332855 CCCCAACCCCCAGCCAGCAGTGG - Intergenic
1057706449 9:97398402-97398424 CCACACTCCCCAAGCCACACTGG + Intergenic
1059656206 9:116360094-116360116 CCAAGCTCTCCAGCCAGCCCTGG + Intronic
1060826812 9:126692352-126692374 CAAGCCTCCCCAGCCACCACTGG - Intronic
1060930432 9:127486371-127486393 CCACAGTGCCCAGTGAGCACAGG - Intronic
1061236786 9:129347840-129347862 CCCCACTTCCCAGCCAGGCCTGG + Intergenic
1061843736 9:133375649-133375671 CCCCACCCTCCAGCCAGCCCGGG - Intronic
1061861863 9:133472439-133472461 CCACACCCCCTACCCAGCGCTGG + Intronic
1062032396 9:134367613-134367635 CCACACTCCCCAGCCGGCGAGGG - Intronic
1062249917 9:135588794-135588816 CCACCCACCCCACCCAGCCCTGG - Intergenic
1062290725 9:135793258-135793280 CCCCATTCCCCAGCCAGGCCAGG + Intergenic
1062323877 9:136003500-136003522 CCAAACACCTCAGCCAGCCCTGG + Intergenic
1186245834 X:7616095-7616117 CCACTGTGCCCAGCCAGCCCTGG - Intergenic
1186820222 X:13280447-13280469 CCACCCTTGCCAGCCAGCAAGGG + Intergenic
1187319245 X:18225872-18225894 CCCCACTCCCCAACAACCACAGG + Intergenic
1189187939 X:39070222-39070244 CCACACCTCCCTGCCAGCAGAGG + Intergenic
1189252088 X:39608935-39608957 CCTCACTCCCCAGCAAACACAGG - Intergenic
1189386921 X:40544771-40544793 ACACACCCCCCAGAAAGCACGGG + Intergenic
1190811007 X:53883396-53883418 CCGCCCTCCCCAACCAGCCCTGG + Intergenic
1190880985 X:54492557-54492579 CCCCACTGCCCAGCCGGCCCAGG - Intronic
1191714539 X:64185305-64185327 CCACACTCCCCTTTCTGCACTGG + Exonic
1192220860 X:69196527-69196549 CCAAATGCCCCAGCCAGCCCTGG + Intergenic
1192292273 X:69810467-69810489 CCACCGTGCCCAGCCAGCCCAGG - Intronic
1193365240 X:80623604-80623626 CCCCACTCCCTAGCCAAAACAGG - Intergenic
1193962212 X:87939932-87939954 CCACACCTCCCTGCCAGCAGAGG + Intergenic
1194158286 X:90419942-90419964 GCACAGTGGCCAGCCAGCACTGG + Intergenic
1194219358 X:91171833-91171855 CCACCATGCCCAGCCATCACTGG + Intergenic
1194227536 X:91279708-91279730 CCACACGCCCCAGCCAGGATGGG + Intergenic
1194676764 X:96803750-96803772 CCACCGCACCCAGCCAGCACAGG - Intronic
1197701786 X:129605232-129605254 CCACCGCGCCCAGCCAGCACTGG - Intergenic
1198868149 X:141147653-141147675 CCACCATGCCCAGCCAGCAATGG - Intergenic
1200504612 Y:3996906-3996928 GCACAGTGGCCAGCCAGCACTGG + Intergenic
1200555870 Y:4635596-4635618 CCACCATGCCCAGCCATCACTGG + Intergenic