ID: 1026573931

View in Genome Browser
Species Human (GRCh38)
Location 7:71556142-71556164
Sequence CTGTAGCCCTTAAATACGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 51}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026573931 Original CRISPR CTGTAGCCCTTAAATACGCA AGG Intronic
903615838 1:24655746-24655768 CTGTGAGCATTAAATACGCATGG + Intronic
905082701 1:35338474-35338496 CTGTAGGCCTTGAATATGCTCGG + Intronic
908132922 1:61094163-61094185 CTCTAACCCTTAAATAACCATGG - Intronic
915988415 1:160489465-160489487 CTTTAGCCCTTCCATAGGCAGGG - Intronic
919790936 1:201290525-201290547 CTGCAGCTCTCAAATACCCAAGG - Intronic
923792383 1:237122910-237122932 TTGTAGCCCTTATATACATAAGG - Intronic
1071366639 10:84907234-84907256 CTGTATCCCATAAATATGTATGG - Intergenic
1073320071 10:102610452-102610474 CTGTAGACCTTATATAGGCGGGG + Intronic
1091870459 12:3885966-3885988 CTAAATCCCTTAACTACGCAGGG + Intergenic
1093951166 12:25165937-25165959 CTGTAGCCCAGGAATAGGCAGGG - Intronic
1111250619 13:85596476-85596498 CTGTAGCCCATAAAAGAGCAAGG - Intergenic
1112898766 13:104334495-104334517 CTGTAGCCATTTATTAAGCAAGG - Intergenic
1113230716 13:108212084-108212106 ATGTAGTCATTAAATACTCAGGG - Intronic
1121888347 14:97565261-97565283 CTGAAGCCCTGAAACAGGCAAGG - Intergenic
1122587757 14:102821733-102821755 GTGTGGCCTTTAAATACTCAGGG + Intronic
1126481237 15:49122786-49122808 CTGTAAGGCTTAAATACTCAAGG - Intronic
1126791585 15:52226501-52226523 CTGGAGCCCTTAAATACTCAGGG - Intronic
1130694408 15:86116060-86116082 CTGTATCACTAAAATAGGCAGGG + Intergenic
1131543244 15:93292371-93292393 TTGTAGACTTTAAATACTCAAGG - Intergenic
1131925627 15:97380405-97380427 CTGCAGCCCTTAAATGCAAAAGG - Intergenic
1135092238 16:19526951-19526973 CTGTTTCCTTTAAATAAGCAAGG - Intronic
1135645333 16:24156729-24156751 CTTTAGGCCTTAAATCCCCATGG - Intronic
1136057194 16:27699148-27699170 GAGTAGCCCTTAAATAGGCAGGG + Intronic
1136530090 16:30862228-30862250 CTGTAGCCCAGAAATAGTCAGGG - Intronic
1139339681 16:66259797-66259819 CTATAGCCCTTAGAGACACATGG - Intergenic
1143044745 17:4068718-4068740 CTGAAGCCCTGGAATACGCCAGG + Intronic
1145407604 17:22619031-22619053 CTGTAGCTCTCAAATACTGATGG + Intergenic
1146267955 17:31465480-31465502 CTGCAGCCCCTCAATACGGATGG + Intronic
1148716183 17:49717745-49717767 CTGCAGGCCTGAAATACTCAGGG - Intronic
925014153 2:509215-509237 CTGTAGCCCTGAAGTTCTCAGGG - Intergenic
940646759 2:156400127-156400149 CTGTAACCCTTACATAAGCAAGG + Intergenic
943325056 2:186487222-186487244 CTGTAGCCCTTTAATGGCCAAGG + Intronic
1173219080 20:41116447-41116469 CTCTAGGCCTTAGATAAGCAAGG - Intronic
1184774009 22:46614387-46614409 CTGTAGCCGTTCATTACGAATGG + Intronic
950293987 3:11812295-11812317 CTGTAGACCTAAAAGATGCAAGG + Intronic
951978097 3:28537002-28537024 CTGAAACCATTAAATACGTAAGG + Intronic
953743589 3:45556783-45556805 CTGCAGCCCCTAGATACTCAGGG + Intronic
979590030 4:122467924-122467946 CTCTAGCCATTAAATCTGCAGGG - Intergenic
994570189 5:101505549-101505571 CTGTAGCCAACAAATGCGCAAGG + Intergenic
997353441 5:133247177-133247199 CAGTAGCCCGCAAATAGGCAGGG - Intronic
1000397328 5:160789672-160789694 CTGTAGCCAATAATTACGCTTGG - Intronic
1007790837 6:44307228-44307250 CTGTAGCCCTTCCAGACTCACGG + Exonic
1026573931 7:71556142-71556164 CTGTAGCCCTTAAATACGCAAGG + Intronic
1031355097 7:120780062-120780084 CTGTAGCCCTGGAATAGTCAGGG + Intergenic
1034746628 7:153529202-153529224 CTGGAGGCTTTAAATACTCAAGG - Intergenic
1036777207 8:11621656-11621678 ATGTAGCCCTTAACTATGTATGG + Intergenic
1037694586 8:21212438-21212460 CTGTAGGCTTTTAATAAGCAAGG - Intergenic
1043717804 8:83508070-83508092 CTGTAGCCCATGAATAGTCAGGG + Intergenic
1044255370 8:90054043-90054065 CTGTACCCCTTAAATGTACAGGG - Intergenic
1051018984 9:12516999-12517021 ATGTAGCCCTGAAAAACACAAGG + Intergenic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1185454279 X:300230-300252 CTGGAGCCCTTACAGACCCAGGG + Exonic
1187573845 X:20533179-20533201 CTGTAGCCTTTTAATTCCCATGG + Intergenic
1196525382 X:116723878-116723900 CTGTAGCCCAGAAATAGTCAGGG + Intergenic
1198089139 X:133310550-133310572 ATGTATCCCTTAAATTCTCAGGG + Intronic