ID: 1026575256

View in Genome Browser
Species Human (GRCh38)
Location 7:71566281-71566303
Sequence CACAAACTCTCCCAAAGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026575256_1026575262 25 Left 1026575256 7:71566281-71566303 CCACCGCTTTGGGAGAGTTTGTG 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1026575262 7:71566329-71566351 CTACCCTGTTTGCCTCTGAGAGG 0: 1
1: 0
2: 0
3: 21
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026575256 Original CRISPR CACAAACTCTCCCAAAGCGG TGG (reversed) Intronic
900571056 1:3358421-3358443 CAGAAAATCTCCCACAGTGGAGG + Intronic
903360182 1:22772148-22772170 TCCAAACTCTCCCAAAGCCCTGG + Intronic
906381486 1:45334788-45334810 CACAAATGCTCCCAAACAGGAGG - Intronic
908267021 1:62389579-62389601 CCCAAAGTCTCCCAAAGTGCTGG + Intergenic
909683597 1:78320662-78320684 AACAAACTCTCCCCAAACAGTGG + Intronic
912569470 1:110610852-110610874 CCCAAAGGCTCCCAAAGGGGAGG + Intronic
918686128 1:187418117-187418139 CACCATCTCTCCCAAAGCCTAGG + Intergenic
1063284330 10:4667410-4667432 CACAAACTCTTCCAAAAAAGTGG - Intergenic
1064006162 10:11700843-11700865 CACATTCTCTCCCAAAGGGCTGG - Intergenic
1064078023 10:12285940-12285962 CCCAAAGTCTCCCAAAGTGCTGG + Intergenic
1067303685 10:45037942-45037964 CAGCAACTCACCCAAAGCAGAGG + Intergenic
1072472510 10:95725633-95725655 CACAACCTCTCCTAAAGTGTAGG - Intronic
1074929747 10:118112268-118112290 CACAGTCTCTCCCACAGGGGCGG - Intergenic
1080611906 11:33911656-33911678 CAGAAACTCCTCCAAAGCAGTGG - Intergenic
1084625043 11:70299903-70299925 AACAAACCCTCCCAAAGCGATGG - Intronic
1088040715 11:105378038-105378060 CAAAAATTCTCCCACAGAGGCGG + Intergenic
1089944152 11:122450411-122450433 CACAAACTATCACAAACTGGAGG - Intergenic
1095833102 12:46608522-46608544 CAGAAACTTTCCCAAAGCTTAGG - Intergenic
1096227376 12:49874835-49874857 CCCAAACTCTACCAACACGGGGG + Intronic
1101331013 12:103758002-103758024 CTCAAACTCTCCCACGGCGCAGG + Intronic
1101734200 12:107450769-107450791 CTCCACCTCTCCCAAAGCAGGGG - Intronic
1103844733 12:123893467-123893489 CACACACTCTGCCAAAGCAGGGG - Intronic
1104165715 12:126227630-126227652 TAGAAACTCTGCCAAAGCGCAGG + Intergenic
1108083376 13:46760263-46760285 CATAAAATCTCCCAAGGCTGTGG - Intergenic
1111538321 13:89633639-89633661 AACAAACTCTCCCAAAACTTAGG - Intergenic
1113897525 13:113775648-113775670 CACGACCTCACCCACAGCGGGGG + Intronic
1114830713 14:26138126-26138148 CACAGACTCTCCCAAATCCTGGG + Intergenic
1119564280 14:75615453-75615475 CACACACTCTCACACAGCAGAGG - Intronic
1120854624 14:89201861-89201883 CACCAACTTTCCCACAGCTGTGG + Intronic
1122670612 14:103369025-103369047 CAAAAACTCTCCTAAAGAAGGGG - Intergenic
1127479354 15:59364323-59364345 CCCAAGCTCACCCAAAGAGGGGG + Intronic
1129516144 15:76158938-76158960 CACAACCTCTCCCGAAGCTCTGG - Intronic
1129547629 15:76414197-76414219 CACAAACTCTCTCAAGGGAGAGG - Intronic
1132197050 15:99922667-99922689 CACAAAATCTTCCAAAGCATAGG - Intergenic
1133710610 16:8397673-8397695 CTCCAACTCTCCCAAATAGGAGG + Intergenic
1136027157 16:27475937-27475959 CACAATCCCTCCCAGAGCTGAGG - Intronic
1137829395 16:51529271-51529293 CACAAACCATCCCAAAGCCAAGG - Intergenic
1144521612 17:15956306-15956328 CCCACACTCTCCCCAAGCTGTGG - Intronic
1149343815 17:55714441-55714463 CCCAAAGTCTCCCAAAGTGCTGG + Intergenic
1151167734 17:72219538-72219560 GACACGCTCTCCCAAAGGGGCGG + Intergenic
1158437538 18:57443817-57443839 CACAAATTGTCCCAAAGGGCAGG + Intronic
1159884905 18:73894588-73894610 CACAAACTAGGCCAAAGGGGAGG + Intergenic
1163772127 19:19197575-19197597 CTCAATCTCTCCAAAGGCGGAGG - Exonic
925010902 2:485501-485523 AACAAAGTCTCCCAAAATGGAGG + Intergenic
925889836 2:8424653-8424675 TACAGACTCTCCCAAAGAGAGGG - Intergenic
935754792 2:106268683-106268705 CTCATACTCTCCCAAAGTGTTGG - Intergenic
938212276 2:129478620-129478642 CACCAACTCCCCCAAAGGTGGGG + Intergenic
940254442 2:151714135-151714157 CTCCAACTCTCCCAAAGCACAGG + Intronic
942138879 2:172956946-172956968 CACAGACTCTTCCAAAGGGTGGG + Intronic
942604084 2:177672114-177672136 CACCAACTCTCCCAGAAGGGAGG + Intronic
942944214 2:181656253-181656275 CAGAAACACTCCCAAAGCTCTGG + Intronic
945926762 2:215813503-215813525 AACATACTCTCCCAAAGATGAGG + Intergenic
947637806 2:231688948-231688970 CACAACCTCACCCACAGCAGAGG + Intergenic
947859852 2:233350971-233350993 CATCAACTCCCCCAAAGCGGTGG - Intergenic
1178258371 21:31075949-31075971 AAAAAAATCTCCCAAAGCTGAGG + Intergenic
1179845170 21:44107164-44107186 CCCAACCCCTCCCAAGGCGGGGG - Intergenic
1180130450 21:45823596-45823618 CACTGACTCACCCAAAGGGGTGG + Intronic
953087198 3:39681116-39681138 CACTAACTCTCCCATAATGGTGG - Intergenic
953122645 3:40060198-40060220 CACAGAGTTTCCCAAAGCAGGGG - Intronic
953564450 3:44019383-44019405 CACAAGCTCCCCCAAAGCTTTGG - Intergenic
954672852 3:52299821-52299843 CACACACTCTCCCTAAGAGGGGG - Intergenic
955060011 3:55486151-55486173 CGCCTGCTCTCCCAAAGCGGAGG + Intronic
955795632 3:62633637-62633659 CACAAAATATCCCCAAGAGGTGG - Intronic
960806015 3:121584698-121584720 GACAAAATCTCAGAAAGCGGAGG + Intronic
964556342 3:157943972-157943994 CACATACTCTGCCAATACGGAGG + Intergenic
964910265 3:161772418-161772440 AACAAACTGTCCCAAAACAGTGG - Intergenic
966111523 3:176408436-176408458 CCCAGACTCTCCCAGAGAGGTGG + Intergenic
970311288 4:14784935-14784957 CACAAAATTTCCCAAAGTGAAGG + Intergenic
970361462 4:15312455-15312477 CAGAAATTCTCCCAGAGCTGGGG - Intergenic
978467266 4:109021791-109021813 GACAGACACTCCCAGAGCGGTGG - Intronic
979924609 4:126545768-126545790 CATATCCTTTCCCAAAGCGGGGG + Intergenic
980913440 4:139013768-139013790 CACCATCTCTCCCAAAGCACAGG + Intergenic
988311057 5:29557234-29557256 CACACACTCTCCCAGAGAAGTGG - Intergenic
990260589 5:54017651-54017673 AACAAACCCTCCCAAAGGGAAGG + Intronic
998901175 5:146856685-146856707 AGCAAACTCTCCCAAAGAGATGG - Intronic
1006321281 6:33321054-33321076 CACATAGTCGCCCAAAGAGGCGG + Exonic
1011601857 6:89067065-89067087 CACCATCTCTCCCAAAGCACGGG + Intergenic
1018873056 6:167797427-167797449 CACGGCCTCTCCCAAGGCGGAGG + Intergenic
1024362080 7:48478782-48478804 CACCATCTCTCCCAAAGCACAGG - Intronic
1025827108 7:65019435-65019457 CTCAAACTCTCCCAAGTAGGTGG - Intergenic
1026194196 7:68158341-68158363 CACCATCTCTCCCAAAGCACAGG + Intergenic
1026575256 7:71566281-71566303 CACAAACTCTCCCAAAGCGGTGG - Intronic
1038238974 8:25790671-25790693 CTCAAACTCTTCCAAAGAGGAGG - Intergenic
1040065284 8:43140241-43140263 GACAAACACTCCCAACGCAGGGG + Intergenic
1042246461 8:66712973-66712995 CACAAACTCTCCGGGAGCCGGGG - Intronic
1049503402 8:142980804-142980826 CACAAACTCTTCTAGAGCCGAGG - Intergenic
1050737409 9:8779719-8779741 CACAAACTCAGCCAAATCGTGGG + Intronic
1052308448 9:27038032-27038054 CACAAATCCTCCCAAAGGTGAGG - Intronic
1053123588 9:35562725-35562747 CACACAATCTCCCAAGGAGGTGG + Intronic
1053474807 9:38375117-38375139 CACAGACTCTCACAAAGAGATGG + Intergenic
1056652179 9:88475285-88475307 CACAAACTCTGCCAAATTTGTGG + Exonic
1185696716 X:2200463-2200485 AAAAACCTGTCCCAAAGCGGTGG + Intergenic
1189560833 X:42189884-42189906 CACAGATTCTACCAAAGCGGTGG - Intergenic
1190690546 X:52909762-52909784 CACAAACTCTCCACAAGGTGGGG - Intergenic
1190695437 X:52946030-52946052 CACAAACTCTCCACAAGGTGGGG + Intronic
1192540785 X:71970288-71970310 CACAAACTCTTCCAAAAACGGGG - Intergenic
1194088785 X:89560890-89560912 CACAGCCTCTCCCAAAGCATGGG + Intergenic
1197487290 X:127068796-127068818 CACAAATTCTCCCTAATCTGTGG - Intergenic
1198069971 X:133138624-133138646 CAAAAACTCTCCAAGAGTGGAGG - Intergenic
1198400396 X:136263030-136263052 CACAAGCTGTCCTGAAGCGGGGG - Intergenic
1200251820 X:154558052-154558074 CACAAACTCTCCCATCCTGGCGG + Intronic
1200265947 X:154646364-154646386 CACAAACTCTCCCATCCTGGCGG - Intergenic
1200441461 Y:3216941-3216963 CACAGCCTCTCCCAAAGCATGGG + Intergenic