ID: 1026580064

View in Genome Browser
Species Human (GRCh38)
Location 7:71608335-71608357
Sequence CTGGCTCCATCCATCTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026580060_1026580064 -1 Left 1026580060 7:71608313-71608335 CCACTTGCCACTCATGCAGTTGC 0: 1
1: 0
2: 1
3: 5
4: 155
Right 1026580064 7:71608335-71608357 CTGGCTCCATCCATCTACCAGGG 0: 1
1: 0
2: 0
3: 6
4: 167
1026580059_1026580064 0 Left 1026580059 7:71608312-71608334 CCCACTTGCCACTCATGCAGTTG 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1026580064 7:71608335-71608357 CTGGCTCCATCCATCTACCAGGG 0: 1
1: 0
2: 0
3: 6
4: 167
1026580058_1026580064 22 Left 1026580058 7:71608290-71608312 CCTGGAGTGATGGATACTGTTTC 0: 1
1: 0
2: 1
3: 7
4: 122
Right 1026580064 7:71608335-71608357 CTGGCTCCATCCATCTACCAGGG 0: 1
1: 0
2: 0
3: 6
4: 167
1026580062_1026580064 -8 Left 1026580062 7:71608320-71608342 CCACTCATGCAGTTGCTGGCTCC 0: 1
1: 0
2: 2
3: 16
4: 190
Right 1026580064 7:71608335-71608357 CTGGCTCCATCCATCTACCAGGG 0: 1
1: 0
2: 0
3: 6
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026580064 Original CRISPR CTGGCTCCATCCATCTACCA GGG Intronic
900836436 1:5008300-5008322 ATTTCTCCATCCATCTACCTAGG - Intergenic
901221452 1:7586149-7586171 CTGGCTGCATCCATCCCTCAGGG + Intronic
901783025 1:11607050-11607072 CTGGCTGCTTTCATCTATCATGG - Intergenic
902219735 1:14957371-14957393 ATGGCTCCATCCACCCAACATGG - Intronic
907159965 1:52362511-52362533 CTGGCTCCGTCCAGCTGCAAGGG + Intronic
908343927 1:63211769-63211791 CTGCTTCCATCCAACTACTATGG + Intergenic
909363445 1:74792216-74792238 TTGTTTCCCTCCATCTACCAAGG - Intergenic
911860763 1:102945292-102945314 CTGTCTTTCTCCATCTACCATGG + Intronic
916391246 1:164333345-164333367 CTGGAGCAATCCATCCACCATGG + Intergenic
917794123 1:178520749-178520771 CTGGCTCCATCCATTTTCTTGGG - Exonic
921187728 1:212684609-212684631 CTGGCCCCATCCAGCTACAAGGG - Intergenic
1062933790 10:1369993-1370015 CTGTCTCCATTGATCTAACAAGG - Intronic
1064721729 10:18235988-18236010 CTTGCTCCAGCCATGTAACATGG + Intronic
1067041561 10:42955804-42955826 CTTGCTCCATCCATGCACCTGGG - Intergenic
1067101579 10:43338422-43338444 CTGTCTCCTTCACTCTACCATGG - Intergenic
1067787370 10:49260329-49260351 CTGGCTCCAACCATCTTCTTTGG + Intergenic
1068619473 10:59164326-59164348 CTGCCTCCATCCACCCACAAGGG + Intergenic
1070799199 10:79235208-79235230 CTGGCTCCCCTCATCTGCCATGG + Intronic
1070908510 10:80096408-80096430 CTGTCCCCATCAAGCTACCACGG - Intergenic
1077311732 11:1891799-1891821 CTGGCACCCTCCATGTACCCAGG + Exonic
1079146736 11:17858888-17858910 ATGGCTGCATCCCTCTATCAGGG - Intronic
1079502545 11:21117887-21117909 CTAGTTCCATCCATCCACAAAGG + Intronic
1079679282 11:23273701-23273723 ATGGCTCCATCCTCCTAGCATGG - Intergenic
1081717450 11:45260528-45260550 CTTGCTCCAGCCTTCCACCATGG + Intronic
1084146370 11:67267138-67267160 CTGGCTCCCGCCTTCTCCCACGG + Intronic
1084211700 11:67627260-67627282 CTGGATCCAGCCATCCTCCACGG + Intergenic
1084949229 11:72655425-72655447 CTTGTACCATCCATCTACCTGGG - Intronic
1089075286 11:115733699-115733721 CTGCCTGCATCCCTCTATCAGGG - Intergenic
1089982717 11:122785682-122785704 CTGGCTCCATCACTTTAGCAAGG + Intronic
1094486253 12:30927881-30927903 CTGGCCCCATCTGTCTCCCAAGG + Intronic
1096638577 12:52976571-52976593 CAGGCTCCATCATTGTACCAAGG - Intergenic
1098299242 12:69037419-69037441 CTTGCTCCATTCATCTTTCAAGG + Intergenic
1098587429 12:72170615-72170637 CTGGCTCCATAGATCTAGGATGG + Intronic
1099135144 12:78888324-78888346 ATGGGTCCATCCATTTACCAGGG - Intronic
1099279750 12:80629087-80629109 CTATCTCCATCCATGCACCAAGG - Intronic
1099309128 12:80995597-80995619 CTTACTGCTTCCATCTACCATGG + Intronic
1104145553 12:126030704-126030726 CTCGCTTCATCCATCGGCCAGGG + Intergenic
1104222149 12:126795455-126795477 GTGGCTGCATGCATCTCCCAGGG - Intergenic
1105995764 13:25670387-25670409 CAGACTCCATCCAGCTCCCAGGG - Intronic
1107960647 13:45555090-45555112 CTGGCACCATCTACCCACCATGG - Intronic
1112400272 13:99071367-99071389 CTCAATCCATCCATCTACCTTGG + Intronic
1112964398 13:105169370-105169392 CTGGGAGCATCCATCAACCATGG - Intergenic
1113739580 13:112701982-112702004 CTGTCTCCATCCATCTCCTCAGG - Intronic
1118983560 14:70734468-70734490 CTGCTTATATCCATCTACCAGGG + Exonic
1119972871 14:78991928-78991950 CTGCCTCCATCAACCCACCAGGG - Intronic
1120310913 14:82827166-82827188 GTGGCTCCATCCAGCAACCTTGG - Intergenic
1121653277 14:95575716-95575738 ATGGCTGCATCCATCTGCCCAGG - Intergenic
1121657711 14:95609959-95609981 TTGGCTCCATCCATCTGGGATGG + Intergenic
1124399954 15:29339220-29339242 CTGGCCCCAGCCCTCTCCCATGG - Intronic
1125730556 15:41890578-41890600 CTGTCTGCCTCCATCTCCCAGGG + Intronic
1127303860 15:57683182-57683204 TTGGCGGCATCCCTCTACCAGGG - Intronic
1127310022 15:57744369-57744391 CTGGTTCCATGCAGCTTCCATGG + Intronic
1132503654 16:296359-296381 CTGGGGCCATCCACCCACCAGGG + Intronic
1135687564 16:24510413-24510435 ATGGGTCCATCCATGAACCATGG + Intergenic
1136250641 16:29002384-29002406 CAGCCTCCTTCCGTCTACCAAGG - Intergenic
1138658979 16:58506884-58506906 ATGCCTCCATCCATCTCCCTGGG + Intronic
1139514598 16:67445760-67445782 CTGCCTCCAACCAGCTACAAAGG + Intronic
1141046113 16:80717455-80717477 CTGTCTCCATCCACCTTCCCTGG - Intronic
1141700824 16:85641249-85641271 CCGGCTCCATCCGGCTCCCAGGG + Intronic
1142504717 17:355486-355508 CTGGATCCAGCCATTGACCATGG - Intronic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1148324282 17:46774108-46774130 CTGGCTGCATCCAGCTTGCAGGG + Intronic
1148484255 17:47980668-47980690 CTGGCTCCAGCCATCCTGCAGGG + Exonic
1148546580 17:48523898-48523920 CTAGCTCCATACACCTATCAGGG + Intergenic
1149392522 17:56206371-56206393 CTGTATACATCCATCTACTAAGG - Intronic
1150755666 17:67910140-67910162 CTGGCTTCATCCACTTAGCATGG + Intronic
1152579521 17:81159905-81159927 CTGGCTCTACCCACCTGCCAGGG - Intronic
1154508628 18:15069396-15069418 CTGACATCATCCTTCTACCAGGG - Intergenic
1156630031 18:38956203-38956225 CTGCCTCCATGGATCTACCTTGG + Intergenic
1157416486 18:47507702-47507724 CTGGCTCCATCCCTCCCTCATGG + Intergenic
1157551394 18:48584094-48584116 CTGGCTGCAGCCTTGTACCAGGG + Intronic
1159715759 18:71820570-71820592 TTGGCTGCAGCCATGTACCAGGG - Intergenic
1161402042 19:4070561-4070583 CTGTCTACATCTATCCACCAAGG - Intergenic
1162369925 19:10272385-10272407 CTGGCTCCATACATTCTCCAAGG - Intronic
1165765786 19:38350165-38350187 CTGGCTACATCCAACTGCAAGGG + Intronic
1168114139 19:54211569-54211591 CTGGTTCCTCCCATCAACCAAGG - Intronic
925125117 2:1448829-1448851 CTGGCTCCATTCATCATCGAGGG - Intronic
928220162 2:29396750-29396772 CTGGCTCCCTGCACATACCAGGG + Intronic
929255558 2:39807776-39807798 TTGGCTGCAGCCAACTACCATGG - Intergenic
930028722 2:47045406-47045428 CTGGCTCCCTCCCTCTACCCTGG - Intronic
933626789 2:84610248-84610270 TTGGCTGCATCAATCTAGCAAGG + Intronic
934702481 2:96453234-96453256 CTGGCTCCAGCCCTCAGCCATGG - Intergenic
940702471 2:157062762-157062784 CTGTCTCCATCAAGCTACCATGG + Intergenic
941066133 2:160905008-160905030 CTGGCTTGAGGCATCTACCAGGG + Intergenic
947366751 2:229404164-229404186 TTACCTCCATCCAACTACCAAGG - Intronic
1170757820 20:19220055-19220077 CTGGACCCATCCATGGACCATGG + Intronic
1173154157 20:40593783-40593805 CTGGATCCATCCATCTAAAGGGG - Intergenic
1173342267 20:42163114-42163136 CTGCCTGCCTCCACCTACCAAGG + Intronic
1173360310 20:42338313-42338335 CTGGCACCATCTCTCTATCAGGG - Intronic
1174376294 20:50128811-50128833 CTGGCTCCAGCCTTATCCCAAGG + Intronic
1174547149 20:51334138-51334160 CTGGCTCCAGGCGTCTCCCAGGG - Intergenic
1176093611 20:63329673-63329695 CTGCCTGCATCTATCTGCCAAGG + Intronic
1176118683 20:63444538-63444560 CTGACTCCATCCCTCCACCCAGG + Intronic
1176789448 21:13302325-13302347 CTGACATCATCCTTCTACCAGGG + Intergenic
1177988608 21:28010516-28010538 CTGACATCATCCTTCTACCAGGG + Intergenic
1178699178 21:34819049-34819071 CTGGGCTCATCCATCTAACAAGG + Intronic
1182086310 22:27563548-27563570 CTGCCTCCATCCCTCTGCCCTGG + Intergenic
1182896866 22:33866143-33866165 TTGGCCACATCCATCCACCATGG - Intronic
1183035390 22:35137229-35137251 CTGGTTCCATCTATCCACCAAGG + Intergenic
1183903103 22:41021159-41021181 CTGGCTCCTGGCATCTTCCAGGG + Intergenic
1184325526 22:43780777-43780799 CAGGTCCCATGCATCTACCAGGG - Intronic
950514187 3:13453463-13453485 CTTGCCCCATCCATCCCCCAGGG - Intergenic
950623925 3:14230533-14230555 CTGCCACCATCTATCTACCTTGG - Intergenic
952395959 3:32921055-32921077 CTGAAGCCATCCATCTACTAGGG + Intergenic
954368154 3:50156838-50156860 CTGGCTCCATCCTCCCCCCAAGG - Intronic
960958090 3:123049086-123049108 CTGGCTACATTCAGCTCCCACGG + Intergenic
961049656 3:123735516-123735538 CTGGCTCCTTCCAGCTTCCCTGG + Intronic
962449218 3:135497926-135497948 CTGGCTCCAGCCCTGCACCAAGG - Intergenic
964158132 3:153611823-153611845 CTGGCTCCAGCCCTCACCCATGG + Intergenic
964508034 3:157421064-157421086 CTGCCTCCTTCCATCTGGCAAGG + Intronic
965408600 3:168301902-168301924 CTGATTCCTTCCAGCTACCAGGG - Intergenic
965550200 3:169956654-169956676 CTTTGTACATCCATCTACCATGG - Intergenic
966918129 3:184595965-184595987 CTGGCTGCATCCTTCCTCCATGG - Intronic
970785141 4:19786843-19786865 CTGTCTCAATACATTTACCATGG + Intergenic
972590031 4:40476905-40476927 CTGGCTCCTTCCAGTTACTAAGG - Intronic
973610322 4:52630212-52630234 CTGGGTCCAGCCTTCTACAAAGG + Intronic
974473326 4:62347082-62347104 CTGGCTCCATCTAACTTACATGG - Intergenic
979785214 4:124709330-124709352 CTGGACCAATCCATTTACCATGG + Intronic
980041725 4:127947758-127947780 CTGGGTTCATCCAAGTACCATGG + Intronic
980441939 4:132859952-132859974 TTGGCTCCCACCATCTATCATGG + Intergenic
981822234 4:148899475-148899497 CTGACTCCATCCTGCCACCAAGG - Intergenic
982998559 4:162382340-162382362 CTCACTCCTTCCATCTGCCATGG - Intergenic
984812553 4:183807666-183807688 CCAGCTCCATCCACCCACCAGGG - Intergenic
985928497 5:3036043-3036065 CTGGCTCCCGCCATCTTCCTGGG - Intergenic
985934405 5:3084234-3084256 ATGGTTCCTTCCCTCTACCAGGG + Intergenic
986591183 5:9372641-9372663 ATGGCTCCATGCATGTGCCATGG - Intronic
988356294 5:30180074-30180096 CAGCCTTCATCCTTCTACCAGGG - Intergenic
991502295 5:67289286-67289308 CTGCCTCCATCCATCTCACTAGG - Intergenic
993534388 5:89064208-89064230 CTGGCTACATTCATTTACTATGG - Intergenic
994042461 5:95274365-95274387 CTGTCTCCTTCCATCTGCAATGG + Intronic
995358426 5:111265969-111265991 ATGGCTCCCACCACCTACCAAGG - Intronic
995742395 5:115368766-115368788 CTGCCTCCTTCCATCATCCATGG - Intergenic
996310609 5:122099659-122099681 CTGGCTCCTTCCTTCTCCCCTGG - Intergenic
997730900 5:136174552-136174574 CTGGCTCAATCTGTCAACCATGG + Exonic
998127461 5:139634244-139634266 ATGGCTCCCTCCTTCTAACAGGG + Intergenic
998127571 5:139634792-139634814 ATGGCTCCCTCCTTCTAACAGGG - Intergenic
999507826 5:152216728-152216750 CTGTCACCATCCATATACCATGG + Intergenic
1001363490 5:171112152-171112174 CTGACTCCATGTATCCACCATGG - Intronic
1002823723 6:753819-753841 CTGGCTCCATCCAGGGACCTTGG + Intergenic
1002894458 6:1368410-1368432 CTCTCTCCATCCATGTGCCAGGG + Intergenic
1004754369 6:18596105-18596127 CTGTCTCCATCCCTCTGCCTGGG + Intergenic
1007179072 6:39915522-39915544 CTGGCTCCACCTGTCTACCTTGG + Intronic
1008677964 6:53841581-53841603 CTGGATACTTCCATCAACCATGG - Intronic
1009356380 6:62752164-62752186 CTGGCTCCATCTAGCTGCAAAGG - Intergenic
1011177795 6:84584779-84584801 CTCACTCCCTCCATCTCCCAGGG + Intergenic
1013709187 6:112877244-112877266 CTCACTCTATCCAGCTACCAGGG - Intergenic
1019416028 7:926831-926853 CTGGCTCCTTCCCTGTCCCAGGG - Intronic
1019642647 7:2112649-2112671 CTGGCTCCATCCAGCACCCCTGG - Intronic
1024042749 7:45567897-45567919 CAGCCTCTAGCCATCTACCATGG + Intergenic
1026580064 7:71608335-71608357 CTGGCTCCATCCATCTACCAGGG + Intronic
1029124750 7:98288219-98288241 CTGGCTCCCTCCAGCTCCCCCGG + Intronic
1030419026 7:109283919-109283941 CCAGCTCCATCCATGTCCCATGG + Intergenic
1030812265 7:113989235-113989257 CTGGCTCCAGTCCTCAACCATGG + Intronic
1031952398 7:127905798-127905820 CTTCCTCCTTCCATCTACCCTGG - Intronic
1032028095 7:128459498-128459520 ATGGCTCCATCCAACCACAAGGG - Intergenic
1040877105 8:52165532-52165554 CATGCTCCATCCATCCCCCAGGG - Intronic
1041952459 8:63518801-63518823 GTGGCTCCATTCATCTAGAATGG - Intergenic
1045941191 8:107740063-107740085 ATGGCTGCATCTATCTACAAAGG + Intergenic
1047413922 8:124648516-124648538 CTGGCTTTATCCCTCTACTAAGG - Intronic
1048550905 8:135432920-135432942 CTGCCTCCCTCCCTCTCCCAAGG - Intergenic
1052076788 9:24152276-24152298 CTGGATCCATCCATTTCTCAGGG + Intergenic
1056309525 9:85324879-85324901 CTGGGTCTAGCCACCTACCAGGG - Intergenic
1059344520 9:113619307-113619329 GTGGCTGCATCCCTCTCCCAGGG - Intergenic
1061440806 9:130602218-130602240 ATGGCTTCAGCCACCTACCAGGG + Intronic
1186640456 X:11449737-11449759 CTTGATGCATCCATCTACTAAGG - Intronic
1186694889 X:12019741-12019763 CAGGCTCTACCCATCTATCAAGG + Intergenic
1188961071 X:36492072-36492094 CTGGCTCCTTTCACATACCATGG + Intergenic
1192238499 X:69311842-69311864 CTGGCACCTCCCATCTCCCAAGG + Intergenic
1192723544 X:73724737-73724759 CTGGATTCATCCATCTTCCTAGG + Intergenic
1197003925 X:121473473-121473495 CTGTCCCCATCAAGCTACCATGG - Intergenic
1197421254 X:126238438-126238460 CTGCCTCCTGCCACCTACCATGG - Intergenic
1198114367 X:133530941-133530963 CTGGCTCAATCCATAGACAAGGG + Intergenic
1201863516 Y:18625215-18625237 GTTGCTTCATCCATCCACCAGGG + Intergenic
1201869806 Y:18695163-18695185 GTTGCTTCATCCATCCACCAGGG - Intergenic