ID: 1026582445

View in Genome Browser
Species Human (GRCh38)
Location 7:71629654-71629676
Sequence TTGGAGAATTGGGAGTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 419}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026582439_1026582445 -1 Left 1026582439 7:71629632-71629654 CCAACTAATTATTTATTTATTTT 0: 2
1: 26
2: 200
3: 2394
4: 21772
Right 1026582445 7:71629654-71629676 TTGGAGAATTGGGAGTTGGGAGG 0: 1
1: 0
2: 3
3: 41
4: 419
1026582438_1026582445 0 Left 1026582438 7:71629631-71629653 CCCAACTAATTATTTATTTATTT 0: 3
1: 52
2: 300
3: 2581
4: 18675
Right 1026582445 7:71629654-71629676 TTGGAGAATTGGGAGTTGGGAGG 0: 1
1: 0
2: 3
3: 41
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026582445 Original CRISPR TTGGAGAATTGGGAGTTGGG AGG Intronic
900865569 1:5266469-5266491 TTGGGGAGCAGGGAGTTGGGGGG - Intergenic
901348171 1:8566264-8566286 TTTTAGAAATGGGAGTTGTGTGG - Intronic
901843216 1:11966428-11966450 GTGGAGGGATGGGAGTTGGGGGG + Intronic
901962919 1:12841426-12841448 TGGGAGAATTGGGGGTTGCAGGG - Intergenic
901990109 1:13105732-13105754 TGGGAGAATTGGGGGTTGCAGGG - Intergenic
902061045 1:13643110-13643132 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
902315884 1:15617889-15617911 GTGAAGAATTGGGGGCTGGGGGG + Intronic
902375051 1:16026635-16026657 TTGGAGAAATGGGAGTGGGGAGG + Intronic
902380022 1:16048442-16048464 TTGGAGAAATGGGAGTGGGGAGG + Intronic
902771028 1:18645767-18645789 CTGCAGACTTGGGAGTTGGAAGG + Intronic
905854861 1:41303105-41303127 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
906438454 1:45818029-45818051 TTGAAGAAGTGGTAGTTGGTTGG + Intronic
906928757 1:50147774-50147796 TGGGAGGATTGGGGGGTGGGAGG + Intronic
908033561 1:60027767-60027789 TAGAAGAATAAGGAGTTGGGGGG + Intronic
908184079 1:61634880-61634902 TTGTAGAAATGGGGGTTGGGGGG - Intergenic
908804288 1:67914132-67914154 TTGGAGATGTGGCATTTGGGAGG + Intergenic
909299387 1:73992480-73992502 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
910256529 1:85253590-85253612 ATGGAGAATTTGGAGAGGGGAGG + Intronic
910671831 1:89781598-89781620 TTGGAGAATTGGTTGGTGGGAGG - Intronic
910687265 1:89930074-89930096 TTCCAGAAATGGGGGTTGGGGGG - Intronic
911722391 1:101205636-101205658 GTAGAGAACTGGGAGTTGTGGGG - Intergenic
912019516 1:105089452-105089474 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
912037410 1:105335735-105335757 TGGGGGAATTGGGAATTGGTAGG + Intergenic
912390168 1:109297393-109297415 TGGGGGAAGTGGGAGATGGGGGG - Intronic
912579718 1:110709111-110709133 TTGGAGAATTTTGAGTAGAGGGG + Intergenic
913250099 1:116906173-116906195 GGGGAGAATTGATAGTTGGGTGG + Intergenic
914810301 1:151022887-151022909 TTGGTGAATTGGGAGGGAGGAGG + Intronic
915088270 1:153403799-153403821 TTGGAGAATTGGTTGGTGTGGGG - Intergenic
915096622 1:153467022-153467044 TTGGAGAATTGGTTGGTGTGGGG + Intergenic
915578314 1:156796464-156796486 GAGGAGTTTTGGGAGTTGGGTGG + Intronic
915947337 1:160163241-160163263 TTGGAGAACTGGTTGTTGGTGGG - Intronic
916125517 1:161566910-161566932 TTGAAGAATTTTGAGTAGGGTGG + Intergenic
916135399 1:161648303-161648325 TTGAAGAATTTTGAGTAGGGTGG + Intronic
916462128 1:165036225-165036247 TTTGAGATTTGGGAGCTGGAAGG + Intergenic
916870545 1:168910012-168910034 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
917610526 1:176684546-176684568 TAGTAGAATGGGGAGTGGGGGGG - Intronic
918348553 1:183629693-183629715 TTAAAGAATTAGGAGTTTGGAGG - Intronic
918490983 1:185081318-185081340 TTGAAGAAGTGGTAGTTGGTTGG + Intronic
919629380 1:199944970-199944992 TTGGAGAATTGGTTGGTGTGGGG + Intergenic
920821655 1:209387284-209387306 GTGGGGAGTTGGGGGTTGGGCGG - Intergenic
921773752 1:219073096-219073118 TTGGAGACTTGGAAGGTGGAAGG - Intergenic
922216743 1:223526227-223526249 TTGTAGAGCTGGGAGTTAGGAGG - Intergenic
922683259 1:227618318-227618340 TGGGGGAATTGGGAGATGAGAGG + Intronic
922811335 1:228416950-228416972 GTGGAGGGTGGGGAGTTGGGGGG + Intergenic
923654287 1:235901757-235901779 TTGGGCAATTGGGAGTTGGTTGG + Intergenic
923757901 1:236810147-236810169 TGTGAGAATTGAGAGTTGTGGGG + Intronic
924600777 1:245487084-245487106 GTGGAGAATTGAGAATGGGGGGG + Intronic
924758514 1:246963741-246963763 TTGGAGAATTGGTCGGTGTGGGG - Intronic
1062832865 10:617566-617588 GTGGAGCAATGGGAGGTGGGTGG - Intronic
1063087498 10:2832865-2832887 TGGGAGAAGTGGGTGTGGGGAGG - Intergenic
1063187251 10:3662741-3662763 TGGGAGGAATGGGATTTGGGGGG + Intergenic
1063895924 10:10681783-10681805 TTGATGAATTAGGAGCTGGGAGG - Intergenic
1064117641 10:12592545-12592567 TCAGAGAATGGGGGGTTGGGTGG - Intronic
1064749548 10:18512808-18512830 TTGAAGAAATGGTAGTTGGTTGG + Intronic
1067267302 10:44757216-44757238 TGGGAGAGATGGGAGTTGAGGGG - Intergenic
1067363963 10:45607995-45608017 TTGCAGACTTGGGGGTTGGGAGG - Intergenic
1068518442 10:58052119-58052141 TTGGAGAATTGGTTGGTGAGGGG + Intergenic
1069723550 10:70563950-70563972 TTGGAGGATTGGGGGTTGGCAGG + Intronic
1069884190 10:71613292-71613314 TTGCATAGTGGGGAGTTGGGGGG - Intronic
1070001436 10:72380895-72380917 TTGAATAACTGGGAGTTGTGAGG + Intronic
1070957158 10:80471739-80471761 TTTGAGAAGTGGGGGTGGGGTGG + Intronic
1070981556 10:80652538-80652560 CTGGAGAATTGGTTGTTGGTGGG - Intergenic
1072667249 10:97402767-97402789 TAGGAGAACTGGGAATTGGCCGG - Intronic
1072912379 10:99514859-99514881 TTGGAGAGCTGGGAGGTGGGTGG - Intergenic
1073294014 10:102427706-102427728 GTGGAGAATAGGTTGTTGGGGGG - Intronic
1073301310 10:102472749-102472771 TCTGAGGATGGGGAGTTGGGGGG + Intronic
1074010839 10:109477822-109477844 TTGGGGAATTGGGAATTGAATGG + Intergenic
1074330613 10:112504255-112504277 TTGGAGATTTGGGAGGAGGTTGG - Intronic
1074434775 10:113424723-113424745 TTGGGGAACAGGGAGTTAGGAGG + Intergenic
1074467262 10:113694487-113694509 TGGGAGAATTGTGAGCTGGAGGG + Intronic
1074714997 10:116210240-116210262 CTGGAGAATGGGGAGAGGGGAGG - Intronic
1075352487 10:121736353-121736375 TTGGAGAATCTGGACTTGGAAGG - Intergenic
1075715462 10:124552704-124552726 TTGGGGAATTTGGAGGTAGGGGG - Intronic
1077750672 11:4964914-4964936 TTGGAGAGTTGGGGGTTGAGAGG + Intronic
1078016785 11:7621743-7621765 TGGGAGTATGGGGAGGTGGGAGG + Intronic
1078018992 11:7639968-7639990 TTGGAGAATGGTGGGGTGGGTGG + Intronic
1078317283 11:10304430-10304452 ATTGAGAATTGGGATTTGGAGGG - Intergenic
1078488358 11:11745243-11745265 TTCAAGAGTTGGGGGTTGGGGGG + Intergenic
1079195140 11:18319655-18319677 TTGAAGAATTGTGTGTTGGGAGG + Intronic
1079854576 11:25586096-25586118 TTGGAGAAGTGGTAGTTGGTTGG + Intergenic
1081343588 11:41956293-41956315 GTGGTGATTAGGGAGTTGGGAGG + Intergenic
1081924756 11:46816085-46816107 TGGAAGAATTGTGTGTTGGGGGG - Intronic
1085060357 11:73440308-73440330 TTGGAGAAGTGTGAGGTGTGGGG - Intronic
1085265552 11:75236002-75236024 TCTGAGAGTTGGGGGTTGGGGGG + Intergenic
1085867336 11:80309890-80309912 TTGGACAATTGGGTGTTGTAGGG + Intergenic
1088820079 11:113449188-113449210 TTGGACAGTTGGGAATGGGGAGG - Intronic
1089648209 11:119894123-119894145 CTGTAAAATGGGGAGTTGGGGGG + Intergenic
1090214478 11:124949384-124949406 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1090446064 11:126765874-126765896 GTAGCAAATTGGGAGTTGGGGGG - Intronic
1090626735 11:128614862-128614884 TTGGGCAGATGGGAGTTGGGAGG + Intergenic
1090823875 11:130369648-130369670 TAGGAGAATGAGGAATTGGGAGG - Intergenic
1091200572 11:133777297-133777319 CTGTAGAATTGGGACTAGGGTGG - Intergenic
1091615673 12:2049777-2049799 TTGGGGATTTGGGAGGTGGTGGG - Intronic
1091683587 12:2544742-2544764 TTGAAGAAGTGGTAGTTGGTTGG + Intronic
1091885414 12:4013611-4013633 TTGGGGAGTTGGGGGTGGGGTGG + Intergenic
1092150106 12:6242103-6242125 TTGGAGAGTAGGGCCTTGGGAGG - Intergenic
1092154311 12:6272574-6272596 CTGGGGAATATGGAGTTGGGTGG - Intergenic
1092883162 12:12903634-12903656 TTGCATGATTGGGAGGTGGGAGG + Intronic
1092954328 12:13535541-13535563 TTGTAAAATGAGGAGTTGGGAGG + Intergenic
1093999998 12:25684644-25684666 TTGAAGAATTGGTAGTTGGTTGG + Intergenic
1094098781 12:26738326-26738348 TTAAAGAATTGGGATGTGGGAGG + Intronic
1095885842 12:47187680-47187702 TTGCAGAGTTGGGAGTTGCCTGG - Intronic
1096495597 12:52037550-52037572 TTGGAAACTGGGGAGTCGGGGGG + Intronic
1096715688 12:53489960-53489982 GTGGAGAATTGGGGTTAGGGAGG - Intronic
1096846200 12:54408384-54408406 GAGGAGAATTGGGAGTAGGGTGG + Intronic
1097008691 12:55937333-55937355 CTGAAGAATTGGGAGTAGCGGGG - Intronic
1097108901 12:56643213-56643235 TTTGTGTATTGGAAGTTGGGGGG + Intronic
1098257727 12:68634489-68634511 CTAGAGAATTGGGAGCAGGGAGG + Intronic
1098600850 12:72330288-72330310 TTTAAGAATTGGGAGGTGGGGGG - Intronic
1099096204 12:78378308-78378330 TTTGGGATTTGGGATTTGGGAGG - Intergenic
1100313488 12:93420367-93420389 ATGGAGACTTGGGAGCTGGAGGG + Intronic
1101705968 12:107221605-107221627 TTGGGGATTTGGGAGGCGGGCGG + Intergenic
1102189616 12:110977230-110977252 TTGGAAAATTGGGTGCTGTGTGG - Intergenic
1103902752 12:124311822-124311844 CGGGGGATTTGGGAGTTGGGAGG - Exonic
1103951601 12:124554463-124554485 TTGGAGAGAGGGGAGTTGAGTGG - Intronic
1104738828 12:131157776-131157798 CTGGAGCATTGGGAGTAGAGGGG - Intergenic
1106598639 13:31168808-31168830 AAGGAGCTTTGGGAGTTGGGAGG - Intergenic
1106749379 13:32744386-32744408 GTGGAGTCTTGGGAGTTGGTAGG + Intronic
1107187641 13:37543399-37543421 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1107242010 13:38247520-38247542 TGGGAGGATTGGGATTTGAGAGG - Intergenic
1107488806 13:40859803-40859825 TTGCCAAATTGGGAGGTGGGAGG + Intergenic
1107759433 13:43661149-43661171 TTGGAGACTTGAGAGTTGCAGGG - Intronic
1108846118 13:54679784-54679806 TCGGAGAATTGGGCACTGGGTGG + Intergenic
1110256076 13:73435328-73435350 TTGGAGAGTGGGGTGTGGGGAGG - Intergenic
1110761808 13:79239029-79239051 GTGGAGATTGGGGAGTTTGGAGG - Intergenic
1110796944 13:79649952-79649974 TTGGAGACTCGGAAGTAGGGAGG - Intergenic
1110864437 13:80378599-80378621 TTGGAGAATTGGTTGGTGTGAGG - Intergenic
1112330058 13:98470290-98470312 TTGTAGAGGTGGGAGTCGGGGGG + Intronic
1113478641 13:110603999-110604021 TTGAAGAAATGGTAGTTGGTTGG + Intergenic
1113519829 13:110932458-110932480 TTGGAGGGCTGGGAGGTGGGAGG - Intergenic
1113557004 13:111244971-111244993 TTGAAGAAATGGTAGTTGGTTGG + Intronic
1113632480 13:111897640-111897662 GTGGTGAATTAGGAGGTGGGTGG + Intergenic
1115030009 14:28784053-28784075 TTGGAGAATAGGGAAAAGGGAGG + Intronic
1115322519 14:32099020-32099042 TTGGAGCAGCTGGAGTTGGGAGG + Intronic
1115454546 14:33586900-33586922 TTGGAGAATATAGAGTTTGGGGG + Intronic
1116289756 14:43018349-43018371 CAGGACAATTGGAAGTTGGGAGG + Intergenic
1116947300 14:50847750-50847772 TTGGAGAATTGGTTGTTGGTGGG - Intergenic
1117006162 14:51423242-51423264 TTGGAGACTTGTGAGATGTGGGG - Intergenic
1117316381 14:54575121-54575143 TTGGGGAGTAGGGGGTTGGGGGG - Intronic
1118297729 14:64585639-64585661 TGGGAGGATTGGGAGGTGGGAGG + Intronic
1119371127 14:74144295-74144317 TTGGAGCCATGGGGGTTGGGAGG + Intronic
1119749625 14:77068163-77068185 TTGGAGAATCTGGAGAAGGGTGG - Intergenic
1120314831 14:82878201-82878223 GTGTAGAATATGGAGTTGGGTGG + Intergenic
1122819723 14:104335365-104335387 GTGGAGACTGGGGAGTGGGGAGG + Intergenic
1123889330 15:24759980-24760002 TTGAAGAAATGGTAGTTGGTTGG + Intergenic
1124615193 15:31236559-31236581 CTGGAGCAGTGGGAGATGGGTGG + Intergenic
1126210607 15:46097478-46097500 TTGGAGAAGGGGGATTTGGCAGG + Intergenic
1126780144 15:52132784-52132806 CTGGAGAGTTTTGAGTTGGGAGG - Intronic
1130803441 15:87292010-87292032 TTGGAGAATTGGCCGCTGGATGG - Intergenic
1131305179 15:91236502-91236524 TTGCAGAGTTGGGAGTGGGCTGG + Intronic
1131329926 15:91487513-91487535 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1131417690 15:92275006-92275028 TTGGAGAATAGGAAGTGGTGTGG - Intergenic
1131583470 15:93668285-93668307 TTGTTGAAATGGGAGATGGGTGG - Intergenic
1132416435 15:101622789-101622811 TTGGGGACTGGGGTGTTGGGTGG - Intronic
1132644684 16:993523-993545 TAGGTGAATGGGCAGTTGGGTGG - Intergenic
1133048525 16:3102846-3102868 TTGTTGATTTGGGATTTGGGAGG + Intergenic
1133101355 16:3482030-3482052 TTGGAGGAGTGAGACTTGGGCGG - Intronic
1133242080 16:4420800-4420822 TAGGAGAAATGGGGGTTGGGGGG - Intronic
1133734463 16:8603542-8603564 TTGGAGACTTGGAAGATTGGAGG - Intergenic
1133800051 16:9077943-9077965 TGGGACAATTTGAAGTTGGGGGG + Intergenic
1134663848 16:16003965-16003987 TTGGTGAGTGGGTAGTTGGGTGG + Intronic
1134863568 16:17583988-17584010 ATGGAGAATTGGGAGATGGAAGG - Intergenic
1135602608 16:23796033-23796055 TAGGAGAATAGAGGGTTGGGGGG + Intergenic
1135722504 16:24829453-24829475 TGGGAGGTTTGGGGGTTGGGGGG + Intergenic
1135935218 16:26774152-26774174 TTGGAGAATTGGGAGGGGAGAGG + Intergenic
1136248551 16:28989177-28989199 TCGGAGCAGTGGGAGTTTGGTGG - Intronic
1137991197 16:53157565-53157587 TTGGAGATTTGGGGGTAGGGCGG + Intronic
1138522172 16:57577436-57577458 TTGGGGAACTGGGAGGTCGGGGG - Intronic
1139068638 16:63351744-63351766 TTTGTGTATTGGGAGTAGGGAGG - Intergenic
1139075124 16:63436779-63436801 TTGGTGCATTGGGAGGTGGGAGG + Intergenic
1139678655 16:68542640-68542662 TTGGTGAATCGGGAGTTGGGAGG + Intronic
1140296945 16:73718073-73718095 TTGGAGAATGGAGAGATGGAGGG - Intergenic
1140341202 16:74165003-74165025 TTTAGAAATTGGGAGTTGGGGGG - Intergenic
1140721944 16:77780066-77780088 TTGGACAATTGGGTGATGGATGG + Intergenic
1140963660 16:79942630-79942652 TTAGAGAAGAGGGAGTTGAGGGG - Intergenic
1144019864 17:11231036-11231058 TTGGAGCTTTGGGTGTTGAGGGG + Intergenic
1144569444 17:16386922-16386944 TTGGGGAATTGGAACTTTGGAGG + Intergenic
1144587264 17:16494744-16494766 ATGGACATTTGGGAGTGGGGTGG - Intergenic
1144844239 17:18207840-18207862 GTGGAGAAGGGGGTGTTGGGAGG + Intronic
1145361704 17:22217429-22217451 TTGGGGAATTGGAACTTTGGAGG + Intergenic
1145726670 17:27133776-27133798 TTGGAGACTGAGGATTTGGGAGG + Intergenic
1146362907 17:32193375-32193397 TTGGATATTTATGAGTTGGGAGG + Intronic
1146564493 17:33900731-33900753 TTGAAGAAGTTGGAGGTGGGAGG + Intronic
1146609137 17:34289111-34289133 CTGGGGCATTGGTAGTTGGGAGG + Intergenic
1146680398 17:34803271-34803293 TTCGAGAAGTTGGACTTGGGTGG - Intergenic
1146718532 17:35106512-35106534 TTGGATAAGAGGGAGTAGGGGGG + Intronic
1146909535 17:36639661-36639683 CTGGAGGATTGGGTGGTGGGTGG + Intergenic
1147431425 17:40373250-40373272 CTGAAGAATTTGGAGTTGGGGGG - Intergenic
1147642394 17:42011596-42011618 GTGAAGAAATGGGAGATGGGAGG - Intronic
1148754143 17:49963874-49963896 TGGGAGTAGTGGGAGTTGGAAGG - Intergenic
1148818386 17:50346499-50346521 CTGGTGGATTGGGAGTCGGGCGG + Intronic
1149034617 17:52120249-52120271 TTGGAGTATTTGGAGTTTGATGG - Intronic
1149490292 17:57079681-57079703 TAAGAGAACTGGGAGTGGGGCGG + Intergenic
1149688884 17:58556627-58556649 TTGAGTTATTGGGAGTTGGGGGG - Intergenic
1150900996 17:69276651-69276673 TTGGAGGGTTGGGACTGGGGAGG + Intronic
1150952315 17:69817246-69817268 TTGGAGAATGGGTAGTTGATGGG + Intergenic
1151121526 17:71798232-71798254 TGGGAGATGTGGGAGTTGAGAGG + Intergenic
1151282815 17:73089298-73089320 TTGGAGAGTCGGGGGTTGGTGGG - Intronic
1151364896 17:73610926-73610948 TCTGAGAACTGGGAGGTGGGGGG - Intronic
1151731747 17:75915351-75915373 TTGGAGACCTGAGGGTTGGGAGG - Intronic
1152109712 17:78351120-78351142 TTGGAGATTTGGGGGAGGGGAGG + Intergenic
1152211129 17:79003952-79003974 TTAGGGAGTAGGGAGTTGGGGGG + Intronic
1154509953 18:15087767-15087789 TTGAAGAAGTGGTAGTTGGCTGG - Intergenic
1155345070 18:24849668-24849690 TTGGAAAATTGGAGGATGGGAGG + Intergenic
1155464989 18:26124280-26124302 TTGGAAGGTTGAGAGTTGGGAGG + Intergenic
1155777994 18:29792714-29792736 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1155953672 18:31939305-31939327 TTGGAGATTAGTGAGTTGTGTGG - Intronic
1156407332 18:36795410-36795432 TTAGAGAATTAGGAGTTTTGAGG - Intronic
1156880199 18:42068600-42068622 TGGGAAAAGTGGGAGGTGGGGGG - Intronic
1157739853 18:50082875-50082897 CTGGAGAATTGGTTCTTGGGTGG - Intronic
1157916738 18:51670871-51670893 ATGGAGAAGTGGGGGTAGGGGGG + Intergenic
1158250560 18:55482813-55482835 GTGGAGTGGTGGGAGTTGGGAGG - Intronic
1160608141 18:80067413-80067435 CTGGAGAAAGGGGAGATGGGAGG + Intronic
1161068218 19:2248459-2248481 TTGGGGGCATGGGAGTTGGGGGG - Exonic
1161475125 19:4480421-4480443 TCTTAGAAGTGGGAGTTGGGAGG + Intronic
1161668469 19:5590892-5590914 GTGGAGAGGTGGGAGGTGGGCGG - Intronic
1161809792 19:6465109-6465131 TGGGTGAACTGGGAGCTGGGAGG + Intronic
1162209725 19:9081789-9081811 TAAGATAATTGGAAGTTGGGAGG - Intergenic
1162582648 19:11540125-11540147 CTGGAGAAATGGGAGTGGAGTGG + Intronic
1164597786 19:29541529-29541551 TTGGAGAATTAATAGATGGGTGG + Intronic
1165919082 19:39281516-39281538 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
1166827945 19:45621111-45621133 GAGGAGAACTGGGAGTGGGGAGG + Intronic
1167397910 19:49243662-49243684 GTGGAGATTTGGGAATTGGTCGG + Intergenic
1167505468 19:49869077-49869099 TTGGGGGATCGGCAGTTGGGAGG - Exonic
1167644874 19:50700179-50700201 TTGGGGCATTGGGAGATTGGAGG + Intronic
1167652813 19:50742339-50742361 TTGGAGAACTGGGAAATTGGGGG - Intergenic
1167799745 19:51732440-51732462 TTGGAGAATTGATTGTTGGTGGG - Intergenic
925554903 2:5120433-5120455 TTGGAGAGGTGGGAGGTTGGGGG + Intergenic
927553630 2:24018183-24018205 TTGGAGAGTTGAGAGAGGGGAGG - Intronic
928946889 2:36779619-36779641 TTGGAGGGTTGGGAGGTGGGAGG - Intronic
929591347 2:43149207-43149229 TTTGACACTTGGGGGTTGGGAGG - Intergenic
931251602 2:60536016-60536038 TTGGAGAGGTTGGGGTTGGGAGG - Intronic
932418351 2:71586941-71586963 TGGGAGCAGTGGGAGTAGGGAGG - Intronic
934080651 2:88464995-88465017 TTGGAGACTTGGCTCTTGGGCGG - Intergenic
935040755 2:99424772-99424794 TTGGTCAATTGGGAATTGGGTGG - Intronic
935440360 2:103087578-103087600 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
935546460 2:104404892-104404914 TTGGAGAAATGAGAGTTAAGGGG + Intergenic
936527497 2:113251442-113251464 CTGGAGGATTGTGAGTGGGGAGG + Intronic
936729418 2:115361916-115361938 TATGAAAATTTGGAGTTGGGGGG - Intronic
937735228 2:125279797-125279819 TTGGAGAATCTGAAATTGGGAGG + Intergenic
938912066 2:135895188-135895210 GTGGAGAATTGGGAGCTTTGAGG - Intergenic
940113728 2:150184348-150184370 TTGGAGAGATGGGGGTGGGGAGG - Intergenic
940407008 2:153316296-153316318 TTGGATAATTGGGATTAGGAGGG - Intergenic
942206024 2:173620597-173620619 CTGGAGAGGTGGGGGTTGGGGGG + Intergenic
943265258 2:185722669-185722691 TTGGAGACTTAGAAGTAGGGAGG - Intergenic
943447800 2:188010677-188010699 CAGGAGAATTGGGCATTGGGTGG - Intergenic
944143296 2:196480049-196480071 TTGGAGAATAGGTATTTTGGGGG - Intronic
944423562 2:199556579-199556601 TTGCAGATTTTGGAGTGGGGAGG + Intergenic
944663522 2:201940388-201940410 CTAGAGAATAGGGGGTTGGGGGG + Intergenic
946097003 2:217283247-217283269 TTGGAGACCAGGGAGTTGGGGGG + Intergenic
946360105 2:219214246-219214268 AAGGAGGATTGAGAGTTGGGGGG - Intronic
947134829 2:226966851-226966873 TGGTAGAAATGGGAGTGGGGTGG + Intronic
947275674 2:228389473-228389495 GTGGAGGATTGGGAATCGGGAGG - Intergenic
947403639 2:229752725-229752747 TTGAAGAATGGGGAGCAGGGTGG + Intergenic
947462336 2:230314255-230314277 TAGAAAAATCGGGAGTTGGGTGG - Intergenic
947471450 2:230404782-230404804 TAGAAAAATCGGGAGTTGGGTGG - Intergenic
947523569 2:230865601-230865623 CTGGGGAATTGGGGGTGGGGGGG + Intronic
947616049 2:231557538-231557560 TTGGAGAATCCGGCGTCGGGCGG - Intergenic
948106691 2:235420151-235420173 CTGGAGAGGTGGGTGTTGGGTGG - Intergenic
948957112 2:241302068-241302090 TTGTAGAGATGGGAGTTGTGGGG - Intronic
1169251451 20:4064248-4064270 TCAGAGAGTTGGGAGTCGGGTGG + Intergenic
1169526083 20:6427334-6427356 TTGAAGAACTGGTAGTTGGTTGG + Intergenic
1169787595 20:9376753-9376775 CTGCAGAATTGGGAGATGGGTGG + Intronic
1169907591 20:10618924-10618946 TTGGGGGCTTGGGGGTTGGGGGG + Intronic
1170570318 20:17628824-17628846 TTGGAAAAATGGAGGTTGGGAGG - Intronic
1170809195 20:19660292-19660314 TTGGAGACTTAGAAGGTGGGGGG - Intronic
1171139471 20:22728700-22728722 TGGGAGATTTGGGAGTCTGGAGG - Intergenic
1171405238 20:24908339-24908361 TTGGAGGGGTGGGAGGTGGGAGG + Intergenic
1172473680 20:35221065-35221087 ATAGAGAAATGGGAGTAGGGAGG - Intergenic
1172748337 20:37231170-37231192 CTGGAAAATTGGGGGTGGGGAGG - Intronic
1172803920 20:37597977-37597999 GTGGAGCATGGGGAGGTGGGTGG + Intergenic
1173003088 20:39119549-39119571 GTGAAGAATTGTGATTTGGGGGG - Intergenic
1173241464 20:41301266-41301288 ATGGAGAATGGGTAGTGGGGAGG - Intronic
1173360754 20:42342423-42342445 TTGGTGTATTGGGGGTTAGGGGG - Intronic
1173459934 20:43234927-43234949 TTGCAGAATAGGGAGCTTGGGGG + Intergenic
1174118026 20:48241329-48241351 TTAGAGAATTGGGTGTGGAGGGG - Intergenic
1175526572 20:59638624-59638646 TTGGAGAATGGGTGGATGGGTGG + Intronic
1175526644 20:59638936-59638958 TTGGAGAATGGGTGGATGGGTGG + Intronic
1175671861 20:60910221-60910243 TTGGAAAATTGAAAGTTGAGAGG - Intergenic
1176300204 21:5095702-5095724 CAGGAGAGTTGGGCGTTGGGAGG - Intergenic
1176788117 21:13284012-13284034 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1177215165 21:18118916-18118938 TTGGAGAACTAGGAGATGGAAGG - Intronic
1177516333 21:22156164-22156186 TTGGAGATTTGGAAGTGTGGAGG - Intergenic
1177987258 21:27992216-27992238 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1178155227 21:29845807-29845829 TTGAAGAATTGGGTGTGGAGGGG + Intronic
1178781714 21:35609580-35609602 ATGTAGAATTAGGAGTTAGGAGG + Intronic
1179856818 21:44166209-44166231 CAGGAGAGTTGGGCGTTGGGAGG + Intergenic
1181905460 22:26191582-26191604 TTGGAGGGTTGGGGGGTGGGAGG + Intronic
1183389095 22:37533867-37533889 ATGGAGAATTCTGAGTTAGGGGG + Intergenic
1183493355 22:38128236-38128258 CTGGAGAAGAGGGAGTCGGGAGG + Intronic
1183751556 22:39723815-39723837 GTGGAGACTTGGGAGGTGGTGGG + Intergenic
1184958236 22:47907630-47907652 TTGGAAATTAGGGTGTTGGGAGG - Intergenic
949459692 3:4277114-4277136 TTGGGGGATTGGGAGTGAGGAGG - Intronic
949539804 3:5023473-5023495 TGGGAGACGTGGGAGTTGGAAGG + Intergenic
950911705 3:16602112-16602134 TTGGGGAGTTGGGGGTGGGGAGG + Intronic
952161158 3:30694797-30694819 TTGGATAATTGTGTGTTGGGAGG + Intergenic
952218830 3:31304144-31304166 TTGGAGAATTGGTTGGTGTGAGG - Intergenic
952985801 3:38781542-38781564 TTGAAGAAGTGGTAGTTGGTTGG - Intronic
953233397 3:41084800-41084822 TTAGGGGACTGGGAGTTGGGGGG - Intergenic
954264042 3:49459685-49459707 TTGGGGGATTGGGAGTAGGGAGG + Intergenic
954454162 3:50588006-50588028 TTGGAGACTGGGGTGCTGGGGGG + Intergenic
954535818 3:51358557-51358579 AGGGAGAAAAGGGAGTTGGGAGG - Intronic
955213376 3:56962633-56962655 TTGGAGGGGTTGGAGTTGGGGGG + Intronic
955771963 3:62394257-62394279 TTGGGGAAATGGGTGTTGGGGGG + Intergenic
956021251 3:64935482-64935504 TTGAAGAAATGAGAGTGGGGAGG + Intergenic
956071281 3:65454650-65454672 TTGTAAATTTGGGAGTTGGCAGG + Intronic
956136495 3:66104386-66104408 ATGGGGAAATGGGAGTGGGGTGG - Intergenic
956655439 3:71546129-71546151 TTGGAGTGTGGGGAGGTGGGTGG - Intronic
957193706 3:77040879-77040901 TTGGGGGATTGGGGGGTGGGGGG - Intronic
958698919 3:97563259-97563281 TTGGAGAATTTGATGTTGGAGGG + Intronic
959717084 3:109444575-109444597 TTGGAGAAACAGGAGTGGGGAGG + Intergenic
961404915 3:126672170-126672192 TTGGAGGCATGGGAGTTGGGGGG + Intergenic
962350989 3:134655599-134655621 TTGGAGCATACAGAGTTGGGTGG - Intronic
962414599 3:135170388-135170410 ATAGAGAATTTGGATTTGGGTGG + Intronic
962580585 3:136794402-136794424 TTGGGGAAGTGGGAGATGGAAGG - Intergenic
962712631 3:138100657-138100679 TTGGAGAATTGGTTGGTGTGAGG + Intronic
962876431 3:139539261-139539283 TTGGAGAATTCGGGGTTGTTAGG - Intronic
963833094 3:150029740-150029762 TTGGAGGACTGGGGGTTGGGGGG + Intronic
965460274 3:168953460-168953482 GTGGAGAATGGAGAGTAGGGAGG + Intergenic
965880105 3:173378809-173378831 TTGGAGACTTGAAGGTTGGGAGG - Intergenic
967913452 3:194560434-194560456 CTGGAGAATGGGCAGGTGGGTGG - Intergenic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
969652142 4:8474198-8474220 TGGGATCATGGGGAGTTGGGGGG + Intronic
969938479 4:10706660-10706682 TTGGAATATTGGGAGTTCTGTGG + Intergenic
970333590 4:15007628-15007650 TTTCAAAATAGGGAGTTGGGTGG + Intronic
970522458 4:16899361-16899383 TTGGAGAAGAGGGAGGTGGCTGG - Intergenic
971023680 4:22566221-22566243 TTGGAGAATTGGTTGGTGTGGGG + Intergenic
971444599 4:26730031-26730053 TTAGAGAACTGAGAGTTTGGAGG + Intronic
972087453 4:35237571-35237593 TTGGGGCATTGGAAGTTAGGTGG - Intergenic
972226840 4:37023268-37023290 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
973078049 4:45955479-45955501 CTGTAGAATTGGGTGTTGGTGGG - Intergenic
973688792 4:53403621-53403643 TTGAAAAAGTGGTAGTTGGGAGG + Intronic
973723656 4:53750731-53750753 TGGGAGTAGTGGGGGTTGGGGGG + Intronic
973936766 4:55854003-55854025 TAGGAGAATGCGGAGCTGGGAGG + Intronic
974089077 4:57291738-57291760 GTTGAGAATGGGGAGTTAGGAGG + Intergenic
974756149 4:66210624-66210646 TGGTATTATTGGGAGTTGGGAGG + Intergenic
974934699 4:68398388-68398410 CTGGGGAACAGGGAGTTGGGAGG + Intergenic
975131709 4:70838806-70838828 TTGGAGATTTAGCTGTTGGGGGG - Intronic
975991545 4:80264312-80264334 TGGGAGGATTGGGGGTTGGGCGG - Intergenic
976418574 4:84810112-84810134 TTGAAGAAATGAGAGTTGGCTGG + Exonic
977991783 4:103451840-103451862 TTGCATAATTGGGTGTTTGGTGG - Intergenic
978933374 4:114345191-114345213 CTAGAAAAGTGGGAGTTGGGTGG - Intergenic
978954903 4:114600265-114600287 TTGGAGTATTTGGAGTAGTGTGG - Intronic
980524073 4:133966793-133966815 TTGGGGACTTGGGGGTAGGGTGG + Intergenic
982537493 4:156625288-156625310 TGGGAGGATGGGGAGTTAGGGGG - Intergenic
983674811 4:170280178-170280200 TTGGAGGACTGGGGGTTGTGGGG - Intergenic
983748948 4:171239067-171239089 TTAGTGAATTGTGATTTGGGGGG + Intergenic
983938911 4:173522100-173522122 TTGGAAAATTTAGAGTGGGGAGG + Intergenic
984428645 4:179620450-179620472 TTGGACAATGGGGACTTGGAAGG + Intergenic
986889830 5:12288938-12288960 TTGAGGATTTGGGAGTTGTGAGG - Intergenic
987330037 5:16848559-16848581 TGGGAGAAGTGGGTGGTGGGGGG - Intronic
988476320 5:31589195-31589217 TTGCAGAATGGGTAGTTGAGGGG + Intergenic
988617387 5:32788149-32788171 TTTAAGAAATGGGAGCTGGGAGG + Exonic
991000449 5:61777509-61777531 TGGGAGGATGGGGTGTTGGGAGG + Intergenic
991343053 5:65633170-65633192 TTGGTTAATTAGTAGTTGGGTGG + Intronic
991624883 5:68590394-68590416 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
993498139 5:88631630-88631652 TTGGAGAATAGAGAGTGAGGCGG - Intergenic
994148753 5:96423821-96423843 ATGGAGAATCAGGATTTGGGGGG - Intronic
994355690 5:98791961-98791983 TTGGAGAATCGAGAGTTGGCTGG + Intronic
994797215 5:104318848-104318870 ATGGTGAAATGGGAGGTGGGGGG - Intergenic
994843951 5:104961369-104961391 TTAGAGAACTGTGGGTTGGGAGG + Intergenic
995920637 5:117306394-117306416 TTGGAAACTTGGGAGTTCTGAGG - Intergenic
996715612 5:126585378-126585400 TAGGAGCAGTGGGAGTTAGGGGG - Intronic
998186735 5:139985863-139985885 GTGGGTCATTGGGAGTTGGGGGG - Intronic
999617268 5:153437551-153437573 TGGGAGAAGTGGGAATTGAGAGG - Intergenic
1001170118 5:169411271-169411293 TTGGAAAGCTGTGAGTTGGGAGG - Intergenic
1001190890 5:169630180-169630202 AGGGGGAATTGGGAGGTGGGGGG + Intergenic
1001373132 5:171227027-171227049 TCAGAGAATAGGGAGTGGGGAGG - Intronic
1001974179 5:175983420-175983442 TTGGAGAATTGATTGTTGGGGGG - Intronic
1002067540 5:176659591-176659613 CTGGAGAGGTGGGAGTGGGGAGG + Intergenic
1002160369 5:177311227-177311249 TTGGAGAGTGGGGAGATGGCAGG + Intronic
1002243255 5:177860359-177860381 TTGGAGAATTGATTGTTGGGGGG + Intergenic
1002326676 5:178414436-178414458 TTGGAGAAGTGGTAAATGGGAGG - Intronic
1002609471 5:180405307-180405329 TTGGGGAATTGTAAGTTGGTGGG - Intergenic
1003425479 6:5995803-5995825 TGGGAGTATTGGGAGTGGGACGG - Intergenic
1003870732 6:10400650-10400672 TTAGGGAGTTGGGAGTGGGGAGG - Intronic
1005076201 6:21910295-21910317 ATCAAGAATTGGGAGTTGGCTGG + Intergenic
1005762920 6:28984473-28984495 TGAGAAAATTGGGATTTGGGGGG - Intergenic
1006136584 6:31899838-31899860 CAGGAGAATTGGGGGGTGGGGGG - Exonic
1007155170 6:39735885-39735907 TGAGAGAATTTGGAGGTGGGAGG - Intergenic
1007636946 6:43305413-43305435 TTGGAGGATGGGGAGTGTGGGGG - Exonic
1007823214 6:44577600-44577622 TTGGAGAGGTGGGAGTTGATGGG - Intergenic
1009970990 6:70625596-70625618 TTGGAGCTTTGGGTGATGGGAGG + Intergenic
1012293174 6:97484276-97484298 TTGGCGACTTGGGAGAAGGGTGG - Intergenic
1012398579 6:98826087-98826109 TTGGAGACCAGGGAGTTGGTGGG - Intergenic
1013428274 6:110034292-110034314 CTGGAGGATTGGGAGTGGTGGGG - Intergenic
1013463877 6:110400304-110400326 TCGGAGTAGTGGGAGCTGGGAGG + Intronic
1013824069 6:114190188-114190210 ATGGAGGAGTGGGAGATGGGGGG + Intronic
1014661361 6:124177331-124177353 ATGGAGAATTGTGACTTTGGAGG + Intronic
1014736592 6:125101350-125101372 ATGGAGAAGTAGGAGTTAGGAGG - Intergenic
1018427326 6:163695141-163695163 TTGGAGAATGGGGTGCGGGGTGG - Intergenic
1019015769 6:168878651-168878673 TTGGGGAATTCTGACTTGGGTGG - Intergenic
1019705573 7:2495776-2495798 TGGGAGAATTGGGATTGGGGTGG - Intergenic
1020892315 7:13894055-13894077 TTGGAAAATGGGTAGCTGGGGGG + Exonic
1022011366 7:26310594-26310616 TTGGTGAGTTGGGGGTGGGGAGG + Intronic
1022266014 7:28755548-28755570 CTGGAGGATTAGGAGTAGGGAGG + Intronic
1022906438 7:34862219-34862241 TTGCGGGAGTGGGAGTTGGGGGG + Intronic
1023263346 7:38380054-38380076 GGGGAGAATTGGAAGTTTGGTGG + Intergenic
1023668610 7:42552767-42552789 TAGGAGGATTGGGAGGAGGGAGG - Intergenic
1024512640 7:50215623-50215645 TTAGAGAATACGGAATTGGGAGG + Intergenic
1026240354 7:68568809-68568831 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
1026582445 7:71629654-71629676 TTGGAGAATTGGGAGTTGGGAGG + Intronic
1026850692 7:73721457-73721479 GTGGAGGAGTGGGAGTGGGGAGG + Intergenic
1027164731 7:75826260-75826282 TTGGAGAAAGGTGAGTGGGGAGG - Intergenic
1027495888 7:78887636-78887658 AAGAAGAAATGGGAGTTGGGTGG - Intronic
1027692645 7:81367764-81367786 TTGGAGGAGTTGGAGGTGGGTGG - Intergenic
1028514125 7:91657532-91657554 TTTGAGGAATGTGAGTTGGGTGG + Intergenic
1029456563 7:100675016-100675038 TGGGGGAAGTGGGAGCTGGGTGG + Intronic
1029632160 7:101759532-101759554 TTGGAGAATTGGTTGATGTGGGG - Intergenic
1030495429 7:110293063-110293085 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1031055256 7:116986272-116986294 GTGGTGAATTGAGAGTTGAGGGG + Intronic
1031649720 7:124273303-124273325 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1032017287 7:128388310-128388332 TAGGAGCAGTGGGAGTTGAGTGG - Intergenic
1036441297 8:8783223-8783245 TTGGAGCTGTGGGAGGTGGGTGG - Intergenic
1036688078 8:10924926-10924948 TCAGAGCATAGGGAGTTGGGGGG - Intronic
1037371402 8:18183463-18183485 TTGCAGAATTAGGAGTTTGTAGG + Intronic
1037943715 8:22973659-22973681 ATGGAGAAATGGGTGATGGGAGG + Intronic
1038852221 8:31290752-31290774 TGGGGGAAAGGGGAGTTGGGGGG - Intergenic
1039596698 8:38796917-38796939 TGGGAAATTTGGGAGCTGGGTGG + Intronic
1041069730 8:54115625-54115647 TTGAAGAAGTGGTAGTTGGTTGG + Intergenic
1041683890 8:60624493-60624515 TTGGAGAATTATCATTTGGGCGG - Intergenic
1041813569 8:61940300-61940322 ACAGAGAATTGGAAGTTGGGGGG - Intergenic
1042435526 8:68760195-68760217 CTGGAGAATTAGGTGATGGGGGG + Intronic
1042716359 8:71777340-71777362 TTGGAGACTTGGAAGGTGGGAGG + Intergenic
1043409560 8:79979201-79979223 CTGGAGAATTAGGACTTTGGAGG + Intronic
1043756298 8:84007867-84007889 TTTCAGAATTGGGTGATGGGGGG + Intergenic
1045211878 8:100107235-100107257 ATGGAGAGGTGGGAGGTGGGGGG + Intronic
1045323161 8:101097196-101097218 TTGGAGAACTGGGAGGTTGAGGG + Intergenic
1045330119 8:101148339-101148361 GTGGAGAATTGGGGGGTGGGGGG - Intergenic
1046816143 8:118585950-118585972 TGGAAGAACTGGAAGTTGGGTGG - Intronic
1046856174 8:119034239-119034261 TTGGAGGATGGGGGGTGGGGAGG + Intronic
1047211168 8:122841532-122841554 TTGGAGGGTCGGGGGTTGGGGGG + Intronic
1047789774 8:128191187-128191209 ATGGAGAATTGTGCGTTGAGTGG + Intergenic
1047882542 8:129212287-129212309 ATGGGGATTTGGGAGTAGGGAGG + Intergenic
1048049673 8:130805537-130805559 TTGGAGAAGTGGGAATAGGGTGG + Intronic
1049100255 8:140574133-140574155 GTGGGGAAGTGGGGGTTGGGGGG - Intronic
1051398894 9:16658293-16658315 CTGGAGAATTTGGAGTCAGGGGG + Intronic
1052125590 9:24770663-24770685 TTGGCTGGTTGGGAGTTGGGGGG + Intergenic
1052886592 9:33655056-33655078 TTGAAGAAGTGGTAGTTGGTTGG - Intergenic
1055734019 9:79308720-79308742 TTTTAGGATTGGGTGTTGGGAGG - Intergenic
1055887950 9:81086920-81086942 CTGAAGAATTGGAGGTTGGGGGG + Intergenic
1056784563 9:89580955-89580977 TTGGTGCATTGGGTGTTGGCTGG + Intergenic
1057045761 9:91885295-91885317 TTGAAGCTTTGGGGGTTGGGGGG + Intronic
1057493913 9:95544722-95544744 TAGGATAAGTGGGAGTTGGATGG - Intergenic
1057792601 9:98134050-98134072 TTGGATAAAAGGGAGGTGGGGGG - Intronic
1057851550 9:98570573-98570595 CAGGAGAATTTGGAGCTGGGTGG - Intronic
1057928284 9:99171488-99171510 ATGGAGAATTGAGAGTGGGTGGG - Intergenic
1058297792 9:103330441-103330463 TTGGAAAATTGGAAATTGGTAGG + Intergenic
1059058435 9:111008937-111008959 TGGGAGAATGGGGAGTGGGGTGG + Intronic
1061316480 9:129799489-129799511 TTGCAGCATCAGGAGTTGGGAGG - Intergenic
1186066908 X:5776185-5776207 TTGGAGGAGTGGGGCTTGGGTGG + Intergenic
1186392295 X:9173092-9173114 TTGGAGAATTGGTTGGTGCGGGG + Intergenic
1189383964 X:40521597-40521619 TTGGGGAGTTGGGAGGTGGGAGG + Intergenic
1190313242 X:49132249-49132271 TTGGAGAGATGGGCGTGGGGGGG - Intergenic
1192320142 X:70084119-70084141 TTGGAGAATAGGGTGTGTGGGGG + Intergenic
1194338174 X:92675486-92675508 GTGGAGAGTTGGGAGTTAGGAGG - Intergenic
1194946506 X:100074663-100074685 TTGGAGAATTGGAAGGGGGAGGG + Intergenic
1195375208 X:104219860-104219882 TTGGTGAAGTGGGAGTGGGTTGG + Intergenic
1196864347 X:120057467-120057489 TGGGAGAAATGAGAGTTGTGAGG + Intergenic
1196878753 X:120178864-120178886 TGGGAGAAATGAGAGTTGTGAGG - Intergenic
1197866838 X:131027972-131027994 TTGAAGAAATAGGAGCTGGGTGG - Intergenic
1199722673 X:150553403-150553425 ATGTAGAATTGGGAGTGGGAGGG - Intergenic
1200646578 Y:5792264-5792286 GTGGAGAGTTGGGAGTTAGGAGG - Intergenic
1201544185 Y:15142606-15142628 TTGGACACTTGGAAGGTGGGAGG - Intergenic