ID: 1026583585

View in Genome Browser
Species Human (GRCh38)
Location 7:71637789-71637811
Sequence GTGAGCAGTGCTAATATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026583583_1026583585 -2 Left 1026583583 7:71637768-71637790 CCATCTGCTCCATCTGGTGAAGT 0: 1
1: 0
2: 1
3: 14
4: 186
Right 1026583585 7:71637789-71637811 GTGAGCAGTGCTAATATTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 93
1026583581_1026583585 11 Left 1026583581 7:71637755-71637777 CCAGCATGTCAGACCATCTGCTC 0: 1
1: 0
2: 0
3: 21
4: 148
Right 1026583585 7:71637789-71637811 GTGAGCAGTGCTAATATTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026583585 Original CRISPR GTGAGCAGTGCTAATATTGC TGG Intronic
900805893 1:4768204-4768226 GTGAGCAGTACTAGTGCTGCAGG + Intronic
902142202 1:14366326-14366348 GTGACCAGTTCAAATCTTGCTGG + Intergenic
902604710 1:17562579-17562601 GAGAGCAGTGCTGAGATTTCAGG + Intronic
906562873 1:46772148-46772170 GTGTGCAGTGATCATATTGTTGG + Intronic
908312439 1:62898621-62898643 GTAAGGTGTGCTAATAATGCAGG - Intergenic
908877554 1:68695208-68695230 GAGAGGAGTGTTAATATTTCGGG + Intergenic
909174085 1:72333421-72333443 GTCAGCAATGTTAATATTCCAGG - Intergenic
911810154 1:102265820-102265842 CAGAGCATTGCTAATAATGCTGG + Intergenic
920448845 1:206041704-206041726 GTGAGGAATGCTATGATTGCAGG + Intronic
922608203 1:226904345-226904367 GTGAGCAGTGCTAAATATGCAGG - Intronic
1064110502 10:12534720-12534742 GGGATCAGTGCGAATGTTGCTGG + Intronic
1064706090 10:18074007-18074029 GTGAGAAGTGTTAAAGTTGCTGG - Intergenic
1065294917 10:24265127-24265149 GTGATGAGTGCTAAGATTACAGG + Intronic
1068634745 10:59336434-59336456 GTGAGCAGTGGTCATAGTGGTGG - Intronic
1069564864 10:69457103-69457125 GTGGGCAGTGCTAAAATTAGAGG - Intronic
1070164735 10:73888998-73889020 GTGAGCTGAGCTAATATCACAGG + Intergenic
1079552511 11:21717116-21717138 GTGAGCAGTTCTAATATGCAGGG + Intergenic
1081229513 11:40567685-40567707 CTTAGCAGTGATAATAATGCTGG + Intronic
1081522510 11:43896739-43896761 GAGATCAGTGGTAATATTGTTGG + Intronic
1084225836 11:67714253-67714275 GTGTGCAGTGCCAAGCTTGCAGG + Intergenic
1084263657 11:67994109-67994131 GTGTGCAGTGCCAAGCTTGCAGG + Intronic
1086292046 11:85322688-85322710 GTGATCAGTGGAAATATTTCTGG - Intronic
1089347769 11:117802067-117802089 ATGAGCAGAGCTAAACTTGCTGG + Intronic
1089820823 11:121224670-121224692 GTGAGTAGTATTAATATTGTAGG + Intergenic
1097066117 12:56321963-56321985 GTAACCAGTGTTAATATTTCTGG - Intronic
1100864222 12:98838980-98839002 GTGAGGATTTCTAAGATTGCAGG - Intronic
1105511057 13:21051992-21052014 GTGTGCAGTGCTAAAGTGGCTGG + Intronic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1108602415 13:52006253-52006275 GTGAGCAGTGTTCATGTTACTGG + Intronic
1111099050 13:83556743-83556765 GTAAGTAGTGCTTATATTCCTGG + Intergenic
1111400988 13:87734752-87734774 ATCAGCAATGCTAATATAGCTGG + Intergenic
1115799427 14:36975924-36975946 GTAAGCAGTGCTACTGTTGCGGG + Intronic
1116678158 14:47932191-47932213 TTGAGAAGTTCTGATATTGCAGG + Intergenic
1124602432 15:31146295-31146317 GAGAGGAGTGCTAATAGTTCTGG + Intronic
1127319785 15:57831789-57831811 CTGAGCACTGCTGATATTGTGGG - Intergenic
1134427316 16:14163082-14163104 GTTAGCAGTAGTAATATTGTTGG - Intronic
1134928145 16:18183081-18183103 GGGAGCAGTGTTGATATTGGAGG - Intergenic
1135764378 16:25164855-25164877 GTCAGGAGTACTAAGATTGCTGG - Intronic
1146951935 17:36912870-36912892 CTGAGAAGTGCTAATCTCGCAGG + Intergenic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1148510362 17:48163690-48163712 ATGAGCAGTGATAGTATTGGTGG + Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1151451638 17:74201605-74201627 GTGCTCAATGCTAACATTGCAGG - Intergenic
1152513453 17:80805889-80805911 GTAAGCAGAGTTAATATTACAGG - Intronic
1155243308 18:23883894-23883916 GTCAGCACTATTAATATTGCAGG - Intronic
1158172600 18:54616398-54616420 GTGATAAGTGCTAGTATTTCGGG + Intergenic
1163690485 19:18735886-18735908 GTGAGCAGTGCCCATCTGGCTGG + Intronic
1167723203 19:51193007-51193029 GTTTACAGTGCTAATTTTGCTGG + Intergenic
925658387 2:6175449-6175471 GTGAGCAGTAATCATTTTGCTGG - Intergenic
930920754 2:56750744-56750766 GTCAGCAATGGTAATCTTGCTGG - Intergenic
932776497 2:74531014-74531036 CTGAGCAGAGCTAACAATGCCGG - Exonic
934489658 2:94752616-94752638 GTGAGCAGAGCTTATAGTCCTGG + Intergenic
936684357 2:114810604-114810626 GTTGGAAGTACTAATATTGCTGG - Intronic
948628232 2:239283918-239283940 GAGAGCAGTTCCAACATTGCTGG + Intronic
1170491742 20:16884073-16884095 TTGAGCATTTCTCATATTGCTGG + Intergenic
1181117881 22:20644974-20644996 TTGAGAAGTGCTAATGTTACCGG - Intergenic
1181735429 22:24877766-24877788 TTGAGAAGTGCTAATATTACTGG + Intronic
1183010406 22:34941738-34941760 GTGACCAGTGCTAAAATTGAGGG + Intergenic
952172480 3:30823304-30823326 GTGAGAAGTGATAATACTCCAGG - Intronic
962898048 3:139733731-139733753 GTGAGCAGTGGTGAAATGGCTGG + Intergenic
966277251 3:178188644-178188666 GGGAGCAGTGATAATATTCAGGG + Intergenic
969022175 4:4146016-4146038 GTGTGCAGTGCCAAGCTTGCAGG + Intergenic
969791288 4:9495483-9495505 GTGTGCAGTGCCAAGCTTGCAGG - Intergenic
970625654 4:17876266-17876288 GTGACTATTGATAATATTGCCGG + Intronic
978421628 4:108539397-108539419 GTGATCAGTTTTAACATTGCTGG - Intergenic
983848371 4:172547188-172547210 GTGAGCAGTGGTTAGAATGCAGG + Intronic
984234462 4:177138873-177138895 TTGAGCAGTTCTTATAGTGCTGG - Intergenic
984416192 4:179461003-179461025 GGCAGCAGGGCTAATATTCCAGG - Intergenic
994087035 5:95770433-95770455 GTGACCACTGCTAAGAATGCAGG + Intronic
996087818 5:119322265-119322287 GTGAGCACTGCTGATGGTGCTGG - Intronic
998601078 5:143585699-143585721 ATGAGAAATGCTAAGATTGCTGG + Intergenic
999172764 5:149609258-149609280 GTGAGCATTATTAATATTCCTGG + Intronic
1000158886 5:158580329-158580351 TTGAGCAGTTCTTATAGTGCTGG + Intergenic
1003527350 6:6909439-6909461 ATGAGCAGTCCCAACATTGCAGG + Intergenic
1004548966 6:16628033-16628055 ATCATTAGTGCTAATATTGCAGG - Intronic
1014540379 6:122668728-122668750 GTGAGATGTGCTAATATTCCTGG - Intronic
1017121272 6:151026327-151026349 GTGACCAGTGGTTATATTGGTGG - Intronic
1017272654 6:152526681-152526703 GTCAGCAGAGCTAAGGTTGCAGG + Intronic
1017784300 6:157742088-157742110 GTTAGCAGTGCTATTACTGCTGG - Intronic
1018545301 6:164929187-164929209 GTGTGCAGTCCTAGTCTTGCTGG - Intergenic
1018884902 6:167927017-167927039 GAGAGTTGTGCTAATATAGCTGG - Intronic
1020309597 7:6858058-6858080 GTGTGCAGTGCCAAGCTTGCAGG + Intergenic
1024201048 7:47106046-47106068 GTGAGCAGTGCTCACACAGCTGG + Intergenic
1026583585 7:71637789-71637811 GTGAGCAGTGCTAATATTGCTGG + Intronic
1027691538 7:81353038-81353060 TTTAGCAGTGCTTATAGTGCTGG + Intergenic
1030662316 7:112233600-112233622 AAGAGCACTGCCAATATTGCTGG - Intronic
1042768257 8:72351165-72351187 CTTAGCAGTGCTCATAGTGCTGG + Intergenic
1046236469 8:111429686-111429708 GTTAGTATTGCTAATATTACTGG - Intergenic
1046721972 8:117630576-117630598 TTGAGCACAGCTGATATTGCAGG + Intergenic
1046727919 8:117694622-117694644 GTGAGGAGAGCTAAGATTTCTGG + Intergenic
1053587131 9:39470820-39470842 GTGAGTAGTGCTACTATGGATGG - Intergenic
1054579176 9:66894413-66894435 GTGAGTAGTGCTACTATGGATGG + Intronic
1055611152 9:78026177-78026199 CTGAACAGTGAAAATATTGCAGG - Intronic
1061496416 9:130977421-130977443 ATGAGCTGGGCTAAAATTGCAGG + Intergenic
1186579204 X:10799159-10799181 GCCACCAGTGCTAATATTACTGG + Intronic
1188019694 X:25143796-25143818 CTGTGCAGTGCTAATAGTTCTGG + Intergenic
1189588888 X:42490917-42490939 GTGAGAAGTGATAATATTGGTGG + Intergenic
1189880624 X:45487742-45487764 GTGAGAAGTACAAAAATTGCGGG + Intergenic
1190401742 X:50043432-50043454 GTCAGCACTGCTAAGATTGTGGG - Intronic
1193618099 X:83714984-83715006 GTGAGCAGTACAACTATTGTGGG - Intergenic
1198087027 X:133291595-133291617 GTGATCAATGCCTATATTGCAGG - Intergenic