ID: 1026583720

View in Genome Browser
Species Human (GRCh38)
Location 7:71638718-71638740
Sequence TGCCATCCAAAGAGTAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026583720 Original CRISPR TGCCATCCAAAGAGTAGGTG AGG Intronic
904610052 1:31720914-31720936 GGCCATACATAGAGCAGGTGTGG - Intergenic
904840014 1:33366589-33366611 TGCCCTCCACAGTGTAGCTGGGG - Intronic
906908814 1:49924766-49924788 TGCCCTCAAAATAGTAGGGGAGG + Intronic
907386460 1:54128807-54128829 TGCCACCCAATGAGTATCTGTGG - Intergenic
907947587 1:59149601-59149623 AGCCATACAAATAGTAGGTGAGG - Intergenic
908792192 1:67793967-67793989 TGCCATCCAAAACGGAGGAGGGG + Intronic
910240963 1:85085659-85085681 AGCCCTCCAAAGAGGAGGAGCGG + Intronic
911196790 1:95002740-95002762 TGCCAGCCAAACAGTGGGAGTGG - Intronic
911360879 1:96873997-96874019 TCCCATGAAAAGGGTAGGTGTGG - Intergenic
916549223 1:165833328-165833350 TGCCATGCCAAGAGTGGGTCTGG - Intronic
917160335 1:172050182-172050204 TGCATTCTGAAGAGTAGGTGAGG - Intronic
918536638 1:185582178-185582200 TGGAATCCAAAGAGGATGTGAGG + Intergenic
924655775 1:245974252-245974274 TCCCATCTAAGGAGTAGGTTTGG - Intronic
1063167820 10:3479814-3479836 TGCCATCAAAAGACCAGCTGAGG + Intergenic
1065923667 10:30416522-30416544 TTAAATACAAAGAGTAGGTGTGG - Intergenic
1068367903 10:56076416-56076438 TCCCATGGAAAGGGTAGGTGGGG + Intergenic
1070972832 10:80581647-80581669 TGCAATCCAAAGTCAAGGTGTGG - Intronic
1074969112 10:118521129-118521151 TTCCTTCCAGAGAGTAGGGGTGG + Intergenic
1077195916 11:1279922-1279944 AGACATCCAAAGAGCAGGTGGGG + Intronic
1083756359 11:64793701-64793723 TCCCATCCAAAGACCAGATGGGG - Intronic
1085807197 11:79647364-79647386 TGCCCTCCAGAGAGTAGGGATGG + Intergenic
1088361052 11:108990412-108990434 TGCCCTCCACAGTGTGGGTGGGG + Intergenic
1088649133 11:111941971-111941993 TGCCCTCCATAGAGTAGCGGTGG + Intronic
1090295427 11:125583690-125583712 TGCCATCCAAAGGGGATGGGCGG + Exonic
1090982615 11:131736744-131736766 TGCCACCCTAAGAGAAGCTGCGG - Intronic
1091148496 11:133302558-133302580 TGGCATTCAAAGGGCAGGTGGGG + Intronic
1091497995 12:989330-989352 TGACATGCAAAAAGTAAGTGTGG - Intronic
1092229475 12:6768629-6768651 TGCCTGCCAAGGAGTGGGTGGGG + Intronic
1092246852 12:6868493-6868515 TGCCTTGCAAAGGGGAGGTGAGG + Intronic
1092784782 12:12017304-12017326 TGCCATCCAAAGATAAGGAAGGG + Intergenic
1092854655 12:12661788-12661810 TGCCTTCCCAAGAGGAGGGGAGG + Exonic
1093040363 12:14372187-14372209 TGCCATCCACAGAGTAAATCAGG + Intronic
1094523080 12:31213702-31213724 TACCATCTAAAGAATAGATGTGG - Intergenic
1096536140 12:52276020-52276042 TCTAATCCAAAGGGTAGGTGGGG - Intronic
1096637436 12:52969731-52969753 TGTAATCCAAAGGCTAGGTGAGG - Intergenic
1102180041 12:110905430-110905452 TGCTCTCCAAAAAGCAGGTGAGG - Intronic
1106586098 13:31057453-31057475 TGCCATTCACAGAGTCGGTGGGG - Intergenic
1110059845 13:71027411-71027433 TGGAATCCAAAGAGGATGTGAGG + Intergenic
1113037059 13:106062059-106062081 TGCCCTCCAAGGTGGAGGTGGGG + Intergenic
1116295285 14:43099983-43100005 TCCCATGAAAAGAGTAGGTTGGG + Intergenic
1117549644 14:56821429-56821451 TGCCATCCAAAGAACAGTGGTGG + Intergenic
1117869701 14:60187160-60187182 TGCCAGCCAAGGAGCAGGTGGGG + Intergenic
1121341760 14:93109625-93109647 CCCCATCCATAAAGTAGGTGGGG + Intronic
1121523503 14:94602389-94602411 GGCCTTCCACAGAGAAGGTGGGG + Intronic
1121613037 14:95294136-95294158 TGCCTGCCAAAGAATGGGTGGGG + Intronic
1122082015 14:99273137-99273159 TGCCAGCCCAGGAGTAGGTGTGG + Intergenic
1122175581 14:99915992-99916014 TGCCACTCAGAGAGCAGGTGTGG + Intronic
1122328233 14:100895553-100895575 TGGAATCCAAAGGGAAGGTGTGG + Intergenic
1123951982 15:25288004-25288026 AGCCAGCCAAAGAGTGGGTGAGG - Intergenic
1132341569 15:101081443-101081465 TCCCATCCAAAAAGAAGGTGGGG + Intergenic
1132903927 16:2272511-2272533 TGCCATGCACAAGGTAGGTGTGG - Intergenic
1135616871 16:23918265-23918287 TGTCCTTCACAGAGTAGGTGAGG + Intronic
1139659365 16:68410317-68410339 TGCCATCCACAGACCAGGGGTGG + Intronic
1141207015 16:81940397-81940419 TGCCAGCCAGAGAGCAGGAGGGG - Intronic
1148370500 17:47096222-47096244 TGCCATACAAAGCGTAGATATGG + Intergenic
1150141410 17:62732690-62732712 TGCAATCCAAAAAGAAGATGGGG + Intronic
1150204144 17:63388485-63388507 TGCCAAGCAAAGCCTAGGTGGGG - Intronic
1150291698 17:63985990-63986012 GGCTCTCCAAAGAGTAGCTGGGG - Intergenic
1152239722 17:79155014-79155036 AGGCATCCAAAGGGTGGGTGGGG + Intronic
1157425130 18:47578207-47578229 TGGCATCCGAAGAGGAGCTGGGG - Intergenic
1160716588 19:579546-579568 TGTCATTCAAGGAGCAGGTGAGG - Exonic
1162301208 19:9846206-9846228 TGCCATCCCAACAGAAGCTGGGG + Intronic
1165680563 19:37770880-37770902 TCCCTTCCAAAGAGTGGCTGGGG + Intronic
927460099 2:23291527-23291549 TGCCTTCCAAAGACTGGCTGTGG - Intergenic
927887389 2:26727072-26727094 TGCCAGCCAAAGCTTATGTGGGG - Intronic
929050723 2:37834490-37834512 TGCCATCAAAACAGAAGATGAGG - Intergenic
929662401 2:43800375-43800397 TGCCTTCCAAAGAGTCACTGTGG - Intronic
931940167 2:67243273-67243295 TGCCATCCAAAGGATTGCTGAGG - Intergenic
935458516 2:103299833-103299855 TGTCATCAAAAGAGGAGCTGGGG - Intergenic
1169572887 20:6925811-6925833 TCCCATCCTAAGAGTAGAAGAGG - Intergenic
1169622843 20:7527312-7527334 TGGCTTCCAAAGAGTAGGCTTGG - Intergenic
1170974692 20:21150955-21150977 TGCCTTCCAAGGAGCTGGTGGGG + Intronic
1174747188 20:53075055-53075077 TGTCATCCAAAGCATAGTTGAGG + Intronic
1175380851 20:58562891-58562913 TCCCATCCACAATGTAGGTGAGG - Intergenic
1183109055 22:35635342-35635364 TGCCTTGCACACAGTAGGTGTGG - Intronic
1183694687 22:39415074-39415096 TGCCATCAGCAGAGTAGCTGCGG - Exonic
949976959 3:9469724-9469746 TGATAACCAAATAGTAGGTGGGG + Intronic
952554879 3:34520733-34520755 AGCCATCCAAAGGGAAGGAGAGG - Intergenic
954795117 3:53157385-53157407 TGCCAGGCAGAGAGTTGGTGAGG - Intronic
954980757 3:54743349-54743371 AGCCATGCAAACAGGAGGTGAGG + Intronic
955126909 3:56121920-56121942 TGGGATCCATAGAGTTGGTGTGG - Intronic
957803294 3:85114331-85114353 AGGCATCCTCAGAGTAGGTGTGG + Intronic
961837089 3:129671171-129671193 TTCCATCCACAGAGTCTGTGTGG + Exonic
962446101 3:135467276-135467298 TGACTTCCAAAGAGAAGATGCGG + Intergenic
965293490 3:166914161-166914183 GGACATCCAAATAGTAGGAGAGG - Intergenic
965326163 3:167307300-167307322 GGGCATCCAAATAGTAGGAGAGG + Intronic
965692972 3:171377295-171377317 TGCAAACCAAACAGGAGGTGAGG - Intronic
967213328 3:187188247-187188269 TGCCCTCCTCAGTGTAGGTGGGG + Intergenic
970183990 4:13430413-13430435 TCCCATGGAAAGGGTAGGTGGGG + Intronic
971787375 4:31122221-31122243 TGGCTTCCAAAGAGCACGTGGGG - Intronic
978777950 4:112521326-112521348 TGCCTTCCCCAGAGCAGGTGGGG - Intergenic
985936671 5:3102755-3102777 TGCTTTCCACAGAGGAGGTGGGG + Intergenic
988847371 5:35141811-35141833 TGGCATCCAATGAGGAGTTGGGG - Intronic
990004710 5:50932924-50932946 TGCTATTCACAGAGCAGGTGCGG - Intergenic
990528811 5:56654014-56654036 TGCCATCCACAGGGTGGCTGTGG + Intergenic
992539031 5:77743622-77743644 TGCCAGCCAGAGACTGGGTGCGG - Intronic
993774669 5:91976702-91976724 CACCTTCCAAAGAGGAGGTGTGG + Intergenic
993785813 5:92134110-92134132 GGCCATCCAAACAGTAAGAGAGG - Intergenic
995329241 5:110928582-110928604 TGCCACTCAAAGGGTAGATGTGG - Intergenic
995832625 5:116370769-116370791 TACATTCCAAAGAGAAGGTGAGG - Intronic
996166766 5:120233373-120233395 GGCCATCCAAATAGGAGGAGAGG - Intergenic
998229256 5:140349251-140349273 TGACATCCAGAGAGCAGGTGGGG - Intergenic
1000149112 5:158482204-158482226 TGTCATCCAAAGGAGAGGTGTGG - Intergenic
1001652847 5:173327916-173327938 TGCCATCCCAAGAGTTTGCGTGG + Intronic
1005361193 6:25032532-25032554 TCCCCTTCAAAGAGTATGTGAGG + Intronic
1005384746 6:25274935-25274957 TGCCAGCCACATAGTAGGTGAGG - Intergenic
1008304758 6:49887697-49887719 TGGAATCCAAAGAGTACCTGAGG + Intergenic
1011010339 6:82696299-82696321 TTCCATCCAAGGAGTAGGGATGG - Intergenic
1015314533 6:131803660-131803682 TACCATCCAAAGAGAGTGTGGGG - Intergenic
1015548285 6:134385240-134385262 TGCCAAGCACAGACTAGGTGAGG + Intergenic
1021914894 7:25421684-25421706 AGCCATCCAAGCAGTAGGAGGGG + Intergenic
1026583720 7:71638718-71638740 TGCCATCCAAAGAGTAGGTGAGG + Intronic
1030399086 7:109026258-109026280 TGCCATCCATAGCATAAGTGGGG + Intergenic
1032783964 7:135186189-135186211 TGCCATCCATGGAGGCGGTGAGG + Exonic
1032857181 7:135844721-135844743 GGCCATGCAAAGAGGTGGTGAGG + Intergenic
1034832874 7:154324794-154324816 TCCCATCCTAAGAGTTTGTGAGG - Intronic
1036102199 8:5799628-5799650 TGGAATCCAAAGAGGACGTGAGG + Intergenic
1036750763 8:11442620-11442642 AGCCATTCAAAGAGCAGCTGGGG + Intronic
1039438092 8:37574942-37574964 AGCTAACCAAAGAGTTGGTGAGG + Intergenic
1044555375 8:93557049-93557071 TGCCATCTAGAGAATGGGTGTGG + Intergenic
1051741012 9:20252216-20252238 TTCCATCCAAAGGGTATGTCTGG + Intergenic
1059992062 9:119874878-119874900 TGCCATCCAGGGAGCAGGGGTGG + Intergenic
1060092008 9:120751450-120751472 GGGCATCCAAATAGTAGATGGGG - Intergenic
1060749478 9:126159594-126159616 TACCATCCAAAGAGAAGGATTGG - Intergenic
1185552055 X:990328-990350 TGACATCCATAGAGTGCGTGGGG - Intergenic
1186800789 X:13090522-13090544 TGGCTTCCAAAGGGTAGTTGGGG + Intergenic
1188094849 X:26008623-26008645 TTCCTTCCAAATAGTAGGTACGG + Intergenic
1188850890 X:35130903-35130925 GGCGATCCAAAGGGAAGGTGAGG + Intergenic
1189155812 X:38755845-38755867 TGACACCAGAAGAGTAGGTGAGG - Intergenic
1196137621 X:112227237-112227259 TGACAGCCAAAAAGAAGGTGAGG - Intergenic
1196757421 X:119170263-119170285 GGACATACAAAGAGGAGGTGAGG - Intergenic
1202098583 Y:21281238-21281260 TACCATGAAAAGAGTACGTGGGG + Intergenic