ID: 1026587844

View in Genome Browser
Species Human (GRCh38)
Location 7:71671330-71671352
Sequence TGGGACTCCCTGTGACTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026587838_1026587844 9 Left 1026587838 7:71671298-71671320 CCCCATTAGCTCTGCAATCGGGT 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1026587844 7:71671330-71671352 TGGGACTCCCTGTGACTACCAGG 0: 1
1: 0
2: 0
3: 11
4: 156
1026587840_1026587844 7 Left 1026587840 7:71671300-71671322 CCATTAGCTCTGCAATCGGGTTT 0: 1
1: 0
2: 1
3: 5
4: 73
Right 1026587844 7:71671330-71671352 TGGGACTCCCTGTGACTACCAGG 0: 1
1: 0
2: 0
3: 11
4: 156
1026587839_1026587844 8 Left 1026587839 7:71671299-71671321 CCCATTAGCTCTGCAATCGGGTT 0: 1
1: 0
2: 1
3: 4
4: 46
Right 1026587844 7:71671330-71671352 TGGGACTCCCTGTGACTACCAGG 0: 1
1: 0
2: 0
3: 11
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026587844 Original CRISPR TGGGACTCCCTGTGACTACC AGG Intronic
900611032 1:3544744-3544766 TGGGAAGCCCTGGGTCTACCAGG - Intronic
901736699 1:11317126-11317148 TGGGCCTCCCTGTGTCATCCAGG + Intergenic
902993391 1:20205315-20205337 AGGGCCTTCCTGTGGCTACCTGG - Intergenic
906980150 1:50621142-50621164 TGGGACTTCCTGGTACTTCCAGG - Intronic
907368047 1:53978931-53978953 GAGGGCTCCCTGTGACTTCCAGG - Intergenic
909459375 1:75892744-75892766 AGGGCCTGCCTGTCACTACCAGG + Intronic
911422634 1:97663230-97663252 TGAGATTCCTTGTGACAACCTGG - Intronic
912229213 1:107773217-107773239 TGGATCTGCCAGTGACTACCTGG - Intronic
914752619 1:150545827-150545849 AGGGACTCCTGGTGACAACCTGG - Intergenic
915849641 1:159307540-159307562 TAGGACTCCCTGTGGCTCCAGGG + Intronic
916483120 1:165233261-165233283 TGGGTCTCCCTGTGTTTCCCAGG - Intronic
917176544 1:172242178-172242200 TGGGCTTCCCTGTCCCTACCAGG - Intronic
1063154387 10:3365137-3365159 TGGGTCTCCCTGTCAATTCCAGG - Intergenic
1063243922 10:4199070-4199092 TCGGACTCCCTTGGACTCCCTGG + Intergenic
1066125456 10:32337423-32337445 AGGGACACCCTGTGAATATCTGG + Intronic
1069891718 10:71656350-71656372 TGGGAGCCCCTGTGTCTCCCTGG + Intronic
1075336693 10:121613695-121613717 TGGCACTCCCTGGCACTCCCTGG + Intergenic
1076193880 10:128501154-128501176 TGGGGCTCCCTGTGCCCACAAGG + Intergenic
1077021251 11:418046-418068 TGGGCCTCCCTCTGACTTCTGGG - Intronic
1082006400 11:47421621-47421643 TGGGCCTCCCTGTTGCTCCCTGG - Intronic
1083339572 11:61950349-61950371 TGGGACTCCCTGGGACTCTGTGG - Exonic
1084489223 11:69469292-69469314 TGAAACTCCCTGTGGATACCAGG + Intergenic
1084795473 11:71502033-71502055 TGAGACTCCCTGGGGCAACCCGG - Intronic
1085020294 11:73202435-73202457 TGAGACCGCCTGAGACTACCAGG + Intergenic
1086233517 11:84598733-84598755 TGGGTCTCCCTGTGTTTTCCAGG - Intronic
1089202216 11:116731406-116731428 TGGCAATCCCTGTGGCTGCCTGG + Intergenic
1090320281 11:125837243-125837265 TGGGAGTCCCTGTGACCAGGAGG - Intronic
1090416574 11:126544526-126544548 TGGGACTGCCCGGGGCTACCTGG + Intronic
1090464593 11:126922938-126922960 TCTGAGTCCCTGTGACCACCAGG + Intronic
1099120819 12:78687284-78687306 AGTGACTCCCTCTGACCACCTGG + Intergenic
1101233283 12:102763770-102763792 TGAGGCTCCCTGTCACTTCCAGG - Intergenic
1103253862 12:119523567-119523589 GGGGACTCCCTGTAGCCACCTGG - Intronic
1105349902 13:19605701-19605723 TGGGCCACCCTCTGTCTACCTGG - Intergenic
1105501125 13:20972854-20972876 TTGGACTTCATGTGTCTACCTGG + Intergenic
1110132768 13:72027663-72027685 GAGGACTCCCTGTGAATAACGGG + Intergenic
1114701000 14:24678682-24678704 TGGGTCTCGCTGTGACACCCGGG - Intergenic
1118489423 14:66244664-66244686 CGGGACTCCCTGTTACCTCCAGG + Intergenic
1119108469 14:71947202-71947224 TGGGTCTCCCTGTGGCTAAAGGG + Intronic
1119430619 14:74566176-74566198 TGGTACTCCTTATGACTTCCAGG + Intronic
1121452318 14:94016827-94016849 TCCAACTCCCTGTGCCTACCGGG + Intergenic
1122063132 14:99150350-99150372 TGGGGCTCCCTGTGACTCACTGG - Intergenic
1122243710 14:100385939-100385961 TGGGACTCCCTCTCAGTGCCTGG - Intronic
1123797030 15:23782530-23782552 CTGGAGTCCCTGTGACAACCAGG - Intergenic
1123968369 15:25481095-25481117 TGGGCTTCTCTGGGACTACCTGG - Intergenic
1123993523 15:25702256-25702278 GGGGACTTCCTGTCACTACATGG - Intronic
1126370948 15:47946432-47946454 GGGGACTACCTGTTACTAACAGG + Intergenic
1128746015 15:70114583-70114605 TGGGTCTCCCTGTTCCTAACAGG - Intergenic
1129848641 15:78779587-78779609 TGGGGCTCCCTGAGCCTCCCTGG + Intronic
1130253282 15:82314359-82314381 TGGGGCTCCCTGAGCCTCCCTGG - Intergenic
1131199273 15:90383203-90383225 TGGGTCTCACTCTGTCTACCTGG + Intergenic
1132675250 16:1118710-1118732 TGGGCCTCCCTGTGCCTCCCTGG - Intergenic
1133520040 16:6548553-6548575 TTGTCATCCCTGTGACTACCTGG - Intronic
1133754600 16:8753021-8753043 TTGGACTCCCTGTGTATGCCAGG - Intronic
1134019189 16:10909757-10909779 AGGGTCTCGCTGTGTCTACCAGG + Intronic
1137054221 16:35735700-35735722 GGGGACCCCCTGTGAAGACCAGG + Intergenic
1138248371 16:55483750-55483772 TGGGACTCCCTGGGTCTTCAAGG + Intronic
1138251036 16:55502097-55502119 TGGCCCACCCTGTGACTAACAGG + Intronic
1141050635 16:80760107-80760129 TAGGACTCCCTTAGACTAGCAGG + Intronic
1143259083 17:5584822-5584844 TGGGGCCCCCTGTGTCTGCCCGG + Intronic
1143372306 17:6447861-6447883 TGGCACCCCCTGTGGCTACCTGG + Intronic
1144872365 17:18379141-18379163 TGGGCCTCCCTTGGACCACCCGG + Intronic
1144873573 17:18384793-18384815 TGGGCCTCCCTTGGACCACCCGG + Intronic
1145322801 17:21776221-21776243 GGGGATTGGCTGTGACTACCTGG - Intergenic
1151671101 17:75572083-75572105 CGGGTCTCCCTGGGACTCCCCGG + Intronic
1151671105 17:75572093-75572115 TGGGACTCCCCGGGACATCCAGG + Intronic
1151696884 17:75722332-75722354 TGGGGCTCCTGGTGACTCCCAGG + Intronic
1151748898 17:76025881-76025903 TGGGCCTCCCTTGGACCACCCGG - Intronic
1151840382 17:76613290-76613312 TGGGCCTCACTGTGACTTCTGGG + Intergenic
1151939762 17:77285219-77285241 TGGGACTCCCTTTGCATACTAGG + Intronic
1155051000 18:22147542-22147564 AGGGTCTCCCTGTGTCTCCCAGG + Intergenic
1156253108 18:35370916-35370938 TGGGGCTGACTGTGACTACTGGG + Intronic
1156774464 18:40770285-40770307 TGGGTCTCCCTGTGTCACCCAGG - Intergenic
1157058430 18:44257480-44257502 TTGGATTCTCTGTCACTACCGGG - Intergenic
1157331607 18:46708183-46708205 TCTGACTCCCTGGGACTTCCTGG - Intronic
1157572277 18:48721041-48721063 TGGAACCCCCTGTGCCCACCAGG + Intronic
1162826021 19:13252802-13252824 TGGGTCTCCCTGGGACTCCTTGG + Intronic
1163543485 19:17926289-17926311 TCGGCTTCACTGTGACTACCAGG + Intergenic
1163918387 19:20263946-20263968 TGGAACTCACTGTGCCAACCAGG - Intergenic
1164281891 19:23776601-23776623 TGTGACTCCCTTTTACTGCCTGG + Intronic
1164435413 19:28224373-28224395 TGGGCCTCCCAGTGTGTACCAGG + Intergenic
1164611661 19:29636608-29636630 TGGGCCTCCCTCTGACTCTCTGG + Intergenic
1164795007 19:31019262-31019284 TGGGAGTCCCTGTTTCTGCCTGG + Intergenic
1165047896 19:33120667-33120689 TGGGTCTCCCTGTGTCACCCAGG - Intronic
1166299878 19:41907495-41907517 TGGAACTCTCTGTGACTGTCTGG + Intronic
1166365927 19:42278488-42278510 GGGGGCTCCCTGTGCCTTCCTGG + Intronic
1167011778 19:46813427-46813449 TGGGACAGGCTGTGACTGCCTGG - Intergenic
1168409147 19:56127725-56127747 AGGGAATGCCTGTGGCTACCTGG - Intergenic
928442654 2:31304984-31305006 TGGGACTCCCTGTGATCTCTGGG - Intergenic
929521193 2:42652535-42652557 TGGGTCTCCCTGTGTTGACCAGG + Intronic
929655414 2:43726092-43726114 TGGGTCTCCCTCTGTCTCCCAGG - Intronic
929677421 2:43951042-43951064 TGAGACTCACTGTGTCTCCCAGG - Intronic
932189783 2:69731091-69731113 TAGGCCTCCCTGTGTCTACCAGG + Intronic
933411143 2:81926576-81926598 TGGGACTCACTGAGCCTACCAGG + Intergenic
933449234 2:82425160-82425182 TTGGAAACCCTGTCACTACCTGG - Intergenic
934558566 2:95300425-95300447 TGGGCATCCCAGTGACTTCCAGG + Intronic
939204240 2:139079400-139079422 TGAGACTCCATGTGGCTACAAGG + Intergenic
946280721 2:218663985-218664007 AGGGACTCCCTCCGAGTACCAGG + Exonic
1169239968 20:3968415-3968437 GGGGTCTCCCTGTGTCTCCCAGG - Intronic
1171400103 20:24867679-24867701 TCGGACTCTCTGTGCCTCCCAGG + Intergenic
1174007903 20:47425221-47425243 TGGGTCTCCCTGTGTCATCCAGG - Intergenic
1177594811 21:23224701-23224723 TTGGACTCACTGTTACCACCAGG - Intergenic
1178673362 21:34611921-34611943 TGGGACTCCCTTAGCCCACCTGG + Intronic
1179710026 21:43208021-43208043 TGGGACCCCCTGTTCCTCCCAGG - Intergenic
1179805264 21:43833161-43833183 GGGGCCTCCCTGTGACTGGCAGG + Intergenic
1179926695 21:44538815-44538837 TGGGACTCACGGTCACTCCCAGG - Intronic
1179937212 21:44613349-44613371 TGGGACTCACGGTCACTCCCAGG + Intronic
1179995624 21:44972751-44972773 TGGGACTGGCTGTGCCTGCCAGG + Intronic
1181162215 22:20965661-20965683 TCGGACTCCCAGTGGCTTCCAGG - Intronic
1181853787 22:25768504-25768526 TAGGACTCCTTGTGGCTCCCAGG + Exonic
1183165095 22:36141473-36141495 CCCGACTCCCTGTGACCACCTGG - Exonic
1183341400 22:37283807-37283829 TGGGTCTCCCTGTGCCAACCAGG - Intronic
949121435 3:389301-389323 TGGGGCTCCCTGTGGCTTCCAGG - Exonic
956012423 3:64845660-64845682 TGGGTCTCCCTGTGTCACCCAGG + Intergenic
959952439 3:112194343-112194365 GGTGACTCCATGTGACTTCCTGG + Intronic
968595600 4:1480869-1480891 TGGGTTTCCTTGTGGCTACCTGG - Intergenic
969033089 4:4228799-4228821 AGGGTCTCCCTGTGTCTCCCAGG + Intergenic
970166305 4:13241792-13241814 TGGGACTCCCAGTGCATGCCAGG + Intergenic
972162118 4:36239845-36239867 TGGAACTCCCTGTACATACCTGG + Intronic
973864749 4:55101103-55101125 TCGGAATCCTTGTGACTATCTGG + Intronic
973949622 4:55998515-55998537 TGTCACTCCATTTGACTACCCGG + Intronic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
984091281 4:175378484-175378506 TGGGACTCTTTGTTACAACCCGG - Intergenic
985535764 5:465014-465036 TGGGGCTCCCGGTGGCTCCCCGG - Intronic
985670247 5:1203185-1203207 TGGGACTGCCTGAGCCTGCCTGG + Intronic
994674165 5:102800695-102800717 TGGAACTCCCTTTGAGTCCCTGG + Intronic
999293181 5:150440974-150440996 TGGGTCTCCCTGTGCCGCCCAGG - Intergenic
999905911 5:156141277-156141299 TGGGACTCTCTGTGGTGACCCGG - Intronic
1000003793 5:157164739-157164761 TCTGTCTCCCTGTGACTACCAGG - Intronic
1000998937 5:167986857-167986879 TGGTCCTCCCTGTGACCATCTGG + Intronic
1001591864 5:172871120-172871142 GAGGTCTCCCTGTTACTACCGGG - Intronic
1002148625 5:177207633-177207655 TGGGTCTCCCTGTGTTTCCCAGG + Intronic
1004035836 6:11921909-11921931 TGGGGATCCCTGTGAGTTCCAGG - Intergenic
1005759214 6:28952147-28952169 TGAGTCTCCCTCTGTCTACCAGG - Intergenic
1010245393 6:73657462-73657484 AGGGCCTCCCTGTGACGCCCAGG + Intergenic
1014104060 6:117543410-117543432 AGGGTCTCCCTGTGTCTCCCAGG + Intronic
1017739873 6:157397573-157397595 TGGGATTCCCTGGGCCCACCTGG + Intronic
1018863001 6:167725184-167725206 TGTGACTTCCTTTGACTAGCAGG - Intergenic
1018967026 6:168497217-168497239 TGAGGCTCCCAGTGACCACCGGG - Intronic
1019991991 7:4698576-4698598 AGGGACTCCCTGTGCCACCCAGG + Intronic
1020077769 7:5269776-5269798 TGGGATGCCCTGTGCCTCCCTGG - Intergenic
1022557365 7:31311865-31311887 TGGGACAACCTGTGTCTCCCTGG + Intergenic
1025201118 7:56962395-56962417 TGGGATGCCCTGTGCCTCCCTGG + Intergenic
1025670826 7:63614537-63614559 TGGGATGCCCTGTGCCTCCCTGG - Intergenic
1026587844 7:71671330-71671352 TGGGACTCCCTGTGACTACCAGG + Intronic
1026893208 7:73995066-73995088 TGGTACTACCTGTGACTAGGGGG - Intergenic
1027356122 7:77357400-77357422 TGTGCCTACCTGTGTCTACCTGG - Intronic
1031007706 7:116493000-116493022 GGGGACTCCCTCTGTCTATCTGG + Intronic
1032214712 7:129948997-129949019 TTGGCCGCCCTGTTACTACCCGG - Intronic
1033446545 7:141428033-141428055 GAGGACTCCCTGTGAATGCCAGG + Intronic
1035224526 7:157426034-157426056 TGGGACTCCCTGTGAGTGCAAGG - Intergenic
1036773572 8:11594681-11594703 TGTGAATGCCTGTGAGTACCTGG + Intergenic
1039585557 8:38704268-38704290 AGGGGCTTCCTGTGTCTACCTGG - Intergenic
1041451872 8:58014203-58014225 TGGGCCTCCCTCTGCCTAGCGGG + Intronic
1044987476 8:97768064-97768086 AGGGTCTCCCTGTGTCTCCCAGG - Intergenic
1045793386 8:106013139-106013161 TGGGACTCCCTCTGAAAGCCTGG - Intergenic
1046579019 8:116068557-116068579 TGGGACTCCTTGAGACAAACAGG + Intergenic
1048308810 8:133302437-133302459 AGGGACTGCCAGTAACTACCAGG - Intergenic
1048832652 8:138491828-138491850 AGGGACACCCAGTGATTACCAGG + Intronic
1049386739 8:142346732-142346754 TGGGACCCACTGTGCCGACCTGG - Intronic
1050766286 9:9139137-9139159 TGAGACTCCTAGTGAATACCTGG + Intronic
1054949726 9:70836344-70836366 TGTGGCTCCCTTTGGCTACCTGG + Intronic
1056935190 9:90911014-90911036 TGGGGCTTCCTGTCAATACCTGG - Intergenic
1057133472 9:92670366-92670388 GGGGACTGCCGGTCACTACCGGG - Intergenic
1189438309 X:41012278-41012300 TGGGACCCCCTGAGACTCCCAGG + Intergenic
1190447805 X:50547095-50547117 TGGGACTCCTTGTTACTTCTGGG - Intergenic
1197121391 X:122897587-122897609 TGTGACTACCTGTGATTAACTGG - Intergenic
1198471852 X:136954246-136954268 TGGGTCTCCCTGTGCCTTGCAGG + Intergenic
1200046031 X:153401409-153401431 CGGAACTCCCTGTGGCTTCCGGG - Intergenic