ID: 1026603088

View in Genome Browser
Species Human (GRCh38)
Location 7:71792870-71792892
Sequence GAAACAAGGTTACCAGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026603088 Original CRISPR GAAACAAGGTTACCAGCAAC AGG Intronic
900286482 1:1903256-1903278 GAACCGAGGTTACCAGGACCAGG - Intergenic
904905635 1:33895533-33895555 GACAAAAGGTTAGCAGCAGCAGG + Intronic
905913211 1:41667993-41668015 AACACAAGGTAAACAGCAACAGG + Intronic
906114638 1:43348695-43348717 AAAACACGCTTCCCAGCAACAGG - Intronic
915088024 1:153401640-153401662 GAAAGGAGGTTACCCGAAACTGG + Intergenic
915436425 1:155910307-155910329 GAAACAAGGGTATCAGCAGTTGG - Intronic
917558963 1:176124436-176124458 GAAAGATGGTTACCAGAAGCTGG - Intronic
918665709 1:187147957-187147979 GAAAAATGGTTACCAGAAGCTGG - Intergenic
919229076 1:194749467-194749489 TAAACAAGTTTACTATCAACTGG - Intergenic
920172869 1:204082518-204082540 GAAACAAAGTTGACAGCAAAAGG - Intronic
922019519 1:221689407-221689429 GAAACAAGGTATACAGCTACAGG - Intergenic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
924169927 1:241328250-241328272 GGAACAAGGTTACTAGCCAGTGG - Intronic
1063097140 10:2918092-2918114 AAACAAAGGTTCCCAGCAACAGG - Intergenic
1064619294 10:17198618-17198640 GAATCAAGGTTACCAGGGACTGG + Intronic
1068916406 10:62436768-62436790 GGCACAATGTTACCAGCTACAGG - Intronic
1071064931 10:81620239-81620261 GAAGCATGGTTACCAGAAGCTGG - Intergenic
1071383299 10:85093403-85093425 GAAAGATAATTACCAGCAACTGG - Intergenic
1071957359 10:90773622-90773644 GAAGGATGGTTACCAGCAGCTGG - Intronic
1074393844 10:113080464-113080486 GAACCAAGGTTGCCAGCGAATGG + Intronic
1079213371 11:18483902-18483924 GAAAAAGGGTCACCAGAAACTGG - Exonic
1080977352 11:37358575-37358597 GAAAAAATGGTACCAGCCACTGG + Intergenic
1081143316 11:39531468-39531490 GAAAGATGGTTACCAGAGACTGG - Intergenic
1081342323 11:41943525-41943547 TAACCAAGGTTTCCAGCAAGAGG - Intergenic
1081711570 11:45219839-45219861 GAAATACGGTTCCCAGCAATGGG + Intronic
1088602470 11:111493507-111493529 GAAACAAGACTACCAGCAATGGG - Intronic
1089823397 11:121248771-121248793 GAAACAAAATCACCAGCAAGAGG + Intergenic
1090843029 11:130509049-130509071 GAAACATGGAAAGCAGCAACAGG - Intergenic
1097263586 12:57733408-57733430 GAAACCAGGATGCAAGCAACAGG + Intronic
1097669224 12:62516251-62516273 GAATGATGGTTACCAGCAGCTGG + Intronic
1098060884 12:66561162-66561184 GAATAAAGGTTACCAGAAGCTGG + Intronic
1098062100 12:66573806-66573828 GAAACAGGGTGAAGAGCAACAGG + Intronic
1098217636 12:68236919-68236941 GAATTAATGTTACCAGCTACTGG + Intergenic
1099243558 12:80167190-80167212 GAAACAGATTTACCAGCAAATGG + Intergenic
1099372942 12:81860086-81860108 GAAAAAAGGTTACCAAGGACAGG - Intergenic
1099551679 12:84053029-84053051 GAAGGATGGTTACCAGAAACTGG - Intergenic
1100565221 12:95789435-95789457 GAAACCAGGTGACCCGCAAGAGG + Intronic
1101434844 12:104655643-104655665 GAAACAGTGTTACGAGCAATGGG + Intronic
1103227749 12:119302821-119302843 TAAACAAGATTATCAGAAACAGG + Intergenic
1104539626 12:129651691-129651713 GAAGCAAGGACAGCAGCAACTGG + Intronic
1105043725 12:132984531-132984553 GAAAGATGGTTACCAGCAGCTGG - Intergenic
1105731265 13:23219439-23219461 AAAACAAGTTTTCCAGCAAGTGG + Intronic
1109609367 13:64743186-64743208 GAAATAAAATTTCCAGCAACTGG - Intergenic
1111547234 13:89756227-89756249 GAAAGAAGGTTGTCAGAAACAGG - Intergenic
1111680626 13:91437576-91437598 GAAAAAATGTTACCTGCAAAGGG - Intronic
1112869510 13:103952749-103952771 GGAACAAGGTCAGCAGCAATGGG + Intergenic
1115587924 14:34833663-34833685 GAATAAAGGTTACCAGAAGCTGG + Intronic
1115918907 14:38349790-38349812 GAAGGAAGGTTACCAGAAGCTGG + Intergenic
1117531856 14:56667418-56667440 GGAACAGGGATACCAGCTACTGG - Intronic
1118423964 14:65637779-65637801 GAAAGCAGGTTGCCAGAAACGGG + Intronic
1118787884 14:69061408-69061430 GAAAAAATGGTACTAGCAACTGG + Intronic
1118860454 14:69658913-69658935 GTGACAAGGTTACCACCAGCAGG - Intronic
1119014959 14:71040843-71040865 GAAGCATGGTTATCAGCGACCGG - Intronic
1120098590 14:80418358-80418380 GAAAGAAGGTTTTCAGCAACAGG - Intergenic
1120950351 14:90035245-90035267 AATACAAAGTTACCAGCAAGAGG - Intronic
1121923715 14:97908158-97908180 GAAACAAAGTTACAAGGAAATGG + Intergenic
1125097230 15:35868743-35868765 GAAGCAATGTTACCAGAAAGGGG - Intergenic
1126363896 15:47873661-47873683 GAAAGAAGGTGACTTGCAACAGG - Intergenic
1126521628 15:49601805-49601827 GAAGGAGGGTTACCAGAAACTGG - Intronic
1127004424 15:54550237-54550259 GAAACAAGGTTACCTGTGTCTGG - Intronic
1130449757 15:84039222-84039244 GCAACAAAGTTACCTGCCACAGG + Exonic
1130754338 15:86746561-86746583 CAAACATGGTTACCAGCTCCTGG - Intronic
1131065427 15:89432113-89432135 GAATAGAGGTTACCAGGAACTGG + Intergenic
1131393043 15:92064840-92064862 GAATGATGGTTACCAGCAGCTGG + Intronic
1134199282 16:12184485-12184507 GAAATAAGGCTACCAGCAGGAGG - Intronic
1138889221 16:61121905-61121927 GAAACAAGGTTTTCAGAAAAAGG + Intergenic
1144796541 17:17895276-17895298 AAAACGATGTCACCAGCAACAGG + Intronic
1146988885 17:37249026-37249048 GAATGACGGTTACCAGGAACTGG - Intronic
1151396863 17:73828608-73828630 GAATGGAGGTTACCAGGAACTGG - Intergenic
1153192950 18:2562743-2562765 GAATAAAGGATACCAGCAGCTGG + Intronic
1155443917 18:25890953-25890975 GAATGATGGTTACCAGAAACTGG + Intergenic
1156445977 18:37237011-37237033 GAAACAAGGTTGACAGCTCCTGG + Intergenic
1157612426 18:48966105-48966127 GAATCAAGGTTACCAGGGGCCGG + Intergenic
1162889262 19:13720528-13720550 AACACAAGTTTACCAACAACAGG + Intergenic
1163303432 19:16462347-16462369 GAGACCAGGTTACCAGAATCAGG + Intronic
925684153 2:6453842-6453864 GAAACAACAGTAACAGCAACAGG - Intergenic
927934167 2:27066332-27066354 GAAACAAGGTTTCTAGCAGTTGG + Intronic
928155801 2:28875340-28875362 GATTCAAGTTTAGCAGCAACTGG - Intergenic
928491751 2:31791643-31791665 GAATGAAGGTTACCAGAGACTGG + Intergenic
929084498 2:38155105-38155127 GAAACAAGGTTCCCATAAGCCGG - Intergenic
931090059 2:58876223-58876245 GAAACAAAGTTGCCAGAACCTGG - Intergenic
934231379 2:90184945-90184967 GAATGAAGGTTGCCAGGAACTGG + Intergenic
937336757 2:121066965-121066987 GAGACAAGGAGACCAGCAAGGGG + Intergenic
937864364 2:126737751-126737773 GCAACAAGATTTCCACCAACAGG + Intergenic
938631889 2:133176614-133176636 GAAACCAGGTTACTAGCACATGG - Intronic
939794610 2:146626889-146626911 AAAAGAAGATTAACAGCAACAGG - Intergenic
942090433 2:172484578-172484600 GAAACATTGTTAACAGCAAAAGG + Intronic
942395621 2:175545470-175545492 GAAACATGGTTACCAGAGGCTGG + Intergenic
942413948 2:175738896-175738918 GAAACAAGGTTGGCAGGAAAAGG - Intergenic
943202759 2:184850045-184850067 GAATGATGGTTACCAGCAGCAGG + Intronic
945825098 2:214712081-214712103 GCAACAGGGTTCCCAGCAATTGG + Intergenic
946640243 2:221776088-221776110 GAAACAATTTTCTCAGCAACTGG + Intergenic
948229830 2:236341767-236341789 GAAACAAGGTTGCCAGAATGGGG - Intronic
948309192 2:236972399-236972421 GAAATAAGGGAAGCAGCAACAGG - Intergenic
948384920 2:237575299-237575321 GATACCACGTCACCAGCAACAGG + Intronic
1170801950 20:19597739-19597761 GAATGATGGATACCAGCAACTGG - Intronic
1170828633 20:19820168-19820190 AAAACAAGGTTAAAATCAACAGG - Intergenic
1173435273 20:43026748-43026770 GAAAGATGGTTACCAGAAGCTGG - Intronic
1174206770 20:48846198-48846220 GAAACAAGGAGACTAGCTACAGG + Intergenic
1177005035 21:15661667-15661689 AAAAAAAGGTTATTAGCAACTGG + Intergenic
1177330351 21:19652189-19652211 GAAAAATGGTTACCAGGACCTGG + Intergenic
1180074383 21:45455343-45455365 GAATCAAGGTGCCCAGCACCCGG - Intronic
1184638105 22:45851853-45851875 GAAACACGATTACAAGCAAAAGG + Intergenic
1184962871 22:47944296-47944318 GAAATAATGTTTCCTGCAACAGG - Intergenic
951667559 3:25144083-25144105 GAACTAAGGTTGTCAGCAACAGG - Intergenic
953012804 3:39043653-39043675 GAAGAATGGTTACCAGAAACTGG + Intergenic
953444369 3:42950134-42950156 TAATCAAGGTTGCCAGCAGCAGG - Intronic
959436894 3:106326461-106326483 GAAGAAAGGTGACCAGCAAGAGG - Intergenic
961020805 3:123505230-123505252 GACAGAAGGTTGCCAGCAGCTGG + Intronic
962999924 3:140670616-140670638 GAAAGAAGGTTACCAGGGTCTGG + Intergenic
963045734 3:141101346-141101368 GAAAGAAGGTTCCCAGCCCCTGG - Intronic
963495582 3:146056172-146056194 GAATCATGGTTACCAGAAGCTGG + Intergenic
965939142 3:174155753-174155775 GAAATAAGGGTACCAAGAACTGG + Intronic
966225019 3:177588978-177589000 AACACAAGGTTCCCAGGAACCGG - Intergenic
967715347 3:192756300-192756322 GAAGGATGGTTACCAGAAACTGG + Intronic
969185544 4:5471573-5471595 GTAACTAAGTTACCACCAACTGG - Intronic
969601301 4:8178019-8178041 GAAACAACGGAACCAGCCACTGG + Intergenic
972340531 4:38148930-38148952 GAAATAGGCTTACCAGCACCAGG + Intergenic
974296026 4:59999826-59999848 TAGATAAGGTTACCAGCAACAGG - Intergenic
975080020 4:70266024-70266046 GAAAGATGGTTACCAGAGACTGG + Intergenic
976397084 4:84567713-84567735 GAATGATGGTTACCAGCAGCTGG + Intergenic
976456769 4:85256858-85256880 GAATCAAGTTGACCAGCAGCAGG - Intergenic
978978655 4:114914161-114914183 GAAGGAAGGTTACCAGAAGCTGG + Intronic
979283824 4:118898356-118898378 GAAACAAGGAGACCAGTTACAGG - Intronic
979407851 4:120337011-120337033 GAAAGGTGGTTACCAGCAACAGG - Intergenic
979930902 4:126629106-126629128 GAATGATGGTTACCAGAAACTGG - Intergenic
980315320 4:131192203-131192225 GAAAGAAGGTTGTCAGAAACAGG + Intergenic
980648849 4:135683652-135683674 GTAAAAAGGTTAACATCAACAGG - Intergenic
981133773 4:141187971-141187993 GAAAAACCGTTACCAGCCACTGG - Intronic
981328134 4:143476054-143476076 GAACAAAGGCTCCCAGCAACAGG - Intergenic
982144957 4:152377049-152377071 GAAACAATGTCAACAGCAATAGG + Intronic
982682891 4:158453100-158453122 GAAAGATGGTTACCAGACACAGG - Intronic
983769098 4:171525869-171525891 TAAACAAGGTTAACATCACCAGG - Intergenic
986742103 5:10713268-10713290 GAGACAAGGTGACCAGTAAGAGG + Intronic
987700700 5:21394338-21394360 GAATCAAGGTTACCACAAATAGG + Intergenic
992848089 5:80774792-80774814 GAATGATGGTTACCAGAAACTGG + Intronic
995720901 5:115131850-115131872 GAATCAAAGTTACCAGCCTCTGG + Intronic
999052129 5:148534335-148534357 GATCCAAGGTGACTAGCAACTGG + Intronic
1000018034 5:157295631-157295653 GAAACAAAGTCACCACAAACAGG - Intronic
1003637239 6:7844057-7844079 GAATGGAGGTTACCAGGAACTGG - Intronic
1004249121 6:14007911-14007933 TGAAGAAAGTTACCAGCAACAGG - Intergenic
1005319699 6:24641082-24641104 GAATAAGGGTTACCAGGAACTGG - Intronic
1007808758 6:44471762-44471784 GATACTAGGTTATCAGCACCAGG - Intergenic
1013363216 6:109413942-109413964 GAAGGATGGTTACCAGAAACTGG + Intronic
1014081872 6:117296632-117296654 GAAGGATGGTTACCAGAAACTGG + Intronic
1014164286 6:118205957-118205979 GAAGAAAGGTTACCAGGGACTGG + Intronic
1015571720 6:134628442-134628464 GAAACAAGTGTACCAGCCACCGG - Intergenic
1019810283 7:3160137-3160159 GAAAATAGGTTACCAGGAGCTGG + Intronic
1020765616 7:12316537-12316559 GAATGATGGTTACCAGAAACTGG + Intergenic
1026603088 7:71792870-71792892 GAAACAAGGTTACCAGCAACAGG + Intronic
1028316994 7:89415033-89415055 GAATGATGGTTACCAGCAGCTGG + Intergenic
1030312154 7:108079713-108079735 GTAACAGGGTTCCCAGGAACTGG + Exonic
1031278257 7:119760059-119760081 GAACCAATATTACCAGCAACTGG - Intergenic
1031862730 7:127000218-127000240 GAAGGATGGTTACCAGAAACTGG + Intronic
1033920427 7:146385219-146385241 GCAACAAGATTACAAGCAATAGG - Intronic
1043307334 8:78812062-78812084 GAACCATGGTTACCAGGAGCTGG - Intergenic
1044119087 8:88372078-88372100 GAATGATGGTTACCAGGAACTGG - Intergenic
1044876761 8:96676277-96676299 GAATGATGGTTACCAGAAACTGG - Intronic
1045052899 8:98342969-98342991 AAATCAAGGTGACCAGCCACGGG - Intergenic
1046133938 8:110002657-110002679 GAAGGATGGTTACCAGCAGCTGG - Intergenic
1047814297 8:128445759-128445781 GAAACAAGGTGTCCAGAATCAGG + Intergenic
1051605895 9:18917581-18917603 AAGTCAAGGTTACCAGCACCAGG - Intergenic
1052491924 9:29180276-29180298 GAAACAAGATTATCATCAACAGG + Intergenic
1056895819 9:90548430-90548452 GAAAGAAGGTTCCCGGAAACAGG + Intergenic
1057288579 9:93782605-93782627 GAAGCAAGGTTACCAGAGACTGG - Intergenic
1059683373 9:116607983-116608005 AAAACAAGCTTGTCAGCAACTGG + Intronic
1186127218 X:6426926-6426948 GAAACAAGGTTTCCAGGAGAAGG + Intergenic
1186911139 X:14167636-14167658 GAAGCATGGTTACCAGAGACTGG - Intergenic
1187262664 X:17701630-17701652 GAAGGAAGGTTACCTGAAACCGG + Intronic
1188260608 X:28018418-28018440 GAAAAATGGTTACCAGGAATGGG - Intergenic
1192950169 X:76008303-76008325 GAGACAAGGTCACCTGCAAAGGG - Intergenic
1193462179 X:81804420-81804442 GAAAAATGGTTACCAGCAGCTGG - Intergenic
1193622174 X:83768127-83768149 GAAAAATGGTTACCAGAAGCTGG - Intergenic
1194280902 X:91953027-91953049 GAAAGATGGTTACCAGAGACTGG + Intronic
1195040527 X:101010012-101010034 GAACCAAGGCTGACAGCAACAGG + Exonic
1196323539 X:114372574-114372596 GAAACAATGTTACCAAAACCAGG - Intergenic
1196507832 X:116469322-116469344 GGAAGAAGGTTACCAGAAGCGGG - Intergenic
1197045174 X:121987907-121987929 GAAAGATGGTTACCAGACACTGG - Intergenic
1198699609 X:139382716-139382738 GTAACCAGGTAACCAGCAACCGG + Intergenic
1199837725 X:151609481-151609503 GAAAGGTGGTTACCAGGAACTGG - Intronic
1200598494 Y:5177687-5177709 GAAAGATGGTTACCAGAGACTGG + Intronic
1201337801 Y:12899036-12899058 GAAACAATGATACCAGTAATTGG + Intergenic
1201609463 Y:15824401-15824423 GAAACAAGGTTTCCAGGAGAAGG + Intergenic