ID: 1026608774

View in Genome Browser
Species Human (GRCh38)
Location 7:71838702-71838724
Sequence ATCACCAGAACTGCAGAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 597
Summary {0: 1, 1: 1, 2: 6, 3: 116, 4: 473}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026608774_1026608780 17 Left 1026608774 7:71838702-71838724 CCCCATTCTGCAGTTCTGGTGAT 0: 1
1: 1
2: 6
3: 116
4: 473
Right 1026608780 7:71838742-71838764 GACATCTGATGGTTTTATAAGGG 0: 60
1: 3636
2: 6125
3: 5417
4: 3485
1026608774_1026608781 18 Left 1026608774 7:71838702-71838724 CCCCATTCTGCAGTTCTGGTGAT 0: 1
1: 1
2: 6
3: 116
4: 473
Right 1026608781 7:71838743-71838765 ACATCTGATGGTTTTATAAGGGG 0: 39
1: 3153
2: 7014
3: 7278
4: 4328
1026608774_1026608778 6 Left 1026608774 7:71838702-71838724 CCCCATTCTGCAGTTCTGGTGAT 0: 1
1: 1
2: 6
3: 116
4: 473
Right 1026608778 7:71838731-71838753 TGAGTTCTCAGGACATCTGATGG No data
1026608774_1026608777 -5 Left 1026608774 7:71838702-71838724 CCCCATTCTGCAGTTCTGGTGAT 0: 1
1: 1
2: 6
3: 116
4: 473
Right 1026608777 7:71838720-71838742 GTGATAGTGAGTGAGTTCTCAGG 0: 89
1: 220
2: 299
3: 269
4: 292
1026608774_1026608779 16 Left 1026608774 7:71838702-71838724 CCCCATTCTGCAGTTCTGGTGAT 0: 1
1: 1
2: 6
3: 116
4: 473
Right 1026608779 7:71838741-71838763 GGACATCTGATGGTTTTATAAGG 0: 4
1: 162
2: 2713
3: 4553
4: 4305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026608774 Original CRISPR ATCACCAGAACTGCAGAATG GGG (reversed) Intronic
900492280 1:2956773-2956795 ATCATGAGAACAGCAGCATGGGG + Intergenic
900825459 1:4923003-4923025 ATCATGAGAACAGCAGCATGAGG + Intergenic
900905436 1:5553927-5553949 ATCATGAGAACAGCAGCATGGGG + Intergenic
901443956 1:9295620-9295642 TTCACCAGAGCTGGGGAATGGGG + Intronic
902834014 1:19035212-19035234 AACCCCAGAACCTCAGAATGTGG + Intergenic
904467365 1:30716309-30716331 ACCACCACCACTGCAGACTGTGG + Exonic
905001885 1:34679108-34679130 ATCACAAGAACAGCACTATGGGG + Intergenic
905780012 1:40700564-40700586 ATCACTTGAACTGAAGAATTTGG - Intronic
906833372 1:49058321-49058343 ATCACAAGAACAGCAGCATGGGG - Intronic
908032485 1:60016083-60016105 ATCCCCAGTACTTCAGAATATGG - Intronic
908118553 1:60964656-60964678 ATCACAATAACAGCAGCATGGGG + Intronic
908118915 1:60967280-60967302 ATCACAAGAACAGCAGCATGTGG + Intronic
908211728 1:61907000-61907022 ATCACAAGAACAGCAGAATGGGG - Intronic
908379835 1:63586575-63586597 ATCACAAGAACAGCAGCATGGGG + Intronic
908541793 1:65129271-65129293 ATCACAAGAACAGCAGCATGGGG + Intergenic
908564060 1:65336287-65336309 ATCACGAGAACAGGAGCATGGGG + Intronic
908763241 1:67531477-67531499 ATCATGAGAACAGCAGCATGGGG + Intergenic
908963704 1:69731334-69731356 ATTACAAGAACAGCAGCATGTGG + Intronic
909200457 1:72685397-72685419 GTCACGAGAACAGCAGCATGAGG - Intergenic
909568013 1:77077374-77077396 ATCATGAGAACAGCAGCATGGGG + Intergenic
909698552 1:78493966-78493988 ATGACCAGAACTGCAAAGGGTGG + Intronic
909768386 1:79387448-79387470 ATCACCAGAGAAACAGAATGTGG + Intergenic
909810102 1:79923133-79923155 ATCATAAGAACAGCAGCATGGGG - Intergenic
910129734 1:83889255-83889277 ATCAAGAGAACAGCAGCATGGGG + Intronic
910227885 1:84955057-84955079 ATCACAAGAACAGCAGCATGGGG - Intronic
910708275 1:90153068-90153090 ATCACAAGAACAGCAGCATGGGG + Intergenic
911011650 1:93287434-93287456 ATCACGAGGACAGCAGCATGGGG - Intergenic
911372878 1:97015046-97015068 ATCCCCAGTACTTCAGAGTGTGG - Intergenic
911438080 1:97887822-97887844 ATCATGAGAACAGCAGCATGGGG - Intronic
912267454 1:108173295-108173317 ATCATGAGAACAGCAGCATGGGG - Intronic
912267728 1:108175242-108175264 ATCATGAGAACATCAGAATGAGG - Intronic
912394434 1:109329721-109329743 ATTAACAGAACTGAAGAAAGAGG + Intronic
912668087 1:111601043-111601065 CTCTCCATAACAGCAGAATGTGG + Intronic
913034714 1:114952646-114952668 GTCACGAGAACAGCAGCATGGGG + Intronic
913481015 1:119289233-119289255 ATCACGAGAACAGCAGCATGAGG - Intergenic
914323843 1:146591811-146591833 CTCACCAGAACTGTAGGAAGTGG - Intergenic
915020114 1:152771291-152771313 ATCACGAGAACAGCAGCATGGGG + Intronic
915777349 1:158504554-158504576 ATCACAAGAACAGCACAAAGGGG + Intergenic
915856118 1:159387919-159387941 ATCACAAGAACAGCAGCATGGGG - Intergenic
917690742 1:177465859-177465881 ATCATGAGAACAGCAGCATGGGG + Intergenic
918506755 1:185263194-185263216 ACCTCCAGTACTGCAGAATGTGG - Intronic
920544785 1:206807154-206807176 ATTACGAGAACAGCAGCATGGGG + Intronic
920725045 1:208427181-208427203 ATCCCCAGTACTGCGGAATGTGG + Intergenic
921813555 1:219541836-219541858 ATTTCCAGAGCTGCACAATGTGG + Intergenic
923808847 1:237289578-237289600 ATCACAAGAACAGCAGCATGGGG + Intronic
923865504 1:237934823-237934845 ATCATGAGAACAGCAGCATGGGG + Intergenic
924583977 1:245345658-245345680 ATCACGAGAACAGCAGCAAGGGG - Intronic
1063712230 10:8490719-8490741 ATCATGAGAACAGCAGCATGGGG - Intergenic
1064129918 10:12700412-12700434 ATCATGAGAACAGCAGCATGGGG + Intronic
1064339875 10:14476289-14476311 ATCACGACAACTGCGGAATTAGG + Intergenic
1064386970 10:14903996-14904018 TTAACCAAAATTGCAGAATGGGG + Intronic
1064543257 10:16426433-16426455 ATCACGAGAACGGCAGCATGGGG + Intergenic
1065263151 10:23946951-23946973 ATCATGAGAACAGCAGCATGGGG - Intronic
1066260375 10:33724053-33724075 ATCATGAGAACAGCAGCATGGGG + Intergenic
1067424487 10:46194844-46194866 ATCACAAGAACAGCAGCATGGGG + Intergenic
1067900556 10:50236405-50236427 ATCATGAGAACAGCAGCATGGGG + Intronic
1068377247 10:56196831-56196853 ATCATGAGAACAGCAGCATGAGG - Intergenic
1069211970 10:65773054-65773076 ATCACAAGAACAGCAGCATGGGG + Intergenic
1069339729 10:67396806-67396828 ATCACAATAACAGCAGCATGGGG - Intronic
1069753243 10:70758178-70758200 ATCACCAGAACTCCACGGTGAGG + Exonic
1070507249 10:77125048-77125070 ATCACGAGAACAGCAGCATGGGG + Intronic
1070548760 10:77474261-77474283 ATCCCCAGGACCTCAGAATGTGG + Intronic
1071025810 10:81111718-81111740 ATCATGAGAACAGCAGCATGGGG + Intergenic
1071395727 10:85221936-85221958 ATCACAAGAATAGCAGCATGGGG - Intergenic
1071643287 10:87337499-87337521 ATCACAAGAACAGCAGCGTGGGG - Intergenic
1071709421 10:88035055-88035077 AGCACCAGAAAAGCAGGATGAGG - Intergenic
1072094883 10:92168587-92168609 ATCACGAGAACAGCAGCATGGGG - Intronic
1075449024 10:122534868-122534890 ATGACCGTGACTGCAGAATGTGG + Intergenic
1075825710 10:125355816-125355838 AGCCCCAGAGCTGCAGACTGAGG + Intergenic
1075964946 10:126603371-126603393 ATCACAAGAAGAGCAGCATGGGG + Intronic
1076085558 10:127627066-127627088 ATCTTCAGATCTGCTGAATGAGG - Intergenic
1076195391 10:128513957-128513979 ATCATGAGAACAGCAGCATGGGG + Intergenic
1076228921 10:128803813-128803835 ACCACCAGAATGGCAGAATGGGG - Intergenic
1076658372 10:132039083-132039105 ATCACCAGAACTAAGGAGTGTGG + Intergenic
1076696378 10:132249268-132249290 ATCACAGGCACTGCAGAGTGGGG - Intronic
1076743553 10:132500369-132500391 ATCATGAGAACAGCAGCATGAGG - Intergenic
1077796858 11:5501289-5501311 ATCACCAGTAGGGCAGAATCAGG - Intronic
1078036226 11:7807971-7807993 ATCATGAGAACAGCAGCATGGGG + Intergenic
1078104220 11:8348466-8348488 ATCAGGAGAACAGCAGCATGAGG + Intergenic
1078424458 11:11238040-11238062 ATCACGAGAACAGCAGCATGGGG - Intergenic
1078738108 11:14040173-14040195 ATCACAAGTACAGCAGCATGAGG + Intronic
1079466435 11:20735489-20735511 ATCATGAGAACAGCAGCATGGGG + Intronic
1079519868 11:21313917-21313939 ATCACAAGAACAGCACAAAGTGG - Intronic
1080194665 11:29595239-29595261 ATCATGAGAACAGCAGCATGGGG - Intergenic
1080290417 11:30664758-30664780 ATCATAAGAACAGCAGCATGGGG + Intergenic
1080293712 11:30700955-30700977 ATCACGAGAACAGCAGCATGAGG + Intergenic
1080972550 11:37295699-37295721 ATCACAAAAACTGTAGCATGGGG - Intergenic
1082759708 11:57115475-57115497 ATCATGAGAACAGCAGCATGGGG - Intergenic
1082927463 11:58565063-58565085 ATCACCAAACGTTCAGAATGGGG + Intronic
1084390863 11:68875831-68875853 ATCATGAGAACAGCAGCATGGGG - Intergenic
1084405163 11:68967872-68967894 CTCACCAGAATCTCAGAATGTGG - Intergenic
1084417243 11:69040052-69040074 ACCACAAGAACAGCAGCATGGGG + Intergenic
1084954737 11:72685260-72685282 AACTCCAGAACAGCAGAAAGCGG - Exonic
1085758851 11:79224541-79224563 ACCCCCAGTACTGCAGAGTGGGG + Intronic
1088013396 11:105031055-105031077 TTCTCCAGAACTGCTCAATGAGG + Intronic
1088482913 11:110312457-110312479 ATCATGAGAACAGCAGTATGGGG + Intergenic
1089534350 11:119151361-119151383 ATGGCCAGTACAGCAGAATGAGG - Intronic
1090321428 11:125847052-125847074 ATCACAAGAACACCAGCATGGGG + Intergenic
1090935521 11:131338493-131338515 ATCACAAAAACAGCAGCATGGGG + Intergenic
1095308042 12:40661552-40661574 ATCACGAGAAGAGCAGCATGGGG - Intergenic
1095417584 12:41993425-41993447 ATCATGAGAACAGCAGCATGGGG + Intergenic
1095821057 12:46478940-46478962 ATCATGAGAACAGCAGCATGGGG + Intergenic
1096144120 12:49265758-49265780 AACACCAGAAATGCAGGATTAGG - Intronic
1096969046 12:55650848-55650870 ATCATGAGAACAGCAGCATGGGG - Intergenic
1098630539 12:72716534-72716556 ATTACCAAAACTTCAGAAAGTGG + Intergenic
1098713560 12:73800317-73800339 ATCATGAGAACAGCAGCATGGGG - Intergenic
1099214452 12:79837655-79837677 ATCACAAGAACAGTAGCATGGGG - Intronic
1099218154 12:79878756-79878778 ATCATGAGAACAGCAGCATGGGG + Intronic
1099520505 12:83654766-83654788 ATCATGAGAACAGCAGCATGGGG + Intergenic
1099566000 12:84246921-84246943 ATTACAAGAACAGCAGCATGGGG - Intergenic
1100339992 12:93669786-93669808 ATCATGAGAACAGCAGCATGGGG + Intergenic
1100639233 12:96465474-96465496 ATCCCTAGACCTGAAGAATGTGG - Intergenic
1101511642 12:105398461-105398483 ATCACAAGAACAGCAGCATGGGG - Intergenic
1103005746 12:117418715-117418737 ATCATGAGAACAGCAGCATGGGG - Intronic
1104297480 12:127530140-127530162 ATCACCAGAACAGCACCATGGGG + Intergenic
1104389412 12:128378867-128378889 ATCACAAGAACAGCAGCATGGGG - Intronic
1104416451 12:128599915-128599937 GTCACGAGAACAGCAGCATGGGG - Intronic
1104535760 12:129616569-129616591 ATCACAAGAATAGCAGCATGGGG - Intronic
1104566220 12:129886813-129886835 ATCAGGAGAACAGCAGCATGGGG - Intronic
1104584848 12:130039721-130039743 ATCACAAGAAAAGCAGCATGGGG + Intergenic
1104741924 12:131184024-131184046 ATCATGAGAACAGCAGCATGAGG + Intergenic
1104742151 12:131185508-131185530 ATCATGAGAACAGCAGCATGGGG + Intergenic
1105423150 13:20271080-20271102 ATCACCATAACAGGAGGATGAGG + Intergenic
1105753044 13:23439645-23439667 ATCACGAGAGCAGCAGCATGGGG - Intergenic
1106882124 13:34143204-34143226 CTCCCCAGCACTTCAGAATGTGG + Intergenic
1107015989 13:35707968-35707990 ATCACAAGAACAGCAGCATGGGG - Intergenic
1107066564 13:36219762-36219784 ATCATGAGAACAGCAGCATGGGG - Intronic
1107153515 13:37139945-37139967 ATCCCCAGTACTTCAGAATGTGG - Intergenic
1109132217 13:58601723-58601745 ATCATGAGAACAGCAGCATGGGG + Intergenic
1110454856 13:75679869-75679891 ATCACCAGGACTGCAGGGTGTGG - Intronic
1111505347 13:89182921-89182943 ATCACAAGAACATCAGCATGGGG + Intergenic
1111561891 13:89962121-89962143 ATCACCAGCACTGCATAGTTAGG + Intergenic
1111741988 13:92216480-92216502 ATCACCACATCTGGACAATGAGG - Intronic
1111893990 13:94118219-94118241 ATCACGAGAACAGCAGCATGTGG - Intronic
1111919790 13:94397922-94397944 ATCATGAGAACAGCAGCATGGGG - Intronic
1112142957 13:96666222-96666244 ATCACAAGAACAACAGCATGGGG + Intronic
1112700733 13:102004770-102004792 ATCATGAGAACAGCAGCATGGGG - Intronic
1112858952 13:103807331-103807353 ATCATGAGAACTGCAGCATGGGG - Intergenic
1112897286 13:104315305-104315327 ATCACAAGAACAGCAGCATGGGG + Intergenic
1113225770 13:108158373-108158395 ATCATGAGAACAGCAGCATGGGG + Intergenic
1113522341 13:110949805-110949827 CTCACGAGAACAGCAGCATGGGG - Intergenic
1114680345 14:24479103-24479125 TTCACAAGAACAGCAGCATGGGG + Intergenic
1115030464 14:28787235-28787257 AGAACAAGAACTGCCGAATGAGG - Intronic
1115051998 14:29073763-29073785 AACACTAGAACAGCAGCATGGGG + Intergenic
1115143334 14:30198993-30199015 ATCATGAGAACAGCAGCATGGGG + Intergenic
1115863218 14:37712720-37712742 ATCACGAGAACAGCACTATGGGG + Intronic
1116415392 14:44671946-44671968 ATCACAAGAACAGCAGCATGTGG + Intergenic
1116542120 14:46111797-46111819 ATCACAAGAACAGCAGGATGGGG - Intergenic
1116551577 14:46246467-46246489 ATCATGAGAACAGCAGCATGGGG + Intergenic
1116599054 14:46895226-46895248 ATCACGAGAACAGCAGTATGGGG - Intronic
1116701246 14:48245669-48245691 CTCACCATATATGCAGAATGGGG + Intergenic
1116707281 14:48318230-48318252 ATTACCAAAACTGCAGACTCAGG + Intergenic
1116784324 14:49270360-49270382 ATCATGAGAACAGCAGCATGGGG - Intergenic
1116941010 14:50790618-50790640 ATCAGCAGAACTGCAAATAGAGG - Intronic
1117229114 14:53697125-53697147 ATCACAAGAACAGCAGCATGGGG + Intergenic
1118124389 14:62884073-62884095 ACCACCAGTACTGCAGAAATGGG + Intronic
1118302294 14:64626361-64626383 ATCACAGGAACAGCAGCATGGGG - Intergenic
1118925257 14:70186111-70186133 GTCACAAGAACAGCAGCATGGGG - Intronic
1119018963 14:71089644-71089666 ATCATGAGAACAGCAGCATGGGG + Intronic
1119188094 14:72658945-72658967 ATCACCAACACTGAAAAATGGGG + Intronic
1119278969 14:73387296-73387318 ATCATGAGAACAGCAGCATGGGG - Intronic
1119822068 14:77625200-77625222 ACCACCTGAAATGCAGAATATGG - Intergenic
1120129831 14:80793083-80793105 AACACGTGAACTGGAGAATGGGG - Exonic
1120213031 14:81653090-81653112 ATCACAAGAACAGCAGCATGGGG - Intergenic
1120377908 14:83732985-83733007 ATCACGAGAACAGCAGTATGGGG - Intergenic
1120417599 14:84239750-84239772 ATCACAAGAACAGCAGCATGGGG - Intergenic
1120481556 14:85055267-85055289 ATCACAAGAATGGCAGCATGGGG + Intergenic
1120843439 14:89106647-89106669 ATCATGAGAACAGCAGCATGGGG - Intergenic
1121294980 14:92813010-92813032 TTGACCAGAACAGAAGAATGAGG - Intronic
1121580021 14:95023208-95023230 ATCACCAGAACAGCACTACGGGG + Intergenic
1121653836 14:95580629-95580651 ATCATGAGAACAGCAGCATGGGG + Intergenic
1121715517 14:96071265-96071287 ATCACGAGAACAGCAGCATGGGG + Intronic
1121813115 14:96908790-96908812 ATCACCAGAACAGCACAAAAGGG + Intronic
1121885523 14:97539240-97539262 ATCATGAGAACAGCAGCATGGGG - Intergenic
1121990065 14:98548591-98548613 ATCATGAGAACAGCAGCATGTGG - Intergenic
1122054668 14:99086112-99086134 ACCACAAGAACAGCAGTATGGGG - Intergenic
1122150599 14:99724193-99724215 ATCCCCAGTACCTCAGAATGCGG - Intronic
1123669467 15:22640472-22640494 ATCACGAGAGCAGCAGCATGGGG - Intergenic
1123919063 15:25057784-25057806 CTCACAAGAGCTGCAGCATGTGG - Intergenic
1124525442 15:30446912-30446934 ATCACGAGAGCAGCAGCATGGGG - Intergenic
1124773212 15:32560772-32560794 ATCACGAGAGCAGCAGCATGGGG + Intergenic
1125393925 15:39226573-39226595 ATCATGAGAACAGCAGCATGGGG - Intergenic
1126733568 15:51709244-51709266 ATCACAAGAACAGCAGCATGGGG + Intronic
1127245108 15:57164512-57164534 ATCATAAGAACAGCAGCATGGGG + Intronic
1127310099 15:57744857-57744879 TTCACCACATCTGCAGAATGGGG - Intronic
1127345833 15:58096986-58097008 ATCACAAGAACAGCAGCATGAGG + Intronic
1127688707 15:61373626-61373648 ATGCCCAGAACTGCTGAAAGTGG - Intergenic
1127810265 15:62559746-62559768 ATCACCAGAACTGGGGACTGAGG + Intronic
1128814342 15:70596430-70596452 ATCACCACAACTGCACTATGAGG + Intergenic
1128884679 15:71275735-71275757 ATCACGAGAACAGCAGCAAGGGG - Intronic
1130829011 15:87580761-87580783 AGCACTAGAACTGCATAATAAGG + Intergenic
1131904999 15:97133525-97133547 ATCATGAGAACAGCAGCATGGGG - Intergenic
1132017710 15:98333399-98333421 ATCACCAGGACTGGGTAATGAGG + Intergenic
1132996291 16:2825217-2825239 ATCACGAGAACAGCAGCATAGGG + Intronic
1133340993 16:5035828-5035850 AGCACCAGAAGTGCTGACTGTGG - Intronic
1134356248 16:13484832-13484854 ATCACAAGAACAGCAGCAAGGGG + Intergenic
1134424838 16:14130913-14130935 ATCACAAGAACGGCAGCATGGGG + Intronic
1134660841 16:15983314-15983336 ATCCCCACAACTGCAGCTTGTGG - Intronic
1134874612 16:17686568-17686590 ACCACCAGAACCCAAGAATGAGG + Intergenic
1137577109 16:49607480-49607502 ATCACCAAAACTGAAGAAGCTGG + Intronic
1138212584 16:55175763-55175785 ATGATCAGAACTGCAGATTCAGG + Intergenic
1140009720 16:71119033-71119055 CTCACCAGAACTGTAGGAAGTGG + Intronic
1140610714 16:76595743-76595765 AACAATAGAACTGCAAAATGTGG - Intronic
1141019692 16:80483714-80483736 ATCACAAGAACAGCAGCATGGGG + Intergenic
1141235747 16:82214447-82214469 ATCACAAGAACAGCGGTATGGGG - Intergenic
1141239953 16:82256575-82256597 ATCACAAGAACAGCAGTATGGGG + Intergenic
1142617578 17:1145472-1145494 AGCCCCAGAGCTGCAGAAGGCGG + Intronic
1143048855 17:4105492-4105514 ATCACCTGACCTGAAGAATTGGG - Intronic
1144399800 17:14885015-14885037 CTCACGAGAACAGCAGCATGAGG + Intergenic
1145408881 17:22637875-22637897 ACCACAAGAACAGCAGCATGGGG - Intergenic
1146546132 17:33740484-33740506 ATCATGAGAACAGCAGCATGGGG + Intronic
1151485900 17:74399666-74399688 ATCATGAGAACAGCAGCATGGGG - Intergenic
1153845856 18:9049290-9049312 ATCACCAGAACTGCAAGAAGTGG + Intergenic
1154986086 18:21552372-21552394 GTCACAAGAACAGCAGCATGGGG - Intronic
1155400413 18:25432813-25432835 ATCACGAGAACAGCAGCATGGGG - Intergenic
1155555899 18:27019080-27019102 TTCACAAGCACTGCAGATTGCGG - Intronic
1155774816 18:29747511-29747533 ACCTCCAGCACAGCAGAATGAGG + Intergenic
1156013580 18:32522410-32522432 ATCCCCAGTACCTCAGAATGTGG - Intergenic
1156067227 18:33158611-33158633 ATTCACAGAATTGCAGAATGTGG + Intronic
1156554759 18:38054623-38054645 CTCCCAAGAAATGCAGAATGAGG - Intergenic
1156721017 18:40070275-40070297 ATCACAAGAACAGCAGCATGGGG - Intergenic
1156796505 18:41052726-41052748 ATCACGAGAACAGCAGCATGGGG - Intergenic
1157216152 18:45785405-45785427 ATCAGAAGAACTGCAGGATGTGG + Intergenic
1158299382 18:56034447-56034469 ATCAGGAGAACAGCAGCATGGGG + Intergenic
1158322598 18:56279935-56279957 ATCATGAGAACAGCAGCATGGGG - Intergenic
1159304719 18:66626068-66626090 ATCATGAGAACAGCAGCATGGGG - Intergenic
1159338124 18:67097902-67097924 ATCACGAGAACAGCAGCATGGGG - Intergenic
1159611581 18:70531613-70531635 ATCACGAGAACAGCAGCGTGGGG - Intergenic
1159763866 18:72461611-72461633 ATCATGAGAACAGCAGCATGGGG + Intergenic
1161007608 19:1944347-1944369 CCCACGAGAACTCCAGAATGAGG - Intronic
1163066209 19:14797872-14797894 ACCGCCAAAACTTCAGAATGTGG + Intronic
1164404212 19:27928174-27928196 ATCACCAGTAGTGCAGAAAGAGG + Intergenic
1165401872 19:35606211-35606233 ATCTCAAGAACAGCAGCATGGGG + Intergenic
1168322817 19:55520490-55520512 AAGCCCAGATCTGCAGAATGGGG - Intergenic
925316371 2:2929179-2929201 ATCATGAGAACAGCAGCATGGGG - Intergenic
926327520 2:11797999-11798021 ATCACGAGAACAGCGGCATGGGG - Intronic
926459531 2:13111523-13111545 ATCACGAGGACAGCAGCATGGGG - Intergenic
927194665 2:20539252-20539274 ATCTCCTGATCTGCAAAATGGGG - Intergenic
927356380 2:22178064-22178086 ATCATGAGAACAGCAGCATGGGG + Intergenic
927899038 2:26805790-26805812 ATCATGAGAACAGCAGCATGGGG + Intergenic
928012223 2:27620415-27620437 ATCAGCAAAATTCCAGAATGTGG - Intronic
928044193 2:27910967-27910989 ATCACAAGAACAGCAGCACGGGG - Intronic
928257454 2:29735678-29735700 ATCATGAGAACAGCAGCATGGGG - Intronic
928396464 2:30946382-30946404 ATCACCAGAACAGCACCAAGGGG - Intronic
928416907 2:31101856-31101878 GTCACAAGAACAGCAGCATGGGG - Intronic
929118163 2:38462283-38462305 AGCAACAGAACTGGAGACTGAGG - Intergenic
929211405 2:39360800-39360822 ATCACGAGAACAGCAGCAGGGGG + Intronic
930294080 2:49531273-49531295 ATCACAAGAACAGCAGAGGGGGG + Intergenic
930514746 2:52392904-52392926 ATCATGAGAACAGCAGCATGAGG + Intergenic
930634652 2:53790617-53790639 AGCACCAAAACTGTAAAATGGGG + Intronic
930985251 2:57578317-57578339 ATCTCCAGTACTCCAGAATGTGG + Intergenic
931986984 2:67751609-67751631 ATCACCAGAACTGCAGAGCAGGG + Intergenic
934019521 2:87931661-87931683 ATCACAAGAAGAGCAGCATGGGG - Intergenic
934718891 2:96559193-96559215 ACCCCCAGCACTTCAGAATGTGG + Intergenic
934887907 2:98040783-98040805 TTCATCAGAACCCCAGAATGTGG - Intergenic
935149449 2:100420599-100420621 ATCAGGAGAACAGCAGCATGGGG - Intergenic
935323178 2:101908118-101908140 ATCACAAGAACAGCAGCATGGGG + Intergenic
936598434 2:113872216-113872238 ATCCCCAGTACCTCAGAATGTGG + Intergenic
936699137 2:114988888-114988910 TTCACCATCAATGCAGAATGAGG - Intronic
936909574 2:117576271-117576293 ATCACAAGATCAGCAGCATGGGG + Intergenic
938589844 2:132725963-132725985 ATTACCAGAGCTGCAGAAATAGG + Intronic
940022718 2:149172231-149172253 ATCACAAGAATAGCAGCATGGGG + Intronic
940301897 2:152184354-152184376 CTCACCAAAACTGGAGACTGGGG - Intergenic
940485119 2:154288221-154288243 ATCACAAGAACAGCAGCATGGGG + Intronic
940533242 2:154905950-154905972 ATCACAAGAACAGCAGCATGGGG + Intergenic
940561741 2:155305557-155305579 ATCACAAGAACTGCAGCATGAGG - Intergenic
941387118 2:164867206-164867228 AGCTCCAAAACTGCAGAATTTGG - Intergenic
941607792 2:167621706-167621728 ATCACGAGAACAGCAGCATGGGG - Intergenic
942250324 2:174042140-174042162 ATCACGAGAACAGCAGCATGGGG + Intergenic
943372243 2:187029173-187029195 ATCATCAGAAGAGCAGCATGGGG - Intergenic
943699418 2:190973555-190973577 ATCACAGGAACTGTAAAATGGGG - Intronic
943991274 2:194695832-194695854 ATCAAGAGAACAGCAGCATGGGG - Intergenic
944303803 2:198156596-198156618 ATCCCAAGAACAGCAGCATGGGG - Intronic
945456203 2:210055115-210055137 TTCACAAGAACAGCAGCATGGGG - Intronic
945730126 2:213523162-213523184 ATCACGAGAACAGCAGCATCAGG - Intronic
946447729 2:219754156-219754178 ATCATAAGAACAGCAGCATGGGG - Intergenic
946476917 2:220015925-220015947 ATCACAAGAACAGCAGCATGGGG - Intergenic
946584206 2:221165842-221165864 ATCACAAGAACAGCAGCCTGAGG - Intergenic
946797640 2:223372608-223372630 GTCACAAGAACAGCAGCATGGGG - Intergenic
946884208 2:224206789-224206811 ATCAGGAGAACAGCAGCATGAGG - Intergenic
946970395 2:225084489-225084511 ATCACCAGAACAGCAACATAGGG - Intergenic
947255619 2:228160553-228160575 ATCATGAGAACAGCAGCATGGGG + Intronic
947389242 2:229622608-229622630 ATCCCCAGTACCTCAGAATGTGG + Intronic
947396546 2:229693131-229693153 ATCATGAGAACAGCAGCATGGGG - Intronic
948328476 2:237145725-237145747 ATTTCCAGAATGGCAGAATGAGG + Intergenic
948611115 2:239167606-239167628 ATAACCAGAAGTGCAGAAACGGG - Intronic
1169522298 20:6386818-6386840 ATCACGAGAACAGCAGCATGGGG - Intergenic
1169823386 20:9739490-9739512 ATCACCAGAAATTCAGAAACAGG + Intronic
1169904477 20:10587725-10587747 AGCACCAAAAATGCAAAATGGGG + Intronic
1170241078 20:14166992-14167014 AAAACCAGAAATGCAGAGTGGGG - Intronic
1170444575 20:16412659-16412681 ATCACAAGAACAGCAGAATGGGG + Intronic
1171121608 20:22573278-22573300 TTCACCAGAACTCCAGAATCTGG - Intergenic
1172606084 20:36215017-36215039 CTCTTAAGAACTGCAGAATGGGG - Intronic
1172914967 20:38436505-38436527 ATCAGAAGAACCGCAGCATGGGG - Intergenic
1173056856 20:39622896-39622918 ATCACGAGAACAGCATGATGGGG - Intergenic
1174734500 20:52952783-52952805 ATCATGAGAACAGCAGCATGGGG + Intergenic
1174992516 20:55526972-55526994 ATCACGAGAACAGCAGCATGGGG - Intergenic
1175303477 20:57959633-57959655 CTCCCCAGAACCTCAGAATGTGG + Intergenic
1176888440 21:14284633-14284655 ATCATGAGAACGGCAGCATGGGG + Intergenic
1177177768 21:17718329-17718351 ATCACAAGAACAGCAGCATGGGG + Intergenic
1177425102 21:20912640-20912662 ATCACCAGAACAGCACTAAGGGG + Intergenic
1177539359 21:22471608-22471630 ATCACGAGAACGGCAGCATGGGG - Intergenic
1178147216 21:29754028-29754050 ATTACCAAAACTGCAGTATGCGG + Intronic
1178311997 21:31537217-31537239 GTCACTGGAACTTCAGAATGTGG - Intronic
1178341083 21:31785726-31785748 ATCACGAGAACAGCAGCATGGGG + Intergenic
1178348555 21:31852741-31852763 ATCATGAGAACAGCAGCATGGGG - Intergenic
1179175584 21:39005583-39005605 CTAACCAGAACCTCAGAATGTGG - Intergenic
1179339100 21:40487607-40487629 ATCAGCATAACTGCAGGGTGGGG + Intronic
1180027918 21:45178899-45178921 AGCACCAGACCTTCAGAGTGAGG + Intronic
1180856095 22:19046627-19046649 ATCACCAAAACTGGAGACTCTGG - Intronic
1180902660 22:19385893-19385915 ATCAACAGAGCTGTCGAATGAGG - Intronic
1184306203 22:43603948-43603970 ATCACGAGAACAGCACAATGAGG - Intronic
1184587755 22:45459301-45459323 ATCACCAGAACCTCAGAATGTGG - Intergenic
949201282 3:1382947-1382969 TCCAGAAGAACTGCAGAATGGGG + Exonic
949383920 3:3478594-3478616 ATCATCACACCTGCAGCATGAGG - Intergenic
950444550 3:13028796-13028818 ATCTCCAACACTGAAGAATGAGG - Intronic
950823499 3:15789331-15789353 TTCACCAGCAAAGCAGAATGGGG - Intronic
950990840 3:17435555-17435577 ATCACAAGAACAGCAGCATGGGG + Intronic
951457698 3:22911012-22911034 ATCACGAGAACAGCACAAAGGGG - Intergenic
951969907 3:28432027-28432049 ATCACAAGAACAGCAGCATTGGG + Intronic
952624750 3:35391339-35391361 ATCATGAGAACAGCAGCATGGGG + Intergenic
952805962 3:37352395-37352417 ATCACAAGAACAGCAGCATGGGG + Intronic
953820089 3:46200593-46200615 ATCCTCAGAACAGCAGCATGAGG + Intronic
955671208 3:61405093-61405115 ATCATGAGAACAGCAGCATGGGG + Intergenic
956201052 3:66706291-66706313 ATCAGGAGAACAGCAGCATGGGG + Intergenic
956346224 3:68282129-68282151 ATTACAAGAACAGCAGCATGGGG + Intronic
956571934 3:70706190-70706212 ATCACAAGAACAGCAGCATGGGG + Intergenic
956690089 3:71869123-71869145 ATCATGAGAACAGCAGCATGGGG - Intergenic
956884023 3:73540545-73540567 ATCACAAGAACAGCAGCATGAGG - Intronic
956929770 3:74029609-74029631 ATGCTCAGCACTGCAGAATGTGG - Intergenic
957243415 3:77688121-77688143 GTCCCCAGAACTGTAAAATGGGG + Intergenic
957263719 3:77933373-77933395 ATAACAACAACTGCAGAGTGTGG + Intergenic
957323801 3:78666024-78666046 ATCACGAGAACAGCAGCACGGGG - Intronic
957777258 3:84769269-84769291 ATCATGAGAACAGCAGCATGGGG - Intergenic
958710359 3:97709753-97709775 ATCACAAGAAGTGAAGCATGGGG - Intronic
958835020 3:99135030-99135052 ATGATCAGAACTACAAAATGTGG - Intergenic
959084413 3:101835723-101835745 ACCCCCAGTACCGCAGAATGTGG - Intronic
959492086 3:107002222-107002244 ATCACAAGAAGAGCAGCATGGGG + Intergenic
959856277 3:111162368-111162390 ACCACAAGAACAGCAGCATGGGG - Intronic
959860992 3:111214848-111214870 ATCACAAGAACAGCAGCATGGGG - Intronic
960858148 3:122123777-122123799 ATCATGAGAACAGCAGCATGGGG - Intergenic
960928563 3:122821009-122821031 ATCACAAGAACAGCAGCATGGGG - Intronic
961577999 3:127854198-127854220 ATCACCAAAAATGCAGAGTGGGG - Intergenic
962078315 3:132109264-132109286 ATCATGAGAACAGCAGCATGGGG - Intronic
962362418 3:134753431-134753453 GTCACAAGACCTGCAGCATGTGG - Intronic
963710620 3:148743845-148743867 ATCACCATAACCTCAGAATGGGG + Intergenic
963898146 3:150707615-150707637 ATCATAAGAACAGCAGCATGGGG + Intergenic
965245482 3:166261612-166261634 ATCATGAGAACAGCAGCATGGGG + Intergenic
965319872 3:167240023-167240045 ATCACGAGAACAGCAGCATAGGG + Intergenic
965596170 3:170413540-170413562 ATCACCGAAACTGTTGAATGTGG - Intergenic
966463820 3:180206303-180206325 ATCATGAGAACAGCAGCATGAGG - Intergenic
966948099 3:184791703-184791725 ATCACCAGCACAGCAGAGTGAGG - Intergenic
967683858 3:192397189-192397211 GAAACCAGAGCTGCAGAATGTGG + Intronic
969460521 4:7326544-7326566 ATCACCTGAACTGAACATTGGGG + Intronic
970815413 4:20150535-20150557 ATCAGGAGAACAGCAGCATGAGG + Intergenic
971069835 4:23079309-23079331 ATCACAAGAACAGCAGCATGGGG + Intergenic
971083962 4:23248513-23248535 AACACCAGTCCTTCAGAATGAGG + Intergenic
971290981 4:25339231-25339253 ATCACCAGTACTTCAGAATGTGG - Intronic
971744717 4:30565341-30565363 ATCACGAGAACAGCAGGATGGGG - Intergenic
972180393 4:36457764-36457786 ATCATGAGAACAGCAGCATGAGG + Intergenic
972336741 4:38113613-38113635 ATCAGCAGAAATGCAGAAGTGGG + Intronic
972748749 4:41968000-41968022 ATCACAAGAACAGCAGCATGAGG - Intergenic
973223762 4:47758705-47758727 ATCACAAGAACAGCAACATGGGG - Intronic
973267060 4:48221317-48221339 ATCAGGAGAACAGCAGCATGGGG - Intronic
974334679 4:60526559-60526581 ATCACGAGAATAGCAGCATGGGG - Intergenic
974763260 4:66306972-66306994 ATCATGAGAACAGCAGCATGGGG - Intergenic
975307230 4:72864317-72864339 ATCATCAGAACAGCAGCATGGGG - Intergenic
976090451 4:81451939-81451961 ATGAGCAGAACCGCTGAATGGGG + Intronic
976545490 4:86330525-86330547 ATCATGAGAACAGCAGCATGGGG - Intronic
976851992 4:89558423-89558445 ATCACAAGAACAGCATAGTGGGG + Intergenic
977127899 4:93193398-93193420 ATCATGAGAACAGCAGCATGGGG - Intronic
977669395 4:99678446-99678468 TTCACCAGAACTGGAGCATTAGG - Intergenic
978902106 4:113963496-113963518 ATCATGAGAACAGCAGCATGGGG + Intronic
978952337 4:114575939-114575961 ATCATGAGAACAGCAGCATGAGG + Intergenic
979073800 4:116244683-116244705 ATCATGAGAACAGCAGCATGGGG - Intergenic
979509049 4:121530829-121530851 ATCACAAGAACAGCAGCATGGGG - Intergenic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
979984257 4:127295270-127295292 ATCATAAGAACAGCAGCATGAGG + Intergenic
979990791 4:127372920-127372942 ATCACAAGAACAGCAGTATGGGG - Intergenic
980006721 4:127551321-127551343 ATCATGAGAACAGCAGCATGGGG - Intergenic
981239824 4:142463694-142463716 ATCACCAGAACAGCAGCACTGGG - Intronic
981521438 4:145666622-145666644 ATCATGAGAACAGCAGCATGGGG + Intergenic
982252337 4:153419913-153419935 ATCCCGAGAACAGCAGCATGGGG + Intergenic
982816933 4:159897364-159897386 ATCACGAGAACAGCAGCATGGGG - Intergenic
983105504 4:163681555-163681577 ATCATGAGAACAGCAGCATGGGG - Intronic
983319994 4:166184446-166184468 ATCACGAGAACAGCAGCGTGGGG - Intergenic
984106568 4:175555349-175555371 TTCACAAGAACAGCAGTATGGGG - Intergenic
984436272 4:179713939-179713961 ATCACCAGAACTGCACCAATGGG - Intergenic
984576314 4:181452433-181452455 ATCATGAGAACAGCAGCATGGGG - Intergenic
987155433 5:15084432-15084454 ATCACCAGAAAAGCACCATGTGG - Intergenic
987226497 5:15847380-15847402 ATCACAAGAACAGCAGCATGAGG + Intronic
988484906 5:31660613-31660635 ATCATGAGAACAGCAGCATGGGG + Intronic
988871389 5:35394190-35394212 GTCACAAGAACAGCAGCATGAGG + Intergenic
989125946 5:38052474-38052496 ATCCCCAGTACCTCAGAATGTGG - Intergenic
989218454 5:38928564-38928586 ATCACAAGAACAGCAGCATGGGG + Intronic
989249681 5:39296225-39296247 AACACGTGACCTGCAGAATGGGG + Intronic
989726723 5:44596523-44596545 ATCATGAGAACAGCAGCATGGGG + Intergenic
989726994 5:44598434-44598456 ATCACAAGAAGAGCAGCATGAGG + Intergenic
989781490 5:45270292-45270314 ATTATCAGAACTGCATCATGTGG + Intronic
989786942 5:45344204-45344226 ATCACAAGAATAGCAGCATGCGG + Intronic
989791189 5:45403566-45403588 ATCATGAGAACAGCAGCATGGGG + Intronic
990319749 5:54618107-54618129 ATCATGAGAACAGCAGCATGTGG - Intergenic
991409247 5:66330478-66330500 ATCACAAGAACAGCAGCATGGGG - Intergenic
991439064 5:66627253-66627275 ATCACGAGAAAGGCAGCATGGGG + Intronic
993002114 5:82391704-82391726 ATGGCCAGAAATGGAGAATGAGG + Intergenic
993391606 5:87325218-87325240 ATCACAATAACAGCAGCATGGGG + Intronic
993604525 5:89972281-89972303 ATCACCATAAGTCCTGAATGTGG + Intergenic
994499136 5:100551950-100551972 ATCCCCGGTACTGCAAAATGTGG - Intronic
994668065 5:102731330-102731352 ATCATGAGAACAGCAGTATGGGG + Intergenic
994689656 5:103000795-103000817 ATCATGAGAACAGCAGAAAGGGG + Intronic
994694977 5:103062687-103062709 ATCAAGAGAACAGCAGCATGGGG - Intergenic
995055268 5:107752710-107752732 ATCACAAGGACAGCAGTATGGGG - Intergenic
996395737 5:123011993-123012015 ATCATAAGAACAGCAGCATGGGG - Intronic
996876939 5:128250574-128250596 ATCACAAGAACGGCAGGAGGGGG - Intergenic
998397301 5:141826863-141826885 AGCACCAGAACTGGTGATTGGGG + Intergenic
998397972 5:141831654-141831676 GTGACAAGAGCTGCAGAATGGGG - Intergenic
998424422 5:142014363-142014385 TTCAGCAGAATTGCAGAACGTGG - Intergenic
998908493 5:146932415-146932437 ATCACAAGAACAGCAGTATAGGG - Intronic
999718908 5:154384093-154384115 ATCATGAGAACAGCAGCATGGGG + Intronic
1000369555 5:160521573-160521595 ATCACCAGAACAGCAGCATGGGG + Intergenic
1000669691 5:164045653-164045675 ACCACAAGATGTGCAGAATGTGG - Intergenic
1000691025 5:164320908-164320930 ATCATGAGAACAGCAGCATGGGG + Intergenic
1001054565 5:168438316-168438338 ATCATGAGAACAGCAGCATGGGG - Intronic
1001527208 5:172437405-172437427 ACCACCAGAAGTGCTGAAGGGGG + Intronic
1002869674 6:1155746-1155768 ATCACAAGAATAGCAGCATGGGG - Intergenic
1003007966 6:2398925-2398947 AGCACCAGAAGTGCAGCATCTGG - Intergenic
1003256420 6:4479103-4479125 ATCAACAGAGCTGCAGAACCAGG - Intergenic
1003618143 6:7673518-7673540 CTCACAAGAACTGCATAAGGTGG - Intergenic
1004151883 6:13128077-13128099 ATCATGAGAACAGCAGCATGGGG + Intronic
1005097358 6:22132016-22132038 ATCACCAGACCTGAAGGAGGAGG - Intergenic
1005131541 6:22514139-22514161 AACACCAGACCTGGGGAATGGGG - Intergenic
1005198381 6:23315066-23315088 ATCACGAGAACAGCAACATGGGG + Intergenic
1005201883 6:23355845-23355867 ATCTCTAGGACTTCAGAATGTGG + Intergenic
1005783534 6:29218475-29218497 ATCATGAGAACAGCAGCATGGGG - Intergenic
1007031254 6:38629462-38629484 ACCGCCAAAACTGCATAATGTGG + Intronic
1007335932 6:41154854-41154876 TTTCCCAGAACTGAAGAATGTGG - Intergenic
1008357603 6:50573054-50573076 ATCACAATAACAGCAGCATGGGG + Intergenic
1009546157 6:65021939-65021961 ATTACAAGAACAGCAGCATGGGG + Intronic
1009569670 6:65368155-65368177 ATCAGAAGAACAGCAGCATGGGG + Intronic
1010027198 6:71233000-71233022 ATCATGAGAACAGCAGCATGGGG - Intergenic
1010722294 6:79297089-79297111 ATCATTAGAACAGCAGCATGAGG + Intergenic
1010819288 6:80394876-80394898 ATCACAAGAACAGCAGCATAGGG - Intergenic
1012077354 6:94707188-94707210 ATCACCTGAGCCGCAGATTGAGG + Intergenic
1012348474 6:98221589-98221611 ATCAGCAGAGATGCATAATGGGG + Intergenic
1012868218 6:104643043-104643065 ATGACTAAAACTGAAGAATGTGG - Intergenic
1012942220 6:105427435-105427457 ATCACAAGAACAGCAGCATGGGG + Intergenic
1012972503 6:105746424-105746446 AAAACCAGACCTGCAGAAAGGGG - Intergenic
1013465043 6:110410676-110410698 ATCATGAGAACAGCAGCATGGGG + Intronic
1013825086 6:114201933-114201955 ATCACAAGAATAGCAGCATGGGG + Intronic
1014190890 6:118495403-118495425 ATCACGAGAACGGTAGCATGGGG - Intronic
1014209174 6:118690165-118690187 ATCACCAGAAGTGTAGAAAATGG - Intronic
1014362990 6:120503865-120503887 ATCATGAGAACAGCAGCATGGGG - Intergenic
1014620796 6:123664577-123664599 ATAACAAGAACAGCAGCATGGGG - Intergenic
1015110523 6:129587672-129587694 ATCACAAGAACAGCAGCATAAGG + Intronic
1015351414 6:132224472-132224494 ATCATGAGAACAGCAGCATGGGG - Intergenic
1015351689 6:132226455-132226477 ATCACGAGAACAGCAGCATGGGG - Intergenic
1015417813 6:132969614-132969636 ATCCCCAGTACCGCAGGATGTGG - Intergenic
1017277639 6:152588684-152588706 TTCACCAGAACTGCAAAGCGAGG - Intronic
1017556482 6:155576641-155576663 ATCATAAGAACAGCAGCATGGGG - Intergenic
1018047449 6:159978255-159978277 AACCTCAGAACTGCAGAATTTGG - Intronic
1018093584 6:160365956-160365978 ATCATGAGAACAGCAGCATGGGG + Intronic
1018416375 6:163605509-163605531 ATCACAAGAACAGCAGCATGGGG - Intergenic
1018472937 6:164112448-164112470 ATCACGAGAATAGCAGCATGGGG - Intergenic
1018837742 6:167497923-167497945 ATCACGACAACAGCAGCATGGGG - Intergenic
1019183009 6:170204030-170204052 ATCACAAGAAGAGCAGCATGGGG - Intergenic
1020813355 7:12873395-12873417 CTCAGCAGAACTGCAGCATCAGG - Intergenic
1020874918 7:13681223-13681245 TTCACAAGAACAGCAGCATGGGG - Intergenic
1021341175 7:19464151-19464173 ATCACAAGAACAGCAGCATGAGG - Intergenic
1021419225 7:20426153-20426175 ATCAGGAGAACAGCAGCATGGGG - Intergenic
1021566652 7:22023162-22023184 CTCACCAGAAATGCAGAATCTGG - Intergenic
1021674868 7:23069927-23069949 ATCACCAAAACTGCAGGATTTGG + Intergenic
1022266745 7:28763682-28763704 ATCACCAAAACCTCAGAATAAGG - Intronic
1023157543 7:37265938-37265960 AGCCCCAGAACTTCAGCATGTGG - Intronic
1023376615 7:39562428-39562450 ATGACAAGAACAGCAGCATGAGG + Intergenic
1023505535 7:40896516-40896538 ATCATGAGAACAGCAGCATGGGG - Intergenic
1023685567 7:42731309-42731331 ATCACGAGAACAGAAGCATGGGG - Intergenic
1023986170 7:45097869-45097891 ATCACCAGTGTTGGAGAATGGGG - Intergenic
1024683359 7:51717627-51717649 AGTCCCAGAACTGAAGAATGTGG - Intergenic
1024839650 7:53570901-53570923 ATCACAAGAGCAGCAGAAAGGGG - Intergenic
1025111529 7:56220961-56220983 ATCACCAAAAAAGGAGAATGGGG + Intergenic
1026392819 7:69919305-69919327 ATCCCCATAACTGCTGAAAGAGG - Intronic
1026567277 7:71499882-71499904 ATCATGAGAACAGCAGCATGGGG - Intronic
1026608774 7:71838702-71838724 ATCACCAGAACTGCAGAATGGGG - Intronic
1027581741 7:80005349-80005371 ATCACAAGAACTGCACCAAGTGG - Intergenic
1028405004 7:90465229-90465251 ATCACAAGAACAGCAGCATAGGG - Intronic
1028418776 7:90609467-90609489 ATCACCAGAACAGCACCAAGGGG - Intronic
1028628413 7:92904529-92904551 AGAACCAGAACTGCACCATGTGG - Intergenic
1029188280 7:98754853-98754875 ACCCCCAGTACTTCAGAATGTGG - Intergenic
1029602878 7:101579946-101579968 ATCATGAGAACAGCAGCATGGGG + Intergenic
1030039516 7:105437119-105437141 GTCATGAGAACTGCAGCATGGGG - Intergenic
1031572980 7:123382347-123382369 ATCACGAGAACAGCAGCATGAGG - Intergenic
1032428698 7:131843092-131843114 ATAACATGAACTTCAGAATGTGG - Intergenic
1032876490 7:136044034-136044056 ATCATGAGAACAGCAGCATGGGG - Intergenic
1032977782 7:137244741-137244763 ATCATCAAAATTGCAGACTGAGG + Intronic
1035005279 7:155653324-155653346 TCCACCAGAACCTCAGAATGTGG - Intronic
1035795220 8:2349919-2349941 ATCATGAGAACAGCAGCATGCGG - Intergenic
1036732404 8:11277418-11277440 ATCACAAGAACAGCAGCATGGGG + Intergenic
1037345151 8:17890847-17890869 ATCACGAAAACAGCAGCATGGGG + Intronic
1037984897 8:23283979-23284001 ATCACCAGACTTGCAGCTTGAGG - Intronic
1038150326 8:24937610-24937632 ATCATGAGAACAGCAGCATGGGG - Intergenic
1039526895 8:38225135-38225157 ATCACGAGAACAGCAGCATGGGG - Intergenic
1040996566 8:53408451-53408473 GTCATTGGAACTGCAGAATGAGG + Intergenic
1041438130 8:57864024-57864046 ATCATGAGAACAGCAGCATGGGG - Intergenic
1041682068 8:60604072-60604094 ATCACAAGAACTGCACCAAGCGG - Intronic
1043126107 8:76397721-76397743 AACAGCAGAATTCCAGAATGAGG - Intergenic
1043376544 8:79656070-79656092 ATCATCAGAACTTCAGGATAAGG - Intronic
1044297851 8:90549082-90549104 TTCTCCAGCACTTCAGAATGTGG + Intergenic
1044803830 8:95984292-95984314 TTCCCCAGAACTGGAGAATGAGG + Intergenic
1044879708 8:96711661-96711683 ATCATAAGAACAGCAGCATGGGG + Intronic
1045456178 8:102381409-102381431 ATCACAAGAACAGCAGCATGGGG + Intronic
1045894764 8:107202033-107202055 ATCATGAGAACAGCAGCATGGGG + Intergenic
1046533200 8:115473370-115473392 ATCATGAGAACAGCAGCATGAGG + Intronic
1046917273 8:119691075-119691097 ATCAAGAGAACAGCAGCATGGGG - Intergenic
1046917523 8:119692888-119692910 ATCAAGAGAACAGCAGCATGGGG - Intergenic
1047115830 8:121841136-121841158 ATCACAAGAACAGCAGCATGAGG - Intergenic
1047116111 8:121843160-121843182 ATCACAAGAACAGCAGCCTGGGG - Intergenic
1047206744 8:122808489-122808511 ATCACTAGAATAGCAGCATGGGG + Intronic
1047308992 8:123676581-123676603 AGCACCATAAGGGCAGAATGAGG + Intergenic
1047714648 8:127584429-127584451 ATCATGAGAACAGCAGCATGGGG + Intergenic
1047939449 8:129815067-129815089 ATCATGAGAACAGCAGCATGGGG - Intergenic
1048614262 8:136057082-136057104 ATCATGAGAACAGCAGTATGGGG - Intergenic
1049097850 8:140559307-140559329 AGAACCAGAACTGCAAAATGCGG + Intronic
1049487123 8:142871878-142871900 ATGAACAGAACTCCAGAATGTGG - Intronic
1050789255 9:9445666-9445688 ATCACGAGAACAGCGGCATGGGG + Intronic
1050874417 9:10616346-10616368 AACACCATTACTGCAGACTGAGG - Intergenic
1051829437 9:21258785-21258807 ATCACAAGAACAGCAACATGGGG - Intergenic
1052387977 9:27844689-27844711 ATCACAAGAACAGCAGCATGAGG + Intergenic
1052397207 9:27953556-27953578 ATCACAAGAACAGCAGCATGGGG - Intronic
1053084676 9:35208678-35208700 ATCACCAGAACAGCACAAAGAGG + Intronic
1053471745 9:38351506-38351528 ATCATGAGAACAGCAGCATGGGG - Intergenic
1055367114 9:75556469-75556491 ATCATGAGAACAGCAGCATGGGG - Intergenic
1055417154 9:76095998-76096020 ATCAGCAGCACTGCAGAAAGCGG + Exonic
1056730433 9:89161241-89161263 ATCGCCAGAACAGCACAGTGGGG - Intronic
1057556995 9:96095805-96095827 ATCACGAGAACAGCAGCATGGGG - Intergenic
1058120636 9:101134973-101134995 ATCACCTCATCTGCAAAATGGGG - Intronic
1058149315 9:101446703-101446725 ATCATGAGAACAGCAGCATGGGG + Intergenic
1058219574 9:102280661-102280683 ATCACCAGAGATGCAGACTGGGG + Intergenic
1058222878 9:102324804-102324826 ATCATGAGAACAGCAGCATGGGG - Intergenic
1058719877 9:107754147-107754169 ATCACAAGAACAGCAGCATGGGG - Intergenic
1058906561 9:109486810-109486832 ATCACAAGAACAGCAGCATGGGG - Intronic
1059711226 9:116869297-116869319 TTCACCAGAAATTCAGAACGTGG - Intronic
1060341660 9:122782704-122782726 ATCACGAGAACAGTAGCATGAGG - Intergenic
1060793487 9:126500514-126500536 ATCCCCAGACCAGCAGCATGGGG + Intronic
1060894080 9:127206513-127206535 ATCATGAGAACAGCAGCATGGGG + Intronic
1061155886 9:128861294-128861316 ATCGCCAGCACAGCAGCATGGGG - Intronic
1061723439 9:132567976-132567998 ACCCCCAGAACTTGAGAATGTGG - Intronic
1185992946 X:4912397-4912419 TTCTCCAGAACAGCAGCATGGGG - Intergenic
1186111982 X:6267326-6267348 AACATCTGAACTGCAGAAAGAGG - Intergenic
1186150297 X:6667645-6667667 ATCATGAGAACAGCAGCATGAGG + Intergenic
1186165727 X:6824146-6824168 ATCACAAGAACAGCAGCATAGGG - Intergenic
1187070267 X:15880782-15880804 ATCATGAGAACAGCAGCATGGGG + Intergenic
1187965550 X:24607883-24607905 GTTAACAGAACTGCAGAATGAGG + Intronic
1188031976 X:25274235-25274257 ACCACCAGACATGCTGAATGAGG - Intergenic
1188223093 X:27564256-27564278 ATCACGAGAAAAGCAGCATGGGG + Intergenic
1188262668 X:28038028-28038050 ATCACCAGAACTTTAGCAGGAGG + Intergenic
1188624453 X:32266149-32266171 ATCACAAGAACAGCACCATGGGG - Intronic
1188813544 X:34683032-34683054 ATCATGAGAACAGCAGCATGGGG - Intergenic
1189016701 X:37292361-37292383 ATCCCCAGAACCTCAGAATGTGG + Intergenic
1189378845 X:40487205-40487227 ATCCCCAGGACCTCAGAATGTGG - Intergenic
1189492815 X:41483101-41483123 ATCACAAGAACAGCAGCATGGGG + Intergenic
1189602947 X:42647253-42647275 ATCACGAGAACAGCAGCCTGGGG - Intergenic
1191148013 X:57189642-57189664 ATCAGCAGACCTGCAGAAGACGG - Intergenic
1191643704 X:63455289-63455311 ATCACCAGATCTGCTGGATAAGG + Intergenic
1191689632 X:63926549-63926571 ATCATGAGAACAGCAGCATGTGG - Intergenic
1192689566 X:73348196-73348218 ATCACAAGAAGAGCAGCATGAGG - Intergenic
1193043000 X:77023761-77023783 ATCATGAGAACAGCAGCATGGGG + Intergenic
1193043278 X:77025760-77025782 ATCATGAGAACAGCAGCATGGGG + Intergenic
1194184882 X:90764259-90764281 ATCATGAGAACAGCAGCATGGGG + Intergenic
1194611113 X:96046823-96046845 ATCATGAGAAGTGCAGCATGCGG - Intergenic
1194741127 X:97575505-97575527 AGCTCCAGTACAGCAGAATGAGG - Intronic
1194920470 X:99758900-99758922 ATCACAAGAACAGCAGCATGGGG - Intergenic
1194920776 X:99761261-99761283 ATCATGAGAACAGCAGCATGAGG - Intergenic
1195428366 X:104761351-104761373 ATCACAAGAACAGCAGCATGGGG + Intronic
1195536171 X:106011759-106011781 ATCACAAGAACTGCAGAATGGGG - Intergenic
1195536437 X:106013651-106013673 ATCATGAGAACAGCAGCATGGGG - Intergenic
1195613360 X:106893918-106893940 ATCATGAGAACAGCAGCATGAGG + Intronic
1196300479 X:114045846-114045868 ATCCCCTGAACTCCAGAAAGGGG + Intergenic
1196345967 X:114659161-114659183 ATCACGAGAACAGCAACATGGGG + Intronic
1196405632 X:115359692-115359714 ATCACAAGAATAGCAGCATGGGG - Intergenic
1197349927 X:125370926-125370948 ATCACAAGAACAGCAGCATGGGG + Intergenic
1197585681 X:128344868-128344890 ATCATGAGAACAGCAGCATGGGG + Intergenic
1197798550 X:130324337-130324359 ATCATGAGAACAGCAGCATGGGG + Intergenic
1198250373 X:134874260-134874282 ATCACGAAAACAGCAGCATGGGG + Intergenic
1198318766 X:135497517-135497539 TTCAGCAGATTTGCAGAATGTGG - Intergenic
1198666190 X:139025789-139025811 ACAAACAGAAATGCAGAATGAGG - Intronic
1198791456 X:140351484-140351506 ATCATGAGAACAGCAGCATGGGG - Intergenic
1198810378 X:140530299-140530321 ATCATGAGAACAGCAGCATGGGG + Intergenic
1198858205 X:141041235-141041257 ATCAGGAGAACAGCAGCATGGGG + Intergenic
1198904490 X:141546135-141546157 ATCAGGAGAACAGCAGCATGGGG - Intergenic
1199019031 X:142853657-142853679 ATCCCCATAACCCCAGAATGTGG + Intergenic
1199125005 X:144107473-144107495 ATCACAAGAAGAGCAGCATGGGG + Intergenic
1199327297 X:146513879-146513901 ATCATGAGAACAGCAGCATGGGG - Intergenic
1199619219 X:149684698-149684720 ATCACAAGAACGGCAGCATCTGG - Intergenic
1200450319 Y:3318845-3318867 ATCATGAGAACAGCAGCATGGGG - Intergenic
1200531501 Y:4346368-4346390 ATCATGAGAACAGCAGCATGGGG + Intergenic
1201484126 Y:14474144-14474166 AACATCTGAACTGCAGAAAGAGG + Intergenic
1201683098 Y:16670665-16670687 ATCACAAGAACAGCAGCATGGGG + Intergenic