ID: 1026617494

View in Genome Browser
Species Human (GRCh38)
Location 7:71918774-71918796
Sequence AATTCCAAGGAGCTGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 378}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026617494 Original CRISPR AATTCCAAGGAGCTGGGGGC TGG (reversed) Intronic
900115284 1:1025543-1025565 AATGCGGAGGAGTTGGGGGCAGG - Intronic
900941177 1:5799568-5799590 GGTTCCCAGGAGCTGGGGGTGGG + Intergenic
901320695 1:8338321-8338343 AGTGGGAAGGAGCTGGGGGCTGG - Intronic
901789745 1:11647936-11647958 CCTTCCAAGCAGCTGGGGGAGGG + Intergenic
901879170 1:12184239-12184261 AGTCCCCAGGAGCAGGGGGCTGG - Intronic
902605018 1:17564283-17564305 AATGCCCAGGAGCTTAGGGCTGG + Intronic
902613806 1:17612826-17612848 CATGCCAGGCAGCTGGGGGCCGG - Intronic
904300300 1:29549707-29549729 AATGCCAAGAAGCTGGGGTGAGG - Intergenic
904457935 1:30658408-30658430 AATGCCAAGAAGCTGGGGTGAGG + Intergenic
904613018 1:31735580-31735602 AAATCCAAGAAGCAGAGGGCCGG - Exonic
905044293 1:34984215-34984237 AAATCCCAGGAGGAGGGGGCTGG + Intronic
905108145 1:35576222-35576244 AGTTACCAGGAGCTGGGGGTTGG + Intronic
906642790 1:47451390-47451412 AAATCCAAGGACCTGGGGAGAGG - Intergenic
908031836 1:60008865-60008887 AATGCCAAGCAGCTGGAGGAAGG - Intronic
911323415 1:96441282-96441304 AATTCCAAAAAGCTAGGGGATGG + Intergenic
911645436 1:100332922-100332944 ACTTCTAAGAAGCTTGGGGCTGG - Intergenic
912904489 1:113689591-113689613 TTTTCCACGGACCTGGGGGCAGG + Intergenic
913093623 1:115496507-115496529 ACTTCCAATAAGCTGGAGGCGGG - Intergenic
914715360 1:150249942-150249964 ATTTCCAAGGGGCTGGGGGCAGG + Intergenic
915498193 1:156295577-156295599 AGTCCAAAGGAGCAGGGGGCTGG + Exonic
916487161 1:165270215-165270237 CATGCCAGGTAGCTGGGGGCAGG - Intronic
917534090 1:175862207-175862229 GTTACCAAGGAGCTGGGGGGAGG - Intergenic
919408977 1:197220478-197220500 AGATCCAAGGAGATGGGAGCAGG + Intergenic
919423306 1:197398863-197398885 GATTGCCAGGAGCTGGGGTCAGG + Intronic
920797798 1:209157576-209157598 AATGCCAAAGAGCTGGGGCTGGG + Intergenic
922577945 1:226675492-226675514 ACTTGCAAGGAGCTGTGGGGAGG + Intronic
923769115 1:236921932-236921954 AATTCCCATGTGCTGGGGGAGGG + Intergenic
924464800 1:244290358-244290380 AATTCCAGAGTGCTGGGGGTGGG - Intergenic
1064183153 10:13136736-13136758 TATTCCCAGGAGCTGAGGACAGG + Exonic
1064645016 10:17452231-17452253 AATTCCAATGAGGGGGTGGCAGG + Intronic
1065660969 10:28003949-28003971 AATCCCCAGCAGCTGAGGGCAGG + Intergenic
1065836558 10:29663473-29663495 AATTCCATGGACCTGGGAGGCGG - Intronic
1067555824 10:47269521-47269543 AGTTGCCAGGAGCTGGGGGAGGG - Intergenic
1068593305 10:58873208-58873230 AGTACCAGGCAGCTGGGGGCAGG - Intergenic
1069585989 10:69602732-69602754 GACTCTTAGGAGCTGGGGGCTGG - Intergenic
1070677171 10:78420080-78420102 AATCCCAATGAGCTGGGTGAAGG - Intergenic
1071251433 10:83823613-83823635 AATGGCAAGGAGCTCGGGCCTGG - Intergenic
1071306000 10:84299195-84299217 AAATCCAAAGGGATGGGGGCAGG - Intergenic
1071703757 10:87973879-87973901 AATTCCAATGAGGTTGGGTCAGG - Intergenic
1071875521 10:89838720-89838742 AATTTCAAGGAGCTGCAGGAGGG - Intergenic
1073115089 10:101087422-101087444 AATTCCAAGGGGTCAGGGGCTGG - Intergenic
1073650661 10:105354620-105354642 AGTACCAAGGAGCTGGGAGCAGG + Intergenic
1074051625 10:109886058-109886080 AATTACAGGGAGCTGGGGAGGGG - Intronic
1074068242 10:110038304-110038326 AATTCAAAGGCTCTGGGGGATGG - Intronic
1074350627 10:112733396-112733418 AAATCCACGGAGACGGGGGCTGG - Intronic
1074501499 10:114028979-114029001 CATTGCAAGGGGCTGGGGGAAGG - Intergenic
1075634735 10:124022787-124022809 AATGCCAAGGAGCAGGGCGAGGG - Intronic
1075804569 10:125176838-125176860 AATTGCAAGGAGATGGGGTAGGG + Intergenic
1076243933 10:128931844-128931866 TACTCCAAGGAGCTTGGGGCTGG + Intergenic
1076557579 10:131337853-131337875 GAATCCTAGGTGCTGGGGGCTGG - Intergenic
1076624454 10:131812919-131812941 CATCCCGAGGAGGTGGGGGCTGG - Intergenic
1077049363 11:559925-559947 AGGTCAAAGGAGCTGTGGGCTGG - Intronic
1077899242 11:6476409-6476431 AAGTCAAAAGAGCTGGGGCCAGG - Exonic
1077907613 11:6546278-6546300 ACTGCCAAGGAGCTGGGGCTGGG - Exonic
1078126122 11:8565293-8565315 ACTTCCAGGGAGATGGGGGTTGG - Intronic
1078285350 11:9948242-9948264 GGTTGCCAGGAGCTGGGGGCAGG + Intronic
1079555145 11:21751373-21751395 ACTTCCCCAGAGCTGGGGGCGGG - Intergenic
1080865099 11:36187049-36187071 AATTAGCAGGAGTTGGGGGCAGG - Intronic
1081845246 11:46236911-46236933 AATTCCACTGAGTTGGGGGTGGG + Intergenic
1082107607 11:48237294-48237316 AATTACAAGGAGCAGGGCACAGG - Intergenic
1082916910 11:58446913-58446935 CAGTGCAAGTAGCTGGGGGCTGG - Intergenic
1083164365 11:60874522-60874544 AATTCCAAGGAGGTGGGACTTGG - Intronic
1083843421 11:65317151-65317173 GCTTGCAAGGAGCTGGGGGAAGG - Intronic
1083959937 11:66009067-66009089 AATTCCATGTTGCTGGGGGGCGG - Intergenic
1085941972 11:81215277-81215299 AATTCCCAAGTGCTGGGGGAGGG - Intergenic
1086096600 11:83056185-83056207 GGTTACCAGGAGCTGGGGGCAGG - Intronic
1086260216 11:84930972-84930994 AATTTTAAGGGGCTGGGGACAGG - Intronic
1087133613 11:94692499-94692521 AAGAGCAAGGATCTGGGGGCTGG + Intergenic
1087372646 11:97304212-97304234 TATTCCAAGGAGTTGGGCGGTGG - Intergenic
1088115614 11:106309321-106309343 AATTGCCAGGAGCTGGGGTTAGG - Intergenic
1090551840 11:127828377-127828399 AATTCCAAGACTCTGGGAGCAGG + Intergenic
1091615059 12:2044479-2044501 TTTTCCAAGTACCTGGGGGCGGG - Intronic
1092378187 12:7973060-7973082 GAGGCCAAGGAGCGGGGGGCGGG - Intergenic
1095236020 12:39796540-39796562 CATTCCCATGAGCTGGGAGCTGG + Intronic
1096750507 12:53756032-53756054 CAAGCCAGGGAGCTGGGGGCAGG - Intergenic
1096792315 12:54052972-54052994 ATCTCCAAGGAGCTGGGGCAAGG - Intronic
1097109145 12:56645369-56645391 TATTGGAAGGAGCTGGGGTCAGG + Intronic
1097958734 12:65512221-65512243 AATTCCCAGGAGCTGCTGCCAGG - Intergenic
1099059451 12:77888236-77888258 AATCCCAAGGAGGTAGAGGCAGG + Intronic
1099705602 12:86149508-86149530 AATTCCAAGCATCTCAGGGCAGG + Intronic
1100408390 12:94290990-94291012 GATGCCAAGATGCTGGGGGCAGG - Intronic
1102015638 12:109646121-109646143 CACTTCAAGGGGCTGGGGGCTGG + Intergenic
1102463525 12:113114901-113114923 CATGCCCACGAGCTGGGGGCAGG + Exonic
1103308764 12:119988753-119988775 GCTTCCAAGTAGCTGGGGGCGGG + Intergenic
1104588971 12:130069173-130069195 AATTCCAAGGTCCTGGGGTCAGG + Intergenic
1105506248 13:21012787-21012809 ATTTCCTAGGAGGTGGGGGGGGG - Intronic
1105594842 13:21827694-21827716 AATCCCAAGGAGGTGTGGGAAGG - Intergenic
1106065586 13:26345191-26345213 CATTCCAAGGTACTGGGGGTAGG + Intronic
1106354010 13:28962312-28962334 AATATCAAGGAGTTGGGGCCAGG - Intronic
1106449317 13:29865471-29865493 CATACCCAGGAGCTGGAGGCAGG - Intergenic
1106467078 13:30023076-30023098 ATAGCCAAGGAGCAGGGGGCAGG - Intergenic
1107833958 13:44398695-44398717 CTTTGCAAGGGGCTGGGGGCTGG - Intergenic
1108478563 13:50843995-50844017 CCTTCGAAGGAGGTGGGGGCGGG - Intergenic
1108586974 13:51878541-51878563 AATCCCCAGGTGCTGGGGGAGGG - Intergenic
1110039638 13:70736524-70736546 AATTACAAGAAGCTGGGTTCTGG + Intergenic
1110607191 13:77446649-77446671 ATTTCCAAGGACCTGTGAGCAGG + Intergenic
1112364117 13:98742247-98742269 ATTGCCAAGGAGCCGGGGCCAGG - Intronic
1112568573 13:100572377-100572399 GATTACCAGGAGCTGGGGGACGG + Intronic
1114760438 14:25308319-25308341 ATATCCAAGCAGCTGGGAGCAGG - Intergenic
1115969821 14:38932661-38932683 AAGGCCAATGAGATGGGGGCAGG - Intergenic
1117163515 14:53011781-53011803 AATTCAATGGAGATGGGGGAGGG + Intergenic
1119129192 14:72156081-72156103 AATTCCAATGAGCAGGTGGGTGG + Intronic
1119405865 14:74399310-74399332 GATTGCCAGGAGCTGGGGGAGGG - Intergenic
1120857576 14:89226094-89226116 AATTCCCAAGTGATGGGGGCGGG + Intronic
1121446940 14:93984896-93984918 AATTCCATGGGGCGGGGGGCGGG - Intergenic
1122007518 14:98717752-98717774 AATTCCTGGGAGGTGGGGTCTGG - Exonic
1122077121 14:99243188-99243210 AATAACAAGGAGCTGGGGTGGGG + Intronic
1123042882 14:105497619-105497641 AAGGCCATGGAGCTGAGGGCGGG - Intronic
1124163461 15:27295854-27295876 ACTTCAAAGGAGCTGGGGTGGGG + Intronic
1126296905 15:47149496-47149518 AATACCAAGGAGCAGGGTCCAGG - Intergenic
1127395208 15:58539043-58539065 AACTGGAAGGAGCTGGGGCCTGG - Intronic
1128528687 15:68430053-68430075 GCTTGCAAGGAGCTGGGGGTGGG - Intronic
1128899608 15:71408553-71408575 ATTTTAAAGGAGGTGGGGGCTGG + Intronic
1129363929 15:75042982-75043004 CAGGCCAAGGCGCTGGGGGCTGG - Intronic
1130659384 15:85818158-85818180 AATCCCAAGGAGCTTGGTGTGGG - Intergenic
1131177145 15:90217301-90217323 AATGGCAAGGGGCTGGGGGCAGG - Intronic
1132310462 15:100853915-100853937 CATAGCAGGGAGCTGGGGGCAGG - Intergenic
1132643834 16:989839-989861 TATTCCCAAGAGCTGGGGGAAGG + Intergenic
1132885353 16:2179889-2179911 AAGGCCAAGGAGCGGGAGGCCGG - Exonic
1133115463 16:3575904-3575926 AATTCCAAGGCCCTGGGAGGGGG - Intronic
1133418273 16:5623641-5623663 CATTACAAGCAGCTGGGGGAAGG - Intergenic
1133861510 16:9599665-9599687 ACTTCCGTGGAGCTCGGGGCCGG - Intergenic
1134000945 16:10782351-10782373 ATTTCAAAGGAGCAAGGGGCAGG - Intronic
1134060572 16:11197307-11197329 GATTCCCAGGACCTGGGTGCAGG - Intergenic
1134343987 16:13372290-13372312 AATAACAAGGTGCTGGGTGCTGG + Intergenic
1134661886 16:15990481-15990503 AGTTGCAAGGAGCTGGTGGTGGG - Intronic
1134689135 16:16179487-16179509 TTTTCCATGGACCTGGGGGCAGG + Intronic
1135076220 16:19396057-19396079 AACTCCACTGACCTGGGGGCAGG - Intergenic
1135239740 16:20793704-20793726 TATTCCAGGCAGCTGAGGGCAGG + Intronic
1135615551 16:23908115-23908137 AATCCCTGGGAGCTGGGGGAAGG + Intronic
1135631607 16:24039855-24039877 AAGACCAAGGAGGAGGGGGCTGG - Intronic
1135847913 16:25935480-25935502 GATTTCCAGGAGCTGGGGGAGGG - Intronic
1135912601 16:26575035-26575057 AAAACCAAGGTGCTGGGTGCTGG + Intergenic
1136369838 16:29829563-29829585 AAGTCCAAAGTGCTGGGGGCAGG + Intronic
1136663005 16:31781495-31781517 AATTCCCAGGAGTTGTGGGAGGG + Intronic
1137592139 16:49700266-49700288 ATTTCCAAGTAGCTTGGGGTTGG - Intronic
1138251168 16:55502937-55502959 ATTTGCAAGGAGCTGGGCCCTGG - Intronic
1141434125 16:83989531-83989553 AAATCCAAGGTGCCTGGGGCAGG + Intronic
1141464728 16:84197965-84197987 AAGTCCAGGGACCTGGGGCCAGG + Intergenic
1141499783 16:84436040-84436062 AATTGCATGAAGCTGGGGGGTGG + Intronic
1142132309 16:88436681-88436703 AAGTCTAAGAAGCTGGGGCCGGG - Exonic
1142414554 16:89934360-89934382 AATCCCTGGCAGCTGGGGGCTGG - Intronic
1143112919 17:4562844-4562866 AATTCGATGTAGCTGGGTGCTGG + Intergenic
1144263333 17:13544666-13544688 TGTTCCAAGGAGCAGGGTGCGGG - Intronic
1144762111 17:17712969-17712991 AATTGCCAGGGGCTGGGGGTGGG + Intronic
1145964019 17:28904091-28904113 GAATCCTAGAAGCTGGGGGCTGG - Intergenic
1146712665 17:35056109-35056131 AATACCCAAGACCTGGGGGCGGG - Intronic
1148217038 17:45838980-45839002 CATTTTAAGGAGCTGGGGGGTGG - Intergenic
1149435497 17:56630166-56630188 AACTCTGAGCAGCTGGGGGCAGG + Intergenic
1150137175 17:62702410-62702432 AAGGCCAAGGGGCGGGGGGCGGG + Intronic
1150650735 17:67008440-67008462 AATTGCGGGGAGCAGGGGGCAGG + Intronic
1151312893 17:73305046-73305068 AATTCCCAGGAGGTGAGGGAAGG - Intronic
1151459045 17:74243886-74243908 CATTGCAAGGGTCTGGGGGCAGG + Intronic
1151599018 17:75094950-75094972 AGCTCCCAGGAGCTGAGGGCAGG - Intronic
1152529192 17:80907065-80907087 AAGTCCACGGAGATGGAGGCGGG - Intronic
1152926016 17:83088117-83088139 AATCCCAAGGTCCTGGGGCCGGG - Intronic
1153513060 18:5876580-5876602 AATTACCAGGAGTTGGGGGAAGG - Intergenic
1153911226 18:9708176-9708198 CGTTCCTGGGAGCTGGGGGCCGG + Exonic
1154040415 18:10849506-10849528 AAAGCAAAGGAGCCGGGGGCGGG - Intronic
1156210147 18:34930723-34930745 AGTTGCCAGGAGTTGGGGGCTGG + Intergenic
1156325528 18:36071502-36071524 GAGGCCAAGGGGCTGGGGGCGGG + Intergenic
1156442045 18:37200513-37200535 AATTAAAAGGAGCTGTCGGCCGG + Intronic
1157618587 18:49002276-49002298 AGTCCCAAGGGGCTGGGGGCCGG + Intergenic
1159067789 18:63589027-63589049 AATTTCAAGCATCTGGGAGCAGG - Intronic
1160467493 18:79093731-79093753 AATTCTAAGCAGATGGGGGAGGG - Intronic
1160509713 18:79446612-79446634 TCTTCCGAGGAGCTGAGGGCTGG + Intronic
1161089546 19:2353093-2353115 ACGTCCGAGGAGATGGGGGCTGG + Exonic
1161962472 19:7530182-7530204 AATGGCTAGGAGCTGGTGGCTGG - Intronic
1162298139 19:9827642-9827664 ACTTCAAACGAGCTGGGCGCCGG + Intronic
1162319095 19:9960240-9960262 CTTTCCAGGGTGCTGGGGGCTGG - Exonic
1163466660 19:17471779-17471801 ACAACCAAGGAGCCGGGGGCAGG - Intronic
1163847194 19:19644246-19644268 AATTCCACTGTGCTGGGGGTGGG - Intergenic
1164901470 19:31929564-31929586 AATCCCAAGGCGCTGGGAGTAGG - Intergenic
1166178240 19:41089523-41089545 AATTACCAGGAGTTGGAGGCTGG - Intronic
1166287075 19:41837785-41837807 AATTCCAAGGAGGAAGGGGAAGG - Intronic
1166682158 19:44775683-44775705 AATTCCTACGAGATGGGGGTGGG + Intergenic
1167426737 19:49433538-49433560 GATTCTCAGGTGCTGGGGGCAGG - Intronic
1167575240 19:50314786-50314808 AGGTCAAAGGAGCTGGGGGTGGG - Intronic
1167678140 19:50901572-50901594 AATTGCCAGGAGCTGGGGCTCGG - Intergenic
1168308024 19:55446455-55446477 AATTGCCCGGAGCTGGGGACAGG + Intergenic
925118967 2:1402773-1402795 AATTCCCAGGTGCTGTGGGAGGG - Intronic
925798199 2:7569428-7569450 AATTCCACTGAGCTGGGGCCTGG + Intergenic
926134561 2:10327172-10327194 AAATCCCAGGAGTTGGGGGAAGG - Intronic
928179961 2:29062122-29062144 GTTGCCAAGGTGCTGGGGGCTGG - Exonic
928565798 2:32547370-32547392 AATTGCCAGGGGCTGGGGGAAGG - Intronic
929777595 2:44938622-44938644 AATTCCCAGGCGCTGGGCACTGG - Intergenic
930000718 2:46859871-46859893 AATTCCACCTGGCTGGGGGCAGG + Intergenic
931519540 2:63080603-63080625 AATACCAAGGGGTTAGGGGCAGG - Intergenic
931641196 2:64382438-64382460 AATTCAAAGGGGTTGGTGGCTGG - Intergenic
931643889 2:64404454-64404476 AAAGCCAATGAGTTGGGGGCAGG + Intergenic
932138689 2:69255863-69255885 TATTCCCAGTAGCTGGGGGTGGG - Intergenic
932207076 2:69892635-69892657 AAATACAAAGAGCTGGGGGATGG - Intergenic
932506543 2:72238076-72238098 AATTGCCAGAAGCTGGGGGATGG - Intronic
933036959 2:77411764-77411786 AAATCCAAGACCCTGGGGGCCGG - Intronic
934661725 2:96146633-96146655 AATCCCACGCAGCTGGGGGCAGG - Intergenic
934763600 2:96869017-96869039 AAATCCCTGGAGCTGGGGGAGGG - Intronic
934945621 2:98539279-98539301 AAGTGCAAGCAGCTGGGGGCAGG - Intronic
937032523 2:118752704-118752726 AATTCCAAGTAGCTGGGAGTAGG + Intergenic
937468103 2:122152529-122152551 AATACCAAGGGGCTGGGGCAGGG + Intergenic
937624301 2:124025735-124025757 GAGTACGAGGAGCTGGGGGCGGG + Intronic
938515434 2:132001085-132001107 AAATCCCAGGAAATGGGGGCAGG + Intergenic
941690990 2:168500589-168500611 AATTACAAGGAGGTGGGAGAAGG + Intronic
941873394 2:170408943-170408965 GAATCCCAGGAGCTCGGGGCAGG + Intronic
942027287 2:171922692-171922714 AACCCCAAGCAGTTGGGGGCGGG - Intronic
944402564 2:199345080-199345102 AAATGCCAGGAGATGGGGGCAGG - Intronic
945678970 2:212889916-212889938 TATTCCAAGGATGTGGGGGTAGG - Intergenic
946253887 2:218429739-218429761 AATTCCAGGGGGCTTGGGGTGGG + Intronic
946851485 2:223911219-223911241 GATTTCCAGGAGCTGGGGGAAGG + Intronic
946924613 2:224614705-224614727 ATTTCCAGGGAGCGGGAGGCTGG + Intergenic
947722482 2:232378380-232378402 ATTTCCCAGAAGCTGGGGCCAGG - Intergenic
948224149 2:236295755-236295777 GATTGCCAGGGGCTGGGGGCAGG - Intergenic
948718679 2:239882558-239882580 AACTGCAGGGAGCTGAGGGCTGG + Intergenic
948888126 2:240893932-240893954 AAGCCCGAGGGGCTGGGGGCAGG + Intronic
1168934929 20:1656804-1656826 AATTCTAAGGCGCTGGGGATTGG - Intronic
1169307671 20:4506866-4506888 AATTACTAGGGGCTGGGGGCAGG + Intergenic
1170706912 20:18752098-18752120 ATTTTGAAGAAGCTGGGGGCTGG - Intronic
1171151251 20:22828122-22828144 CATTCCAAGGAGATGAGGGAGGG - Intergenic
1171462207 20:25304446-25304468 ACTTCCAATGAGCTGAGGGTGGG + Intronic
1171958029 20:31474908-31474930 GATTCCACGGTGCTGGGGGAGGG - Intronic
1171959753 20:31485316-31485338 AATTTAAAGGAGGTTGGGGCAGG + Intergenic
1172387427 20:34543916-34543938 AATTCCAGGGAGCCGTGGCCAGG - Intergenic
1174266431 20:49335547-49335569 CATTCCAGGGAGCTGCGGGCAGG + Intergenic
1175330646 20:58161685-58161707 ATTTCCAAGGAGTGGGGGGTTGG + Intergenic
1176429921 21:6569272-6569294 GATTGAAAGGAACTGGGGGCTGG - Intergenic
1178676940 21:34639065-34639087 AAATCCCAGGAGCTGGTGGATGG + Intergenic
1178822514 21:35988783-35988805 AAATCCAAGAAGCTGGTGGCAGG - Intronic
1179479817 21:41670022-41670044 CATTCCAAGGCCCTGGGGGTTGG + Intergenic
1179705315 21:43176734-43176756 GATTGAAAGGAACTGGGGGCTGG - Intergenic
1180233945 21:46445444-46445466 AATTCAAGGCATCTGGGGGCTGG - Exonic
1181044426 22:20207828-20207850 AGGTCCCAGGAGCTGGGGGTGGG + Intergenic
1182613190 22:31566387-31566409 AATTAAAAGAAACTGGGGGCCGG - Intronic
1183299539 22:37052056-37052078 ATTTCCGAGGAACTGGAGGCGGG + Intronic
1183474125 22:38026586-38026608 AGTTCCAGGGAGCCGGGGGAGGG - Intronic
1183541037 22:38429589-38429611 ACTTCCCAGGAGCTGGTGACAGG + Intronic
1183542440 22:38437251-38437273 AAATCACAGGCGCTGGGGGCTGG + Intronic
1184107548 22:42376946-42376968 AATTGAAAGGAGGTGGGGGAGGG + Intergenic
1184350345 22:43939418-43939440 AATTTAAAGGAGCTGGGAGTGGG + Intronic
1184386174 22:44175881-44175903 AAATCCGAGGGGCTGGGGACTGG - Intronic
1184696768 22:46143761-46143783 AAAACCAAGGAGCAGGGTGCGGG - Intergenic
1184839411 22:47043769-47043791 CATTCCAAGGCTCTGAGGGCAGG + Intronic
1185084837 22:48735204-48735226 CCTACCAAGGAGCTGGGAGCTGG + Intronic
1185132112 22:49045093-49045115 AAGCCCATGGAGCTGGAGGCAGG - Intergenic
949804855 3:7943550-7943572 GGTTACCAGGAGCTGGGGGCAGG - Intergenic
950065507 3:10108397-10108419 CATTCCAATGAGGTGGGGGCGGG - Intergenic
950097131 3:10336978-10337000 ACCTCCCAGGAGGTGGGGGCAGG + Intronic
950161628 3:10764838-10764860 AACTCCAGGGAGCAGGGGCCAGG - Intergenic
950357488 3:12424185-12424207 AAAACCACAGAGCTGGGGGCGGG + Intronic
950404492 3:12796435-12796457 AATAACAAGGAGGTGGTGGCAGG + Intergenic
951524364 3:23639800-23639822 GACTGCAAGGAGCTGGGGTCAGG + Intergenic
954911460 3:54114263-54114285 AACTCCAAGGAGAAGGAGGCTGG + Intergenic
955419325 3:58721138-58721160 AATTCCAAGATGCTGGGAGTGGG + Intronic
955719773 3:61868427-61868449 GAGGCCAGGGAGCTGGGGGCAGG - Intronic
955997734 3:64694515-64694537 AATGGCAAGGGGCTGGGAGCAGG + Intergenic
957672521 3:83324032-83324054 AATGCCCAGGAGCTAGGGCCTGG + Intergenic
958880635 3:99665132-99665154 AAGTCCAAGGAGCAGGTGCCAGG + Intronic
959405516 3:105958148-105958170 AACCCCAAGGAACTTGGGGCTGG - Intergenic
959596297 3:108132554-108132576 AACTCCTAAGAGCTGGAGGCAGG + Intergenic
959735947 3:109658797-109658819 AATTCCCAGGGTCTGGGGGTTGG + Intergenic
960197372 3:114785936-114785958 GATTGCCAGGAGCTGGGGACAGG - Intronic
961419089 3:126785777-126785799 AATTACCAGGGGCTGGGGGGAGG - Intronic
961825109 3:129595209-129595231 AAGTGGAAGGAGCTGGGGTCTGG - Intronic
961946347 3:130692998-130693020 AATTGCCAGGTGCTGGGGGAAGG - Intronic
962338253 3:134557897-134557919 AATTCCAAGAAGGTGGAGGAAGG - Intronic
962434326 3:135350511-135350533 GCTTACAAGGAGGTGGGGGCGGG + Intergenic
963055637 3:141184374-141184396 AATCCCATAGAGCTGGGTGCAGG - Intergenic
964431354 3:156609921-156609943 AAATCCAAGAAGTTGTGGGCAGG + Intergenic
964624245 3:158744119-158744141 CATTCCATGGAACTAGGGGCAGG - Intronic
965059664 3:163769232-163769254 AAATACAAGGGGCTGGGTGCGGG + Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966893155 3:184422708-184422730 AATTCCATAGAGCTGGGTGTTGG + Intronic
967547821 3:190752468-190752490 AATTCCCAGGGGTTGGGAGCAGG - Intergenic
967579030 3:191130156-191130178 AATTACTAGGACCTCGGGGCAGG - Intergenic
967589388 3:191255052-191255074 TTTTCCAAGGACCAGGGGGCAGG + Intronic
967909608 3:194530933-194530955 AGTTGCCAGGAGCTGGGGGCGGG - Intergenic
968607940 4:1544396-1544418 CATTCTGAGGTGCTGGGGGCTGG - Intergenic
968758461 4:2428623-2428645 AAGGCCCCGGAGCTGGGGGCGGG - Intronic
968945449 4:3661218-3661240 AATTCAGAGGAGCTGGGGAGCGG + Intergenic
970142946 4:13002530-13002552 GTTTCCTAGGAGCTGGGGGCAGG - Intergenic
971331376 4:25684317-25684339 AATTGCCAGGAGGTGGGGACAGG + Intergenic
971474165 4:27056808-27056830 AATTCCTCGGAGCTGGGTTCCGG - Intergenic
971479513 4:27101919-27101941 AATCCTAAGGAGCTGGTGGCTGG + Intergenic
973024940 4:45256421-45256443 AATCCCCATGAGCTGGGGGAGGG - Intergenic
974916702 4:68186641-68186663 AAAGGCAAGGAGATGGGGGCAGG + Intergenic
975214800 4:71741032-71741054 AATTCCAAGCAACTTGTGGCTGG + Intergenic
975321183 4:73011552-73011574 AACTGCAAGGAGGTGTGGGCAGG + Intergenic
976813391 4:89120692-89120714 AATTCCAAAGGGCGGGGGGTGGG - Intergenic
976844003 4:89465715-89465737 GATTGCAAGGAGCTGGGGGAGGG + Intergenic
979529787 4:121757596-121757618 TTTTCCATGGAGCTGGGAGCAGG + Intergenic
980614075 4:135195198-135195220 AATCCCCAGGAGGTGGGGCCTGG + Intergenic
981865031 4:149407176-149407198 AATTCCCAAGAGCTGTGGGAGGG - Intergenic
984013437 4:174399392-174399414 AATTGCAGTGAGCTGGGGTCAGG - Intergenic
984143684 4:176035089-176035111 ATTTCCAAGGAGCAGGGAGGTGG + Intergenic
984586602 4:181571189-181571211 AATTCGAGGAAGCTGGAGGCGGG + Intergenic
984639311 4:182144646-182144668 AATTCAAAGGAGCCGGGCGCGGG - Intronic
984733824 4:183092277-183092299 AATTTCCAGGAGCTGGGGCCTGG - Intergenic
984815024 4:183828203-183828225 ACTTCCAAGGAGCTGCCAGCTGG + Intergenic
985609237 5:877731-877753 CATTCCAAGGCACTGGGGTCGGG - Intronic
988531434 5:32030813-32030835 AATACCAAGGGGGTGGGGCCTGG - Intronic
988621684 5:32829855-32829877 AATTCCCAGGAGCTGTGGGAGGG - Intergenic
989773705 5:45176500-45176522 GATTGCAAGGAGCTGGGGCAGGG - Intergenic
990177232 5:53121618-53121640 AATAGCCAGGGGCTGGGGGCAGG - Intergenic
990774795 5:59293973-59293995 ATCTCCAAGGAGTTGGGAGCAGG - Intronic
991269967 5:64768276-64768298 AATCCCAAGCAGCTGGGGCTTGG + Intronic
991720859 5:69493292-69493314 ACCCCCAAGGAGCTGGGCGCAGG - Intronic
991947381 5:71912555-71912577 GATTGCCAGGAGCTGGGGGTAGG + Intergenic
992094674 5:73351806-73351828 AGTTGCAAGGGGCTGGGGGAAGG + Intergenic
992732904 5:79690265-79690287 AGTCACAAGGAGCTGGGGGCGGG - Intronic
992776475 5:80093515-80093537 ACTTCCAGGGAGCAGGGGGCAGG + Intergenic
993071453 5:83169032-83169054 AATTCAAGGGAGCTGTGGGTGGG + Intronic
995159472 5:108961465-108961487 AATTCCAAAGTGTTGGGGGTTGG - Intronic
995742245 5:115367154-115367176 GATTCCAAGGGGCTGGGGGAAGG - Intergenic
995833251 5:116376514-116376536 GATTCAAGGGAGCAGGGGGCAGG + Intronic
996607818 5:125344587-125344609 AATTCCAAGGAGCAGGAGCTTGG + Intergenic
996986756 5:129576652-129576674 CTTTCCAAGGAGCTGGGAGGGGG + Intronic
997206316 5:132052315-132052337 AGTTCCAAGGAGGTGGAGGAGGG + Intergenic
998045943 5:138986899-138986921 TTTTCCAAGGATTTGGGGGCAGG - Intronic
998467645 5:142358291-142358313 ACTTCCAGGGAGCTCTGGGCCGG + Intergenic
999376099 5:151087351-151087373 AATTCCAGGGAGTTGGGGTTGGG + Intronic
1001039767 5:168325812-168325834 AGTTTCCAGGGGCTGGGGGCAGG - Intronic
1001106064 5:168855701-168855723 AATTGCCAGAGGCTGGGGGCAGG + Intronic
1001315691 5:170639710-170639732 AATTACAAAGTGATGGGGGCAGG - Intronic
1001809071 5:174613340-174613362 CATTCCAAGGTACTGGGGGCTGG - Intergenic
1002069686 5:176671944-176671966 AATTCCTAGCAGGTGGGGCCAGG - Intergenic
1002135292 5:177104005-177104027 AATGCCATGGGGCTGGAGGCAGG - Intergenic
1002490753 5:179575366-179575388 AAGACCAAGGAACTGGGGGCTGG + Intronic
1003544525 6:7048259-7048281 AAGTGCACAGAGCTGGGGGCGGG + Intergenic
1004424309 6:15497210-15497232 AACTGCAGGGATCTGGGGGCAGG - Intronic
1004850243 6:19691727-19691749 TCTGCCAAGGAGCTGGGGGCGGG - Intergenic
1005713350 6:28523570-28523592 AGTTACAAGGAGGTGGAGGCAGG + Intronic
1007469955 6:42083312-42083334 AATGCCCATCAGCTGGGGGCTGG - Intronic
1008881842 6:56387965-56387987 AACTGCCTGGAGCTGGGGGCGGG - Intronic
1009479895 6:64143654-64143676 CATGCCCAGGAGCTGGGGACAGG - Intronic
1009744951 6:67799732-67799754 AGTTCCCCGGAGCTGGGGGAGGG - Intergenic
1010434489 6:75813823-75813845 AATGCCCAGGAGCTAGGGCCTGG + Intronic
1010730254 6:79383088-79383110 TATTCCCAGCAGCTGGGGGATGG + Intergenic
1011243528 6:85298067-85298089 TTTTGGAAGGAGCTGGGGGCAGG - Intergenic
1011743028 6:90382206-90382228 GATTCCATTGATCTGGGGGCAGG - Intergenic
1012892352 6:104910881-104910903 AATTGCCATGGGCTGGGGGCAGG + Intergenic
1012995847 6:105973189-105973211 GAGTCCAAAGACCTGGGGGCAGG - Intergenic
1015984597 6:138872545-138872567 AATTTCAAAGAGATGGTGGCTGG - Intronic
1017047076 6:150356816-150356838 AATGCCAAATAGATGGGGGCGGG - Intergenic
1018136504 6:160783131-160783153 ACTAAGAAGGAGCTGGGGGCAGG + Intergenic
1018652572 6:166004542-166004564 GGTTGCAAGGAGCTGGGGGAGGG - Intergenic
1018705051 6:166457969-166457991 AAGTCCAGGGAGCTGGTGGTTGG - Intronic
1019067164 6:169312017-169312039 AATTCCCAGGTGCTGTGGGAGGG - Intergenic
1020274078 7:6614705-6614727 AAAACCAAAGATCTGGGGGCAGG - Intergenic
1021649981 7:22823495-22823517 AATTCTAAAGAGTTTGGGGCTGG + Intergenic
1022479291 7:30732774-30732796 ACAGCCAAGGAGCTGGGGGCTGG - Intronic
1022547037 7:31199509-31199531 AATTCCATTGAGATGGTGGCTGG + Intergenic
1023327216 7:39073482-39073504 AATTCCAAGGAGATGGGGGTGGG - Intronic
1023417903 7:39949929-39949951 ATTTCCGGGGAGATGGGGGCAGG - Intergenic
1026272393 7:68847993-68848015 AATTCCCACGTGCTGGGGGAGGG + Intergenic
1026617494 7:71918774-71918796 AATTCCAAGGAGCTGGGGGCTGG - Intronic
1028733038 7:94174959-94174981 AATCCCCAGGTGCTGAGGGCAGG + Intergenic
1028990868 7:97047367-97047389 GATTCCTAGGAGTTGGGGGAAGG + Intergenic
1030999675 7:116400167-116400189 AATTGCAATTAGCTGGTGGCAGG + Intronic
1031936510 7:127740670-127740692 ATTTCCAAGGGGGTGGGGGGTGG + Intronic
1033039074 7:137901896-137901918 AAATAGAAGGAGCTGGGGCCGGG + Intronic
1033162695 7:139011465-139011487 GACTGGAAGGAGCTGGGGGCTGG - Intergenic
1033278218 7:139988496-139988518 AGAAGCAAGGAGCTGGGGGCTGG - Intronic
1033441403 7:141382973-141382995 ATTTCCAAGGAGATTGGGGTGGG - Intronic
1033916138 7:146328694-146328716 GATTAGGAGGAGCTGGGGGCTGG - Intronic
1034654748 7:152720541-152720563 AATTCCAAGGAGGTGGGCTTGGG - Intergenic
1035020508 7:155797500-155797522 AATTGCAGGGTGCTGGGTGCAGG - Intergenic
1035079351 7:156203262-156203284 AATTCTATGGGGCTGGGGGTGGG - Intergenic
1035375510 7:158404667-158404689 GAGGCCAAGGAGCTGGGGGCCGG - Intronic
1035375588 7:158404859-158404881 GAGGCCAGGGAGCTGGGGGCTGG - Intronic
1035375658 7:158405048-158405070 GAGGCCAGGGAGCTGGGGGCCGG - Intronic
1036560262 8:9895802-9895824 ATTTTCAAGGGGCTGGGGGAAGG + Intergenic
1037960251 8:23092559-23092581 AATTCCAGGGAGTCCGGGGCAGG - Intronic
1038568325 8:28638154-28638176 AATTCCAAGAAGATGGGTACAGG - Intronic
1039453391 8:37693400-37693422 ACTTCCCAGGAGGTGGGAGCAGG + Intergenic
1041074737 8:54159266-54159288 AGTTCCCAGGGGCTGGAGGCAGG - Intergenic
1042332932 8:67600341-67600363 AGTTACTAGGAGCTGGGGGTGGG + Intronic
1045405631 8:101863952-101863974 AATTCCAAGGGGATGGGGCCTGG + Intronic
1047459244 8:125046500-125046522 AATGCCTAGGAGCTGGGCTCTGG + Intronic
1047994336 8:130319252-130319274 AATTAGTAGCAGCTGGGGGCTGG - Intronic
1048908580 8:139112411-139112433 ATATTCAAGGAGCTGGAGGCTGG + Intergenic
1048964696 8:139607230-139607252 AGTGCCAAGGAGCAGGGAGCAGG - Intronic
1049762347 8:144337093-144337115 AAAGCCCAGGAGCTGGGGGAGGG + Intergenic
1050000481 9:1072192-1072214 AAATCAAAGGAGCTGGATGCTGG + Intergenic
1050964514 9:11781434-11781456 ACATCCAATGAGCTGGGGGCCGG - Intergenic
1053684078 9:40505473-40505495 AGTTGCCAGGAGCTGGGGGAGGG + Intergenic
1054297173 9:63340937-63340959 AGTTGCCAGGAGCTGGGGGAGGG + Intergenic
1054395193 9:64645445-64645467 AGTTGCCAGGAGCTGGGGGAGGG + Intergenic
1054429840 9:65150645-65150667 AGTTGCCAGGAGCTGGGGGAGGG + Intergenic
1057229477 9:93311069-93311091 AGTTCCCAGGGGCTGGGGGAGGG - Intronic
1057502053 9:95603766-95603788 AATGTCAAGGAGGTGTGGGCAGG - Intergenic
1058129474 9:101233689-101233711 AATATCAAGGAGCTGGGATCTGG - Intronic
1059144398 9:111885297-111885319 AGTTACCAGGAGCTGGGGGGAGG + Intergenic
1060082751 9:120666908-120666930 GTTTGCCAGGAGCTGGGGGCAGG + Intronic
1061221945 9:129257291-129257313 AATAAAAAGGAGCTGGGGGAGGG - Intergenic
1061335721 9:129933855-129933877 AATTCAAAGCAGCTGGATGCAGG - Intronic
1061600910 9:131669500-131669522 ACTTGCAAGGTGCTGGGGTCAGG + Intronic
1061810333 9:133158841-133158863 GGTTCCCAGGGGCTGGGGGCGGG - Intronic
1062275316 9:135727688-135727710 AGTACCCAGGGGCTGGGGGCCGG - Intronic
1185783926 X:2873739-2873761 AGTTGCCAGGGGCTGGGGGCGGG - Intronic
1186285992 X:8044859-8044881 AGTTCCATGTGGCTGGGGGCTGG + Intergenic
1186386012 X:9110824-9110846 AAGTCCACGGAGGTGGGAGCAGG - Intronic
1186580273 X:10810175-10810197 GATTACCAGGAGCTGGGGGAAGG - Intronic
1187569900 X:20490229-20490251 AATGCCAAGGAGATATGGGCAGG - Intergenic
1187717326 X:22115599-22115621 AGTTGCCAGGGGCTGGGGGCAGG - Intronic
1188368543 X:29340348-29340370 AATTGCCAAGAGCTGGGGGTAGG - Intronic
1189285768 X:39851337-39851359 ACTTGAAAAGAGCTGGGGGCTGG + Intergenic
1190439642 X:50464384-50464406 AATTCCAAGAAGCAGGGGCGCGG - Intronic
1191842539 X:65523559-65523581 CATCCGAAGGAGTTGGGGGCTGG + Exonic
1191900951 X:66040186-66040208 AACCCCAAGGAGGTGGGGGAAGG - Intergenic
1192016002 X:67331921-67331943 AATTCACAGGGGATGGGGGCAGG - Intergenic
1192581872 X:72289873-72289895 AATTTAAAGGAGGAGGGGGCCGG - Intronic
1195199960 X:102539252-102539274 AATGGCCTGGAGCTGGGGGCGGG + Intergenic
1196036785 X:111154122-111154144 AGTTGCCAGGAGCTGGGAGCAGG + Intronic
1196441165 X:115721425-115721447 AATTACCAGGAGGTGGGGGGAGG - Intergenic
1196444693 X:115839413-115839435 AATTACCAGGAGGTGGGGGGAGG - Intergenic
1199482565 X:148313045-148313067 AATTACAATGCACTGGGGGCAGG - Intergenic