ID: 1026619841

View in Genome Browser
Species Human (GRCh38)
Location 7:71940694-71940716
Sequence TCGCAGGATCGCTTGAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127351
Summary {0: 1, 1: 55, 2: 4168, 3: 33294, 4: 89833}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026619841 Original CRISPR TCGCAGGATCGCTTGAGCCC TGG (reversed) Intronic
Too many off-targets to display for this crispr