ID: 1026626400

View in Genome Browser
Species Human (GRCh38)
Location 7:71996235-71996257
Sequence TATTTCATCTGGTAGCTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 402}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026626400 Original CRISPR TATTTCATCTGGTAGCTTCA TGG (reversed) Intronic
902567237 1:17320111-17320133 TATTCCTTCTGGAAGCTCCAGGG + Intronic
905086675 1:35385849-35385871 TCATTTATCTGGTAGTTTCAGGG + Intronic
905607123 1:39311846-39311868 AATTTGATCTGGGAGCTTAAAGG + Intronic
908617026 1:65933101-65933123 CATTTCATCTGGTATCTGCTGGG - Intronic
908759405 1:67498198-67498220 TATTTCATATGGAAGCTCTAGGG - Intergenic
909418601 1:75435932-75435954 CATTTCACCTGTTAACTTCAGGG + Intronic
910617818 1:89218790-89218812 TATTCCTTCTGGTGGGTTCACGG + Intergenic
913279603 1:117173224-117173246 TATTCCTTCTGGTGGGTTCATGG - Intronic
913301725 1:117377574-117377596 TATGTCATGTTATAGCTTCAGGG - Intronic
915251141 1:154589528-154589550 TATTTGTTCTGAAAGCTTCAAGG + Intronic
916196555 1:162229113-162229135 TATTTCACCTGTTAGGATCATGG - Intronic
918542520 1:185648072-185648094 TCTTCCTTCTGGTAGGTTCATGG + Intergenic
918950442 1:191129282-191129304 TGTTTCTTCTGATAGCTTCAGGG - Intergenic
919086957 1:192931950-192931972 CATTCCTTCTGGAAGCTTCAGGG + Intergenic
919147582 1:193655153-193655175 TATCTCATCTGGTGGGTACATGG + Intergenic
919206904 1:194430525-194430547 TCTTCCTTCTGGTAGGTTCATGG + Intergenic
919254813 1:195107297-195107319 TTTTTGATCTTTTAGCTTCAGGG - Intergenic
920013920 1:202890183-202890205 TGTTCCCTCTGCTAGCTTCAGGG - Intergenic
923669296 1:236026251-236026273 TCTGTCATCTGGTAGCCTTATGG - Intronic
1063573070 10:7234701-7234723 TATTTCATCTGATATCTGTAGGG - Intronic
1067225199 10:44371597-44371619 TATTTCAAATTGGAGCTTCATGG - Intronic
1067841387 10:49682275-49682297 TATTCCTTCTGGTGGGTTCATGG + Intronic
1067967987 10:50935720-50935742 TATTTCCTCTGTTATCTTCCAGG + Intergenic
1069294944 10:66831822-66831844 TCTTTTATCTGATATCTTCAGGG + Intronic
1069973124 10:72190375-72190397 GATTTCTTCTGATAGCTTTATGG - Intronic
1070997359 10:80797387-80797409 TATTTCCTCTGGAGGCTTCAGGG + Intergenic
1071220836 10:83463217-83463239 TCTTTCCTCTGGTGGGTTCATGG - Intergenic
1072994661 10:100232317-100232339 GATTTCATTTGGTAGTTTAAAGG + Exonic
1074961407 10:118449160-118449182 GATTTAATCTGGAATCTTCATGG - Intergenic
1078446061 11:11405727-11405749 TCTTCCATCTGATAGCTTCTAGG - Intronic
1079442177 11:20525955-20525977 TATTTCATATGGTTGCTGCAAGG + Intergenic
1079803022 11:24895371-24895393 TTTTTCATCTTTTAGATTCAGGG + Intronic
1081510570 11:43768593-43768615 TATTCCTTCTGGTGGGTTCATGG + Intronic
1081920509 11:46770975-46770997 TATTTCTTTTGGCAGCTTCTGGG - Exonic
1082753622 11:57049514-57049536 TATATCAGCTGCTATCTTCAGGG - Intergenic
1084244826 11:67849881-67849903 TGTTAGATCGGGTAGCTTCAGGG + Intergenic
1084992530 11:72940911-72940933 GATTTCTTCTGATAGCTTTATGG - Intronic
1085886802 11:80531851-80531873 TCTTTCTTCTGGTGGGTTCATGG + Intergenic
1086200304 11:84194347-84194369 TCTTTCTTCTGGTGGGTTCATGG + Intronic
1087251637 11:95906983-95907005 TATTTCTTCTGCTAGCTTTGGGG - Intronic
1088239689 11:107760308-107760330 TATTCCTTCTGGTGGGTTCACGG + Intergenic
1089099499 11:115950369-115950391 GATTTCTTCTGATAGCTTTATGG + Intergenic
1091942915 12:4505741-4505763 TTTTTCATCTGGGAGGTTCAGGG + Intronic
1094722711 12:33080861-33080883 TATTTCATCTAGTTGGTTAAAGG - Intergenic
1095188901 12:39233237-39233259 TATGTCATCTGGTTGCTCCTAGG - Intergenic
1095762596 12:45856430-45856452 TATTTGAATTGGTAGCTTAAAGG + Intronic
1096261149 12:50092547-50092569 TCTGTCATCTTGTAGGTTCAGGG - Intronic
1099081822 12:78193249-78193271 TATTCCAGCTGGCAGCTTGAGGG - Intronic
1099569304 12:84295469-84295491 TATTTAATATGGTAGATTCAAGG + Intergenic
1099964798 12:89434305-89434327 TATTTCAGTTGATAGCTACATGG - Intronic
1100096718 12:91048119-91048141 TATATCATTTGAAAGCTTCAGGG + Intergenic
1104997393 12:132667061-132667083 TATTTCATCCGGTAGGAACATGG - Intronic
1105836475 13:24216602-24216624 CCTTTGATCTGGTACCTTCAGGG - Intronic
1107790974 13:44002023-44002045 TATTCCTTCTGGTAGGTTCTTGG - Intergenic
1107942432 13:45386677-45386699 TATTTCTTCTGGTGGATTCTTGG + Intergenic
1108970970 13:56376249-56376271 CATTTCTTCTGGAGGCTTCAGGG - Intergenic
1109285300 13:60401565-60401587 TATTTCATATGCTACCTTAAAGG - Intronic
1109291316 13:60478718-60478740 CTTTTCTTCTGCTAGCTTCAGGG + Intronic
1111144722 13:84165567-84165589 TATTTCTTCTGTTAGCTTAGTGG + Intergenic
1111239908 13:85459866-85459888 TATTCCTTCTGGTGGGTTCATGG - Intergenic
1112214503 13:97416503-97416525 TAATTCATAGGGTGGCTTCATGG + Intergenic
1112526283 13:100150660-100150682 GATTTCTTCTGATAGCTTTATGG + Intronic
1114253172 14:20979075-20979097 GCTTTCATTTGGTACCTTCAGGG + Intergenic
1115096358 14:29641036-29641058 TATTTCATTTATTACCTTCAAGG + Intronic
1115437538 14:33392667-33392689 CATTTCATCTGTTAGCTTTCAGG - Intronic
1117573031 14:57068270-57068292 TATTTCATCTGGTGCTTTCAAGG - Intergenic
1121089889 14:91173949-91173971 TATTTTGTCTGATAGGTTCAGGG + Intronic
1121551062 14:94801027-94801049 GATTTCTTCTGATAGCTTTATGG + Intergenic
1123909341 15:24951201-24951223 TAGGTCATATGGTAACTTCAGGG + Intronic
1124198447 15:27655802-27655824 TCTTCCTTCTGGTAGGTTCATGG + Intergenic
1124414665 15:29465178-29465200 GTTTTCATCTGGTGGCTTCTGGG - Intronic
1125306190 15:38318452-38318474 AATTTCATCTTTTAGATTCAAGG + Intronic
1125418117 15:39474492-39474514 TATGGCATCTTCTAGCTTCATGG + Intergenic
1128242879 15:66113396-66113418 GATTTCACCTGGAAGCTTGAGGG + Intronic
1129014616 15:72455537-72455559 TGTTTCAGGTGGTAGCTGCAGGG - Intergenic
1129354104 15:74976411-74976433 GATTTCTTCTGATAGCTTTATGG + Intronic
1133491580 16:6275123-6275145 TATTTTATCTGCAAGCTTCAGGG + Intronic
1135990198 16:27214064-27214086 TATTTCTGCTCTTAGCTTCAGGG - Intronic
1137474824 16:48798652-48798674 CATTCCTTCTGGAAGCTTCAGGG + Intergenic
1138258019 16:55586669-55586691 TATTTCTTCTGGTGGGTTCTTGG + Exonic
1141198081 16:81876587-81876609 AATTTCTTCTGGTAGCTAAAAGG - Intronic
1143460380 17:7100069-7100091 TCTTCCTTCTGGTAGGTTCATGG + Intergenic
1145867324 17:28249699-28249721 CATTTTATCTGGCAGCTTAAGGG + Intergenic
1146306291 17:31732354-31732376 TCTTTCTTCTGGTGGATTCATGG - Intergenic
1149017618 17:51926570-51926592 TATTCCTTCTGGAAGCTCCAAGG + Intronic
1149149499 17:53543361-53543383 ATTTTCTTCTGGTAGTTTCATGG + Intergenic
1149252731 17:54788498-54788520 TGTTTCATCTGGTTGCTTTTTGG - Intergenic
1150031821 17:61745869-61745891 TATTTCATTTTCTAGCTTCTTGG - Intronic
1150173841 17:63028770-63028792 TCTTTCATATGGTAACTCCATGG + Intronic
1150629941 17:66872782-66872804 CATATCTTCTGGTAGCTTCTTGG - Intronic
1150655289 17:67035150-67035172 TGTTTCTTCTGGAAGCTCCAGGG - Intergenic
1151417903 17:73978596-73978618 TAAGTGATCTGGTAGCATCAAGG - Intergenic
1153602881 18:6799058-6799080 CTTTTCATCTGGTAGGATCAGGG + Intronic
1155602879 18:27569400-27569422 TCTTCCTTCTGGTAGGTTCATGG + Intergenic
1158516811 18:58137726-58137748 TATTTGATGTGGTAGCGACAGGG - Intronic
1159419117 18:68193064-68193086 TTTTTCTTCTGGTAGCTTTGTGG + Intergenic
1162107602 19:8379753-8379775 TATTCCTTCTGGTAGGTTCGTGG - Intronic
1164029573 19:21390317-21390339 TATTCCATCTGGTGGATTCTTGG - Intergenic
1164162889 19:22641125-22641147 TATTTCTTCTGCTAGCTTAGGGG + Intronic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1164898671 19:31899475-31899497 GATTGCACCTGGGAGCTTCAAGG - Intergenic
1165652451 19:37503215-37503237 TGTTTTATGTGGTAGTTTCATGG - Intergenic
1168660030 19:58158256-58158278 TCTTCCTTCTGGTGGCTTCATGG - Intergenic
926511484 2:13785859-13785881 GTTTTCATCTAGTAGGTTCAAGG - Intergenic
926603457 2:14872562-14872584 TATTCCTACTGGTAGGTTCACGG + Intergenic
926981595 2:18577729-18577751 TATTTCTTCTGTTAGCTCTAAGG - Intronic
928374816 2:30765584-30765606 CCTTTCATCTGGAAGCTGCAGGG + Intronic
928740712 2:34348861-34348883 TATTTCATCTGTTTATTTCATGG + Intergenic
930346019 2:50182005-50182027 TATCTTTTTTGGTAGCTTCAAGG + Intronic
930714689 2:54582333-54582355 TAATTCATCTTGCACCTTCAAGG - Intronic
931053836 2:58444995-58445017 TAATTCATCTGGTTTCTTTAAGG - Intergenic
932759791 2:74431660-74431682 GCCTTCTTCTGGTAGCTTCATGG + Intronic
932871003 2:75397836-75397858 TATTGGATCTGGGAGCTTCTTGG - Intergenic
933139956 2:78780039-78780061 TCTTCCTTCTGGTGGCTTCATGG - Intergenic
935081020 2:99794507-99794529 TTGTTCATCTAGTAGCTCCATGG + Intronic
936232933 2:110720130-110720152 TGTGTAATTTGGTAGCTTCAAGG - Intergenic
937697050 2:124819629-124819651 GATTTCATCCTTTAGCTTCAGGG + Intronic
938620118 2:133042940-133042962 AATTTCATCTGATAGTTGCAAGG + Intronic
939012940 2:136868144-136868166 TATTTCAACTTGCATCTTCAAGG - Intronic
939085831 2:137716901-137716923 TATTCCTTCTGGTGGGTTCATGG - Intergenic
939134670 2:138279015-138279037 GATTTCTTCTGATAGCTTTATGG - Intergenic
939255921 2:139744612-139744634 TATTCCTTCTGGTAGGTTCTTGG - Intergenic
939486877 2:142825509-142825531 TGTTTCCTCTGGAAGCTTCAGGG - Intergenic
940186517 2:150991035-150991057 GTTTTCTTCTAGTAGCTTCATGG - Intergenic
940432880 2:153614326-153614348 TATTTCATTTGGAAGGTTCTTGG + Intergenic
941828512 2:169926823-169926845 TATTTCTTCTTGTAGATTTAAGG + Exonic
943188776 2:184649395-184649417 CTTTTCATCTGGTAGCTTTGGGG - Intronic
943222997 2:185133718-185133740 TCTTCCTTCTGGTAGGTTCATGG - Intergenic
943855022 2:192778515-192778537 TATTTCTTCTGGTGGGTTCTTGG + Intergenic
943905938 2:193501605-193501627 TCTTCCTTCTGGTAGGTTCATGG + Intergenic
944947126 2:204701746-204701768 TTTTTCAACTTTTAGCTTCAGGG + Intronic
945411770 2:209517957-209517979 TCTTTCATCTCATAGTTTCATGG + Intronic
945548753 2:211192316-211192338 CATTCCATCTGGTAACTACAAGG + Intergenic
946764368 2:223026290-223026312 TATTTCATGTCCTTGCTTCAAGG + Intergenic
1169409629 20:5356535-5356557 TATTCCTTCTGGAATCTTCAGGG - Intergenic
1170825027 20:19786405-19786427 TCTTTCTTCATGTAGCTTCAGGG - Intergenic
1175658188 20:60790142-60790164 TATTCCATCTGGTGGGTTCGTGG + Intergenic
1177315335 21:19453503-19453525 TATTTCACATGGTATCTTTATGG + Intergenic
1177468562 21:21523294-21523316 TTTTTCTTCTAGTAGTTTCACGG + Intronic
1177815085 21:25967859-25967881 TATTTAATCTGGTAGCTTGCAGG + Intronic
1178477021 21:32945939-32945961 TATATCAGCTGGTACCTTCAAGG + Intergenic
1178754851 21:35338863-35338885 TATTTCACCTGGATGCTTTATGG - Intronic
1179432347 21:41331540-41331562 TATTTTATCTAGTAATTTCATGG + Intronic
1181996519 22:26887084-26887106 GATTTCTTCTGATAGCTTTATGG + Intergenic
1182964695 22:34510042-34510064 TGTTTCTTAGGGTAGCTTCATGG - Intergenic
949523894 3:4884214-4884236 TTTGTCTTCTGGTAGCTTCAAGG + Intronic
950418694 3:12883825-12883847 TCTTTCTTCTGGTAGGTTCCTGG - Intergenic
951437418 3:22680734-22680756 TCTTTCTTCTGGTATCCTCATGG - Intergenic
951437422 3:22680768-22680790 TCTTTCCTCTGGTATCCTCATGG - Intergenic
951555793 3:23919300-23919322 GATTTCTTCTGATAGCTTTATGG - Exonic
951842234 3:27046873-27046895 TGTTTCATCTGGTGTCATCAAGG - Intergenic
952555364 3:34524017-34524039 TCTTTCTTCTGGTGGGTTCATGG + Intergenic
952631109 3:35468646-35468668 TATTCCTTCTGGTGGGTTCATGG + Intergenic
953500846 3:43432498-43432520 CATTTAAACTGGTAACTTCAAGG + Intronic
956311760 3:67888645-67888667 TATTCCTTCTGGTGGGTTCATGG - Intergenic
956350322 3:68328012-68328034 TTTTTAATATGGTACCTTCAAGG + Intronic
956859754 3:73310749-73310771 TATTTGATTTGGTAGCTTTGGGG + Intergenic
958457425 3:94349007-94349029 TATTCCTTCTGGTAGGTTCTTGG - Intergenic
959136289 3:102425859-102425881 TATTTCATCTAGTAGGCTTAAGG - Intronic
959871535 3:111334097-111334119 AATTTTATTTGGTAGCATCAAGG + Intronic
961982989 3:131101258-131101280 TTTTTCTTCTGCTAGCTTTAGGG + Intronic
962101540 3:132347792-132347814 TATTTCATCATTTAACTTCAGGG + Intronic
962762778 3:138531594-138531616 CATTTTATCAAGTAGCTTCAGGG - Intronic
966245895 3:177807963-177807985 TGTTTCTTCTGGTGGGTTCATGG + Intergenic
966372034 3:179260701-179260723 CATTTCCTCTGTTTGCTTCAGGG + Intronic
967146561 3:186611668-186611690 TTTTTCATCTGGAAGAATCATGG + Intergenic
967682448 3:192380263-192380285 TATTTCATCTGTTTGCTTAATGG + Intronic
970928957 4:21486402-21486424 TATCTCATCTTCTAGGTTCAGGG - Intronic
971263834 4:25081006-25081028 AATTTCATCTGGTGACTGCAGGG - Intergenic
971614285 4:28767068-28767090 TTTTTCTTCTGCTAGCTTTAGGG - Intergenic
971700257 4:29963568-29963590 AATTGTATTTGGTAGCTTCAAGG - Intergenic
973034367 4:45387779-45387801 CTTTTCTTCTGGTAGCTTCGGGG + Intergenic
973219234 4:47706786-47706808 GATTTCTTCTGATAGCTTTATGG - Intronic
973717873 4:53695074-53695096 TTTCTCATCTGGTAACCTCAAGG + Intronic
973856128 4:55011630-55011652 TGTTTCATCTGATAAATTCAAGG - Intergenic
974794301 4:66729052-66729074 CAGTTCATCTGGTAGCTTGCAGG + Intergenic
974807388 4:66898325-66898347 TCTTCCTTCTGGTAGGTTCATGG + Intergenic
975915976 4:79325789-79325811 TATTTCATCTGGTAGTTCTCAGG + Exonic
976122335 4:81796925-81796947 ATTTTCTTCTAGTAGCTTCATGG - Intronic
976329139 4:83808652-83808674 AATTACATCTGGAAGCATCATGG - Intergenic
976419662 4:84826626-84826648 TATTTGATCTGCTAGATTAAAGG + Intronic
976541836 4:86286512-86286534 TATATCATCTGGTTGCTATAAGG - Intronic
978132166 4:105212070-105212092 TTATTCCTTTGGTAGCTTCAAGG + Intronic
980054817 4:128069193-128069215 GATTTCTTCTGATAGCTTTATGG + Intronic
980252058 4:130330171-130330193 TCTCTGATCTGGGAGCTTCATGG - Intergenic
980817195 4:137963719-137963741 TACTTCACATGGTAGCTTAAAGG + Intergenic
981661414 4:147171339-147171361 TATTTCATGTGGTTAGTTCAGGG - Intergenic
982700793 4:158658206-158658228 TATTCCTTCTGGTGGCCTCATGG - Intergenic
984239979 4:177206580-177206602 TTTTTCATCTCCTAGCTTAATGG + Intergenic
985384160 4:189427768-189427790 TATTTAATATCCTAGCTTCATGG - Intergenic
985403452 4:189614490-189614512 TCTTCCATCTGGTGGATTCATGG + Intergenic
987870595 5:23612272-23612294 TATTTCATCTTGCTGCTTTAAGG + Intergenic
987983748 5:25120374-25120396 TATTTCATCAGAAATCTTCAAGG - Intergenic
988045294 5:25943544-25943566 TATTTCATATGGTTACTTTATGG + Intergenic
988605849 5:32677797-32677819 TCTTTCTTCTGGTGGGTTCAGGG + Intergenic
988619120 5:32804396-32804418 GATTTCTTCTGGTGGATTCATGG + Intergenic
990063855 5:51687531-51687553 TAAAACATCTGGTAGCATCAAGG + Intergenic
990880375 5:60531372-60531394 TCTTTCTTCTGGTGGGTTCACGG - Intergenic
991035275 5:62122235-62122257 TCTTTCATCTTTTTGCTTCAGGG + Intergenic
991462526 5:66874324-66874346 TATTTGATATGGGAGCATCAGGG + Intronic
995863562 5:116666081-116666103 TATTCCATGTGGTTGTTTCATGG + Intergenic
996074492 5:119174242-119174264 TTTTTCAAATGGTAGTTTCAGGG + Intronic
998051934 5:139043147-139043169 TCTTTCCTCTTCTAGCTTCAAGG - Intronic
999380164 5:151115842-151115864 TATTTGATGTGGAAGCTGCAGGG + Intronic
999847554 5:155501382-155501404 TATTTTCTCTGGTTTCTTCAAGG - Intergenic
1000644959 5:163750162-163750184 TATTCCTTCTGGTGGATTCATGG + Intergenic
1003359053 6:5406350-5406372 TGATTCTGCTGGTAGCTTCATGG - Intronic
1003753488 6:9089381-9089403 TATTTTAACTGGTATATTCAAGG - Intergenic
1004045232 6:12017360-12017382 TCTTTCTTCTGGTAGGTTCGTGG + Intronic
1004092142 6:12514523-12514545 GATTTCTTCTGATAGCTTTATGG - Intergenic
1005976866 6:30806853-30806875 TCTTCCTTCTGGTAGGTTCATGG + Intergenic
1006350932 6:33520703-33520725 TCTTCCTTCTGGTGGCTTCATGG + Intergenic
1006715073 6:36113019-36113041 TATATAATTTGGTAGCTGCAAGG + Intergenic
1007737919 6:43993336-43993358 CATGTCATCTGGGAGCTGCAGGG - Intergenic
1008446644 6:51599293-51599315 TATTCCTTCTGGTGGGTTCATGG - Intergenic
1008702657 6:54119959-54119981 TATTTCACCTGCTTCCTTCAGGG + Intronic
1009664208 6:66654831-66654853 TCTTCCTTCTGGTAGTTTCATGG + Intergenic
1009983450 6:70753743-70753765 TATGTCATCTTGGAGCTTAATGG + Intronic
1010117131 6:72327040-72327062 TGTTTCATCTGGAGGCTTTAGGG - Intronic
1011021525 6:82818823-82818845 TATGTCATCTGGCAGCCTCTGGG - Intergenic
1013547653 6:111174676-111174698 TCTTTGATCTGGAAGCTTCCAGG + Intronic
1016858632 6:148696430-148696452 TCTTTCTTCTGGTGGGTTCATGG + Intergenic
1018076449 6:160219648-160219670 TATTTCATAGGGTTGCTGCAAGG + Intronic
1020647627 7:10834087-10834109 TATTTCAACTTTTAGATTCAGGG - Intergenic
1022186103 7:27970984-27971006 TCTGTCATCTGGAATCTTCACGG - Intronic
1022545270 7:31181666-31181688 TATTTCCTATGTTATCTTCAAGG + Intergenic
1022847831 7:34228494-34228516 AATCACATCTGGGAGCTTCAGGG + Intergenic
1023672645 7:42594159-42594181 CGTTTCTTCTGGAAGCTTCAGGG - Intergenic
1024710926 7:52013751-52013773 TCTGTCATCTGCTGGCTTCAAGG - Intergenic
1026344938 7:69465675-69465697 TCTTTTGTCTGATAGCTTCAGGG - Intergenic
1026511977 7:71034916-71034938 CATTTCATCTGTTTTCTTCACGG - Intergenic
1026626400 7:71996235-71996257 TATTTCATCTGGTAGCTTCATGG - Intronic
1027533799 7:79369524-79369546 CATTTCTCCTGGTAGCATCATGG - Intronic
1027549885 7:79577561-79577583 TATTTCATTTGGTAACTGCCAGG - Intergenic
1027662482 7:81003949-81003971 TATTTTATCTGTTAGTTTGAGGG + Intergenic
1028013003 7:85672833-85672855 TCTTCCTTCTGGTAGGTTCATGG - Intergenic
1029840508 7:103358058-103358080 TACATCCTCTGGTAGCTTCTTGG + Intronic
1030014149 7:105201618-105201640 TTTTTCTTCTGGTAGCGACAGGG - Intronic
1031509693 7:122634685-122634707 TATTTCTTCTGCTAGCTTTGGGG + Intronic
1033884739 7:145931640-145931662 TATATCATGTGGTTTCTTCAGGG + Intergenic
1037373234 8:18202429-18202451 TATTCCTTCTGGTAGGTTCTTGG + Intronic
1037488091 8:19367972-19367994 ATTTTCTTTTGGTAGCTTCATGG + Intronic
1039135369 8:34316699-34316721 CATTTCTTCTGGAGGCTTCAGGG + Intergenic
1041560150 8:59208528-59208550 TTTTTCATCTGCTATCTACAAGG - Intergenic
1042461240 8:69071659-69071681 TTTTTCCTCTGGAGGCTTCACGG + Intergenic
1043696044 8:83219014-83219036 TATTTCTTCTGCTAGCTTTGTGG + Intergenic
1044119648 8:88378962-88378984 TTTATCCTCTGGTAGCTGCAGGG + Intergenic
1044462570 8:92462810-92462832 TATTGAATCTGATAGCTTTATGG - Intergenic
1044596379 8:93962724-93962746 TATTTCAGCTTTTAGGTTCAGGG + Intergenic
1044708578 8:95032890-95032912 TTTTTCCTCTGGTATCTTCCTGG + Intronic
1045032018 8:98146057-98146079 TATTTCAACTACTGGCTTCAGGG - Intronic
1047338703 8:123959411-123959433 TATTTTATCTTGCTGCTTCAAGG + Intronic
1047401495 8:124552303-124552325 AATTTCTTCTGGTAGCTTCATGG - Intronic
1047742744 8:127819918-127819940 AGTCTCATCTGGCAGCTTCAAGG + Intergenic
1048784493 8:138035935-138035957 TATCTATTGTGGTAGCTTCATGG - Intergenic
1048883672 8:138891218-138891240 TATCTCATCTGATTGCTTAATGG + Intronic
1049963560 9:758491-758513 TTTTTTGTCTGGTAGCCTCATGG + Intergenic
1050248492 9:3717559-3717581 TCCATCATCTGATAGCTTCATGG + Intergenic
1050411959 9:5375481-5375503 TATTTCATTTGGTACATTTAGGG - Intronic
1050849793 9:10269151-10269173 TGTTTAATCTGGTATGTTCAAGG - Intronic
1051078557 9:13269472-13269494 TATTTCATCTTGGAGCTTGCAGG - Intronic
1051973529 9:22921013-22921035 TAAGCCATCTTGTAGCTTCATGG - Intergenic
1052705146 9:31986155-31986177 TATTTACTCTGGTAACTTCAGGG - Intergenic
1053418532 9:37962134-37962156 TACATCATCTGTTACCTTCACGG - Intronic
1055215744 9:73859650-73859672 AATTCCATCTGGTAACTTCCAGG - Intergenic
1055241745 9:74194639-74194661 TATTCCTTCTGGTAGGTTCTTGG + Intergenic
1055516538 9:77039572-77039594 AATTTCATTTGGCAGCTTCGAGG - Intergenic
1058379406 9:104362034-104362056 TCTTTCTTCTGGTGGGTTCATGG + Intergenic
1058804895 9:108581361-108581383 CATTTGATCTCTTAGCTTCATGG - Intergenic
1186069710 X:5805435-5805457 TATGTCATCTGTTAGCTTCATGG + Intergenic
1186602691 X:11055327-11055349 AATTTCATCTGTTAGTTTAATGG + Intergenic
1186891296 X:13961535-13961557 TATTCCTTCTGGAGGCTTCAGGG - Intergenic
1187034269 X:15521545-15521567 TGTTTCCTCTGGAAGCTTTAGGG + Intronic
1188339369 X:28979871-28979893 AATTTCATGTGGTAGATTAAGGG - Intronic
1189593032 X:42535838-42535860 CATTTCATCTGGCAGCTTTATGG - Intergenic
1189887290 X:45561171-45561193 TATTTCTTCTGCTAGCTTTGGGG + Intergenic
1189917234 X:45867827-45867849 TATTGCATCTGGTTTCTTTAAGG + Intergenic
1190543879 X:51504926-51504948 TATGGCATCTGGTACCTACATGG - Intergenic
1192861318 X:75074974-75074996 TGTTTCAACTTTTAGCTTCAGGG - Intronic
1192886964 X:75345757-75345779 TTTATCTTCTGCTAGCTTCAGGG + Intergenic
1193040535 X:76999238-76999260 TATTTCACCTGGGAAATTCAAGG - Intergenic
1193090416 X:77488072-77488094 TATTTCATATGTTATCTTCCAGG - Intergenic
1193138942 X:78005110-78005132 TATTTCTTCTAGTAATTTCATGG - Intronic
1193411470 X:81168532-81168554 TATTTCATCTGGGAATTTCCAGG - Intronic
1194904652 X:99559628-99559650 ATTTCCATCTGGTAGCTTTATGG - Intergenic
1195382239 X:104281835-104281857 TACTTCACCTGGTATCTTCCTGG - Intergenic
1196488652 X:116243944-116243966 TATTCCTTCTGGTGGGTTCATGG - Intergenic
1198919627 X:141710912-141710934 AATTTTATATGGTTGCTTCAAGG + Intergenic
1199248785 X:145636635-145636657 TATTTCCTCTGCTAGCTTTTGGG - Intergenic
1199681867 X:150230480-150230502 TAGTTCTTCTGGTATTTTCAGGG + Intergenic
1199792642 X:151169487-151169509 TATTTTATCTGGCAGCTCTATGG - Intergenic
1200147518 X:153934408-153934430 TATTTCATCTGGTAGTTCTCGGG + Exonic
1200784330 Y:7246478-7246500 TATTTCTTCTGGTGGGTTCTTGG + Intergenic
1200880201 Y:8204778-8204800 TATTCCTTCTGGTAGATTCTTGG + Intergenic
1201525184 Y:14925323-14925345 TATGCCATCTATTAGCTTCATGG - Intergenic
1201993411 Y:20055040-20055062 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1201993526 Y:20056539-20056561 TCTTGCTTCTGGTAGATTCATGG + Intergenic
1201993602 Y:20057539-20057561 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1201993619 Y:20057789-20057811 TCTTGCTTCTGGTAGATTCATGG + Intergenic
1201993769 Y:20059790-20059812 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1201993849 Y:20060968-20060990 TCTTCCATCTGGCAGGTTCATGG - Intergenic
1201994247 Y:20066487-20066509 TCTTTCTTCTGGCAGGTTCATGG - Intergenic
1201994359 Y:20068115-20068137 TCTTTCTTCTGGCAGGTTCATGG - Intergenic
1201994611 Y:20071363-20071385 TCTTCCATCTGGCAGGTTCATGG - Intergenic
1201994729 Y:20072988-20073010 TCTTCCATCTGGCAGGTTCATGG - Intergenic
1201994765 Y:20073493-20073515 TCTTCCATCTGGCAGGTTCATGG - Intergenic
1201994850 Y:20074618-20074640 TCTTCCATCTGGCAGGTTCATGG - Intergenic
1201994973 Y:20076236-20076258 TCTTCCTTCTGGTAGGTTCATGG - Intergenic
1201995160 Y:20078739-20078761 TCTTCCATCTGGCAGGTTCAAGG - Intergenic
1201995290 Y:20080492-20080514 TCTTCCATCTGGCAGGTTCATGG - Intergenic
1201995435 Y:20082374-20082396 TGTTTCTTCTGGCAGGTTCATGG - Intergenic
1201995504 Y:20083136-20083158 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1201995601 Y:20084644-20084666 TCTTTCTTCTGGCAGCTTCATGG + Intergenic
1201995961 Y:20089377-20089399 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1201996192 Y:20092641-20092663 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1201996293 Y:20093895-20093917 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1201996308 Y:20094149-20094171 TTTTTCTTCTGGCAGTTTCATGG + Intergenic
1201996339 Y:20094528-20094550 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1201996381 Y:20095071-20095093 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1201996414 Y:20095571-20095593 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1201996436 Y:20095821-20095843 TCTTTCATCTGGCAGGTTCATGG + Intergenic
1201996443 Y:20095946-20095968 TCTTTCTTCTGGCAGTTTCATGG + Intergenic
1201996611 Y:20098073-20098095 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1201996633 Y:20098323-20098345 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1201996694 Y:20099076-20099098 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1201996794 Y:20100325-20100347 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1201997065 Y:20103973-20103995 TCTTCCTTCTGGCAGCTTCATGG + Intergenic
1201997241 Y:20106350-20106372 TCTTCCTTCTGGCAGCTTCATGG + Intergenic
1201997394 Y:20108474-20108496 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1201997420 Y:20108849-20108871 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1201997504 Y:20109857-20109879 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1201997521 Y:20110107-20110129 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1201997580 Y:20110865-20110887 TCTTTCTTCTGGCAGTTTCATGG + Intergenic
1201997770 Y:20113246-20113268 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1201997778 Y:20113371-20113393 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1201997815 Y:20113874-20113896 TCTTTCATCTGGCAGGTTCATGG + Intergenic
1201997865 Y:20114503-20114525 TCTTTCATCTGGCAGGTTCATGG + Intergenic
1201998016 Y:20116511-20116533 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1201998331 Y:20120645-20120667 TCTTTCTTCTGGCAGGTTCAAGG + Intergenic
1201998720 Y:20125754-20125776 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1201998801 Y:20126753-20126775 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1201998882 Y:20127881-20127903 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1201998946 Y:20128755-20128777 TCTTTCTTCTGGTAGGTTCATGG + Intergenic
1201999153 Y:20131624-20131646 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1201999190 Y:20132125-20132147 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1201999232 Y:20132754-20132776 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1201999284 Y:20133502-20133524 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1201999494 Y:20136382-20136404 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1201999524 Y:20136757-20136779 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1201999553 Y:20137132-20137154 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1201999658 Y:20138507-20138529 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1201999753 Y:20139630-20139652 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1201999842 Y:20140885-20140907 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1201999888 Y:20141513-20141535 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1201999908 Y:20141763-20141785 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1202000048 Y:20143640-20143662 TCTTTCTTCTGGCAGTTTCATGG + Intergenic
1202000075 Y:20144015-20144037 TATTCCTTCTGGCAGGTTCATGG + Intergenic
1202000205 Y:20145898-20145920 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1202000475 Y:20149465-20149487 TCTTCCTTCTGGCAGCTTCATGG + Intergenic
1202000632 Y:20151595-20151617 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1202000735 Y:20152968-20152990 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1202000823 Y:20154220-20154242 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1202000906 Y:20155347-20155369 TCTTCCATCTGGTAGGTTCATGG + Intergenic
1202000930 Y:20155721-20155743 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1202000951 Y:20155971-20155993 TCTTTCATCTGGCAGGTTCATGG + Intergenic
1202000957 Y:20156096-20156118 TCTTTCTTCTGGCAGTTTCATGG + Intergenic
1202000973 Y:20156350-20156372 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1202001080 Y:20157737-20157759 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1202001117 Y:20158237-20158259 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1202001171 Y:20158862-20158884 TCTTTCTTCTGGCAGGTTCAAGG + Intergenic
1202001860 Y:20167828-20167850 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1202001997 Y:20169709-20169731 TCTTTCTTCTGGCAGTTTCATGG + Intergenic
1202002024 Y:20170084-20170106 TATTCCTTCTGGCAGGTTCATGG + Intergenic
1202002190 Y:20172470-20172492 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1202002582 Y:20177857-20177879 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1202002734 Y:20179860-20179882 TATTCCTTCTGGCAGGTTCATGG + Intergenic
1202002887 Y:20181866-20181888 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1202002911 Y:20182241-20182263 TCTTCCTTCTGGCAGCTTCATGG + Intergenic
1202003217 Y:20186250-20186272 TCTTCCTTCTGGCAGCTTCATGG + Intergenic
1202003378 Y:20188380-20188402 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1202003483 Y:20189753-20189775 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1202003699 Y:20192632-20192654 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1202003751 Y:20193260-20193282 TCTTTCATCTGGCAGGTTCATGG + Intergenic
1202003801 Y:20193889-20193911 TCTTTCATCTGGCAGGTTCATGG + Intergenic
1202005845 Y:20270572-20270594 TCTTCCTTCTGGCAGCTTCATGG + Intergenic
1202005899 Y:20271318-20271340 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1202005963 Y:20272192-20272214 TCTTTCTTCTGGTAGGTTCATGG + Intergenic
1202006267 Y:20276305-20276327 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1202006443 Y:20278675-20278697 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1202007509 Y:20292788-20292810 TCTTCCTTCTGGCAGCTTCATGG + Intergenic
1202007648 Y:20294662-20294684 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1202008586 Y:20307120-20307142 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1202008754 Y:20309240-20309262 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1202009694 Y:20321607-20321629 TCTTCCTTCTGGCAGCTTCATGG + Intergenic
1202009849 Y:20323607-20323629 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1202010099 Y:20326857-20326879 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1202010440 Y:20331231-20331253 TCTTCCTTCTGGCAGCTTCATGG + Intergenic
1202010579 Y:20333105-20333127 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1202011188 Y:20341104-20341126 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1202011386 Y:20343731-20343753 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1202011479 Y:20344981-20345003 TCTTCCTTCTGGCAGCTTCATGG + Intergenic
1203336063 Y_KI270740v1_random:1231-1253 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1203336178 Y_KI270740v1_random:2730-2752 TCTTGCTTCTGGTAGATTCATGG + Intergenic
1203336244 Y_KI270740v1_random:3605-3627 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1203336261 Y_KI270740v1_random:3855-3877 TCTTGCTTCTGGTAGATTCATGG + Intergenic
1203336410 Y_KI270740v1_random:5856-5878 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1203336633 Y_KI270740v1_random:8857-8879 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1203336799 Y_KI270740v1_random:11231-11253 TCTTTCTTCTGGCAGCTTCATGG + Intergenic
1203337143 Y_KI270740v1_random:15871-15893 TATTCCATTTGGCAGGTTCATGG + Intergenic
1203337153 Y_KI270740v1_random:15996-16018 TGTTTCTTCTGGCAGGTTCATGG + Intergenic
1203337165 Y_KI270740v1_random:16121-16143 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1203337272 Y_KI270740v1_random:17496-17518 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1203337305 Y_KI270740v1_random:17999-18021 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1203337367 Y_KI270740v1_random:18879-18901 TCTTTCTTCTGGTATGTTCATGG + Intergenic
1203337485 Y_KI270740v1_random:20383-20405 TGTTTCTTCTGGCAGGTTCATGG + Intergenic
1203337631 Y_KI270740v1_random:22265-22287 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1203337702 Y_KI270740v1_random:23269-23291 TCTTTCTTCTGGTATGTTCATGG + Intergenic
1203337763 Y_KI270740v1_random:24022-24044 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1203337785 Y_KI270740v1_random:24272-24294 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1203337845 Y_KI270740v1_random:25022-25044 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1203337924 Y_KI270740v1_random:26154-26176 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1203338021 Y_KI270740v1_random:27402-27424 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1203338178 Y_KI270740v1_random:29536-29558 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1203338200 Y_KI270740v1_random:29786-29808 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1203338261 Y_KI270740v1_random:30536-30558 TCTTCCATCTGGCAGGTTCAAGG + Intergenic
1203338306 Y_KI270740v1_random:31165-31187 TCTTTCTTCTGGCAGGTTCATGG + Intergenic
1203338550 Y_KI270740v1_random:34425-34447 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1203338572 Y_KI270740v1_random:34675-34697 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1203338633 Y_KI270740v1_random:35424-35446 TCTTCCATCTGGCAGGTTCATGG + Intergenic
1203338682 Y_KI270740v1_random:36053-36075 TCTTTCTTCTGGCAGGTTCATGG + Intergenic