ID: 1026627293

View in Genome Browser
Species Human (GRCh38)
Location 7:72006853-72006875
Sequence AGTTATTTTAGGAGTCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026627293 Original CRISPR AGTTATTTTAGGAGTCTGGG AGG (reversed) Intronic
900692024 1:3986803-3986825 TGGTGTGTTAGGAGTCTGGGTGG + Intergenic
902351849 1:15861731-15861753 TGTTATTTCAGCATTCTGGGAGG - Intronic
903933160 1:26875922-26875944 TGTAATTCTAGGACTCTGGGAGG - Intergenic
903987078 1:27235866-27235888 GGTGATTTTAGGAGCCTGGTAGG + Intronic
908719997 1:67114974-67114996 AGAAATTTTAGGAATCTGGCTGG - Intronic
911427200 1:97733142-97733164 AACTATTTTAGCAATCTGGGAGG + Intronic
913298371 1:117344308-117344330 TGTAATTCTAGGACTCTGGGAGG + Intergenic
915738524 1:158100010-158100032 ATTTATTTTTGGGGTCTGGGTGG - Intronic
917033500 1:170721127-170721149 AGTTTTTTTGGGAGGCGGGGTGG - Intronic
917114639 1:171590307-171590329 AGTGCCTTTAGGAGTCTGTGTGG + Intronic
918746505 1:188208175-188208197 AGTTTTTGGAGGAGTCTGTGGGG - Intergenic
918997795 1:191784544-191784566 AGTTCTTTTAGGATTCTGAGGGG - Intergenic
919586374 1:199445808-199445830 ACTTGTTTTATGAATCTGGGTGG + Intergenic
921225304 1:213013648-213013670 TGGTATTTTGGGAGCCTGGGAGG - Intronic
921370162 1:214414452-214414474 AGTGATTTTTGGTGGCTGGGTGG - Intronic
922698203 1:227742561-227742583 AGGTATTTCAGGAGTGTGGAGGG - Intronic
923323770 1:232862155-232862177 AGTAATTTCAGCACTCTGGGAGG + Intergenic
923884829 1:238142864-238142886 AGTTATTTAATGAGTGAGGGAGG + Intergenic
1063330910 10:5158366-5158388 ATTTATTTTAGGAGTGGGGTTGG + Intergenic
1065715258 10:28560640-28560662 AATTTCTTTAAGAGTCTGGGTGG - Intronic
1069265493 10:66452765-66452787 AGTTGGTTTACCAGTCTGGGTGG - Intronic
1070055529 10:72930810-72930832 AGTTATTTTGGCAGGCAGGGCGG - Intronic
1070854117 10:79592625-79592647 AGTTATATTAGAAGTATTGGGGG + Intergenic
1071913920 10:90268698-90268720 AATTATTTTGGGAGTTTAGGAGG - Intergenic
1072504374 10:96049709-96049731 AGTGATTTTAGGTGTATGAGAGG + Intronic
1072685564 10:97534612-97534634 AGCTTTTTTAGGAGTAAGGGTGG - Intronic
1073821471 10:107269286-107269308 AGTTAGTTTAGTAGTCTGCCTGG + Intergenic
1075147877 10:119898112-119898134 ATTTATTTTAGAAGTATGGAAGG + Intronic
1075208338 10:120466529-120466551 AGTGATGTTAGAAGTCAGGGTGG + Intronic
1078055730 11:8007580-8007602 AGTTATTTTGAGAGGCTGGGGGG - Intergenic
1078875956 11:15397592-15397614 AGTTTTTTTAGGAGTCTTTAGGG + Intergenic
1079018691 11:16891200-16891222 ATATATTTTTTGAGTCTGGGTGG - Intronic
1080758402 11:35224376-35224398 AATTATTTTAGGAGTCAGTTGGG + Intronic
1082841192 11:57691326-57691348 AGATATTTTAGCACTTTGGGAGG - Intronic
1084201053 11:67558650-67558672 AGTTATTTCAGGAATCAAGGAGG + Intergenic
1084771378 11:71344780-71344802 ATTTATTTTAGGAGGTGGGGAGG + Intergenic
1085394974 11:76202596-76202618 AGTTAATTGAGGAGTCGTGGAGG - Intronic
1087639645 11:100742725-100742747 AAATATTTTACGAATCTGGGAGG + Intronic
1087926416 11:103923731-103923753 AGGTATTTCAGGAGTCTCAGGGG + Intronic
1092038282 12:5360698-5360720 AGTTTGTTAAGGAGGCTGGGGGG + Intergenic
1093249780 12:16788114-16788136 AGTTAGTTTGGGAGTGGGGGTGG - Intergenic
1093658171 12:21721628-21721650 AGCTATTATAGGAGACTGGAGGG - Intronic
1093751277 12:22803306-22803328 AGTTTATCTTGGAGTCTGGGTGG - Intergenic
1093872169 12:24305851-24305873 TGTAATTTTAGCAGTTTGGGAGG - Intergenic
1097176614 12:57147094-57147116 AGTGAGTTTAGCAGACTGGGAGG - Intronic
1098413698 12:70208598-70208620 TGTAATTCTAGCAGTCTGGGAGG - Intergenic
1099890896 12:88586941-88586963 AGTCATTTCAGAAGTCTGTGAGG - Intergenic
1102886474 12:116525810-116525832 TGTTTCTTTAGGAGACTGGGCGG + Intergenic
1105507269 13:21021024-21021046 ATTTATTTTAAGAGTCTGAGAGG + Intronic
1105835216 13:24204612-24204634 AGTAATTTCTGGGGTCTGGGAGG - Intronic
1106996748 13:35493094-35493116 AGTGATTATAAGATTCTGGGTGG + Intronic
1108132220 13:47314307-47314329 AGTAATTCTAGCACTCTGGGAGG - Intergenic
1108401620 13:50050903-50050925 TGTAATTTTAGGACTTTGGGAGG - Intergenic
1109251646 13:60028305-60028327 AGATTTTTTTGGAGTCTTGGTGG - Intronic
1110836687 13:80091754-80091776 ACTTGTTTTATGAATCTGGGTGG + Intergenic
1110837895 13:80106043-80106065 AGTAATTTTAGCACTTTGGGAGG + Intergenic
1112682756 13:101786182-101786204 AGTTCTCTTAGAATTCTGGGAGG - Intronic
1115251096 14:31348889-31348911 AGTTATATTAGGAGTGGTGGTGG - Intronic
1115493221 14:33979047-33979069 CGCTATTTTAGGATTCTGGATGG - Intronic
1116796142 14:49392340-49392362 ACTTATTTTATGAATCTGGGTGG - Intergenic
1117870543 14:60195994-60196016 AGTTATTTTACAACTCTGTGGGG + Intergenic
1117985470 14:61382172-61382194 AGTAATTTTAGCACTTTGGGAGG + Intronic
1118082779 14:62380796-62380818 AGTTATTTTGGGGGTGGGGGTGG + Intergenic
1124593124 15:31070809-31070831 AGTAATTTTAGAACTTTGGGAGG - Intronic
1124939161 15:34201964-34201986 AATTATTTAAGGTGTATGGGAGG + Intronic
1126578252 15:50218830-50218852 AGTTATTTTCTAAGCCTGGGGGG - Intronic
1126624248 15:50670915-50670937 TGTAATCTTAGCAGTCTGGGAGG + Intronic
1127140398 15:55969946-55969968 AGTGACTTTAGGAGTCTGATTGG - Intronic
1127744150 15:61947811-61947833 ATTTATTTTAGGATTCTTGATGG - Intronic
1127925031 15:63530895-63530917 AGTTGTTTTAGCAGTTTGGTAGG + Intronic
1128455905 15:67831293-67831315 ATTTATTTTAGGAATGTGAGAGG + Intronic
1129261117 15:74367856-74367878 AGATATTTCAGGAGTCTGCTAGG - Intergenic
1130051281 15:80486020-80486042 AGTTATTTCTGGAGGCTGTGAGG + Intronic
1134021101 16:10922250-10922272 AGTGAGTGTGGGAGTCTGGGCGG + Exonic
1134147744 16:11780535-11780557 AATTATTTTAGAAGACTGGACGG + Intronic
1134370572 16:13620378-13620400 AGCCAGTTTATGAGTCTGGGTGG - Intergenic
1134854927 16:17510534-17510556 AGATGCTTTAGGAGTCTGAGAGG - Intergenic
1135093940 16:19547148-19547170 TGTTATCCTAGCAGTCTGGGAGG + Intronic
1136932985 16:34435648-34435670 AGTGATCTTGGGAGTCTTGGGGG - Intergenic
1136971587 16:34976166-34976188 AGTGATCTTGGGAGTCTTGGGGG + Intergenic
1137361818 16:47824822-47824844 TGTTATTTCAGCACTCTGGGAGG + Intergenic
1144830782 17:18130133-18130155 TGTAATTTCAGGAGTTTGGGAGG - Intronic
1145814261 17:27784074-27784096 GGATATTTTTGAAGTCTGGGAGG - Intronic
1146038190 17:29426432-29426454 AGTAAGTATAGTAGTCTGGGAGG + Intronic
1147453360 17:40519742-40519764 TGTGATCTTAGGAGGCTGGGTGG - Intergenic
1149114594 17:53077450-53077472 ACTTAGTTTAGGTGTCTGGTGGG - Intergenic
1149382223 17:56105679-56105701 AGTTAATTTTGGAGTTTTGGGGG + Intergenic
1150701538 17:67451286-67451308 TGTAATCTTAGCAGTCTGGGAGG - Intronic
1153934320 18:9907340-9907362 ACTTATTTTGGGAGTTTGTGAGG - Intergenic
1159078951 18:63713902-63713924 TGTTATTTCAGGATTCTGGCTGG + Intronic
1160137594 18:76285862-76285884 AGATGTCTTGGGAGTCTGGGTGG - Intergenic
1160330243 18:77984487-77984509 ATTTATTGTAGGAGTATGGCGGG - Intergenic
1161376092 19:3939757-3939779 AGTGAGTTTAGGGGTCAGGGAGG - Intronic
1161483927 19:4524805-4524827 AGCTAGTTGAGGTGTCTGGGGGG - Intronic
1164570060 19:29367767-29367789 AGTTATTTTTGGAGTGTGTAGGG + Intergenic
924988550 2:291562-291584 AGGTATTTTAGAAGTCTTTGAGG - Intergenic
926806105 2:16712872-16712894 TGATATTTTTGGAATCTGGGAGG - Intergenic
928900547 2:36313494-36313516 ACTTGCTTTATGAGTCTGGGTGG + Intergenic
929627650 2:43426512-43426534 ATTCATTTTAGGAATTTGGGTGG - Intronic
929648021 2:43649265-43649287 AGTTAGTTTCTGAGTCAGGGAGG + Intronic
929961410 2:46499459-46499481 AATTCTTTTAGGAGTCTGCAAGG + Intronic
930107069 2:47648764-47648786 ACTTATTTTAGGACTGAGGGAGG + Intergenic
930529503 2:52572315-52572337 AGTTCTTTAAAGAGGCTGGGGGG - Intergenic
932314048 2:70767936-70767958 TGTTATTTTATGGGTTTGGGGGG + Exonic
933429929 2:82163226-82163248 ACTTATTTTGGGAGTCTGAGAGG + Intergenic
937468253 2:122153786-122153808 AGTGATTTCAGGACTCTGGAAGG + Intergenic
938057587 2:128228300-128228322 TTTTTTTTTAGGAGTTTGGGAGG + Intergenic
940583736 2:155616556-155616578 AGTTATTTTAGGAATATGAAAGG - Intergenic
940728970 2:157368129-157368151 AGTTATATTGGGATTTTGGGGGG + Intergenic
941488864 2:166118489-166118511 GGTGATTTGAGGAGTCTGTGAGG - Intronic
942587097 2:177492649-177492671 AGTGATTTTTGGAGGCTGTGTGG + Intronic
943107410 2:183562840-183562862 TGTTATTTTATGAATCTGGTTGG - Intergenic
944376083 2:199043535-199043557 AATTATTTTAGGACTCAAGGAGG - Intergenic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
945440026 2:209867401-209867423 AATTATTTTTGGGGGCTGGGGGG + Intronic
948098057 2:235352240-235352262 AGTTATTATAGAAGACTAGGGGG + Intergenic
948254519 2:236556288-236556310 AGTTACTGTGGGAGGCTGGGAGG + Intergenic
1170901371 20:20466490-20466512 AATTGTTTCAGGAGTCTGAGAGG - Intronic
1171104223 20:22417306-22417328 AGGTAAATTAGAAGTCTGGGAGG - Intergenic
1172802970 20:37591234-37591256 AGTTGTTCTTGGGGTCTGGGAGG + Intergenic
1172819687 20:37720413-37720435 AGTAATCTTAGCAATCTGGGAGG - Intronic
1172823114 20:37756543-37756565 AGTTATATTTGGAAACTGGGTGG - Intronic
1173187489 20:40851880-40851902 CCTAATTTTAGCAGTCTGGGAGG - Intergenic
1173986269 20:47263982-47264004 AGACATTTTAGGAGAGTGGGGGG + Intronic
1174409577 20:50325552-50325574 AGGGATTTGAGGAGCCTGGGAGG - Intergenic
1177246848 21:18537131-18537153 AGCTATAAAAGGAGTCTGGGTGG - Intergenic
1178010229 21:28276444-28276466 AATTATTTTATGAGTCTGTGCGG - Intergenic
1181835088 22:25599049-25599071 AGTTATTCTGGGAGTATGGTAGG - Intronic
952734409 3:36674538-36674560 AGTCATTTTACCAATCTGGGTGG + Intergenic
954997098 3:54891712-54891734 AGTCATTTCAGAACTCTGGGAGG + Intronic
959161959 3:102734749-102734771 AGTCAGTTTATCAGTCTGGGTGG - Intergenic
959197035 3:103197236-103197258 AAATATGTTAGGAGTCTGGATGG + Intergenic
960878487 3:122320930-122320952 ACGTATTTTAGGAGTCCAGGTGG - Intergenic
961016322 3:123470999-123471021 AGTTATCTTAGCACTTTGGGAGG - Intergenic
961755726 3:129126324-129126346 TGATATTTTGGGATTCTGGGAGG - Intronic
963806090 3:149724485-149724507 TTTTTTTTAAGGAGTCTGGGGGG - Intronic
965029454 3:163345681-163345703 AGCAATCTTAGGTGTCTGGGGGG + Intergenic
965122618 3:164581634-164581656 AGTTATTTTTTGATTTTGGGGGG - Intergenic
965437779 3:168673776-168673798 AGGTCTTTTAGGAAGCTGGGTGG - Intergenic
966223968 3:177578361-177578383 AGATATTTTAGCACTTTGGGAGG + Intergenic
966447724 3:180022203-180022225 AATTAATTTAGGAGTGTGGAAGG - Intronic
969830308 4:9790583-9790605 ATTTCTATTAGGAGTTTGGGAGG + Intronic
970743568 4:19267029-19267051 AGATATTTTGGAAGTCTGGGAGG - Intergenic
974372563 4:61036938-61036960 TATTGTTTTAGTAGTCTGGGGGG + Intergenic
976052676 4:81027942-81027964 AGTCATTCCAAGAGTCTGGGAGG + Intergenic
976220169 4:82750514-82750536 AGTAATTTTATTAGCCTGGGTGG - Intronic
976774274 4:88690039-88690061 AGTTTTGTTGGGTGTCTGGGTGG - Intronic
978224721 4:106320438-106320460 ACTTATTTTAGGAGCCTGGTAGG + Intronic
978281786 4:107025448-107025470 ACTTTTTTTAGGAGTGTGAGTGG + Intronic
978330609 4:107609139-107609161 AGATAATTTAGGAGTCTCTGTGG + Intronic
980576175 4:134685836-134685858 ACTTGTTTTAGGAATCTGGGTGG + Intergenic
980839122 4:138236341-138236363 AGCTTTTGTACGAGTCTGGGTGG - Exonic
982614346 4:157622119-157622141 AGTTATTTTTGGTGTGAGGGAGG - Intergenic
982904433 4:161049858-161049880 AGCTAGTTTATCAGTCTGGGTGG - Intergenic
983632361 4:169862149-169862171 AGGTATTGTGGGAGGCTGGGTGG + Intergenic
986431641 5:7687042-7687064 AGTTCTTTTATTAGGCTGGGTGG + Intronic
987699916 5:21384045-21384067 ATTTATTTTATGAATCTTGGTGG + Intergenic
988113737 5:26855817-26855839 AGTTATTTTAGGAATATTTGAGG - Intergenic
991689262 5:69210789-69210811 TGTAATCTTAGCAGTCTGGGAGG - Intergenic
992023611 5:72649584-72649606 AGTCATTGTGGGAGGCTGGGAGG - Intergenic
992641045 5:78768598-78768620 TGTAATTTTAGCACTCTGGGAGG - Intronic
992682169 5:79164490-79164512 AGTAATTTTAGCACTTTGGGAGG - Intronic
993739699 5:91523023-91523045 AATTATTTTAAGATTCTGAGGGG - Intergenic
994232696 5:97326499-97326521 ACAGATTTTAGGTGTCTGGGGGG - Intergenic
995624925 5:114065929-114065951 AGTTATTTCATGAGACTGGGTGG + Intergenic
997160317 5:131601460-131601482 AGTTATTTTTGAATTCTGAGTGG - Intronic
997381143 5:133439398-133439420 AGCTATTTGAGGCCTCTGGGTGG + Intronic
1000199318 5:158992191-158992213 ATTTATTTAAGGATTCTGGAAGG - Intronic
1001089748 5:168728662-168728684 TGTAATTCTAGCAGTCTGGGAGG + Intronic
1002987336 6:2203175-2203197 AGTTACTTTAGGCCACTGGGGGG + Intronic
1004770387 6:18774645-18774667 AGTTAGTCTAGGAGTGTGGAAGG + Intergenic
1004923203 6:20395855-20395877 AGTTATTTTTGGTGTGAGGGAGG + Intergenic
1005317992 6:24622785-24622807 TGTAATTTTAGCACTCTGGGAGG + Intronic
1005550657 6:26910726-26910748 ATTTATTTTATGAATCTTGGTGG - Intergenic
1007882042 6:45178397-45178419 AGTTGCTTTAGGAATCTGGGTGG - Intronic
1008395388 6:51000501-51000523 TTTTATTTTAGGAGGCTGAGTGG - Intergenic
1011175677 6:84557625-84557647 AGTAATTTTAGGAATCTTTGAGG + Intergenic
1012470208 6:99564166-99564188 TGTAATTTTAGCACTCTGGGAGG + Intronic
1016319791 6:142830409-142830431 TTTTATTTTAAGAGGCTGGGAGG + Intronic
1020038784 7:4985517-4985539 ATCTATTTTAGGATCCTGGGGGG - Intronic
1021778996 7:24083348-24083370 AGTTTTTTAAGGAATCTGGTGGG - Intergenic
1021873479 7:25026902-25026924 AGTAATCTCAGCAGTCTGGGAGG + Intergenic
1023497424 7:40813367-40813389 ACTTGTTTTATGAATCTGGGTGG + Intronic
1023705798 7:42940801-42940823 AGTTATCTGAGGAGAGTGGGAGG - Intronic
1024232951 7:47376809-47376831 AATAATTTTAGGAGTTAGGGAGG - Intronic
1024737921 7:52325013-52325035 AGTCTTTTTAAGAGACTGGGGGG + Intergenic
1026415364 7:70174195-70174217 AGAAATTTTAGGAGTCTTGATGG + Intronic
1026627293 7:72006853-72006875 AGTTATTTTAGGAGTCTGGGAGG - Intronic
1027407610 7:77878343-77878365 AGCCATTTTATGGGTCTGGGTGG + Intronic
1027557917 7:79688812-79688834 AGTTGTTTTAGTAATCTGGATGG + Intergenic
1028451210 7:90985389-90985411 AGTTCTTTTAGGACTCTGCTTGG + Intronic
1029323956 7:99789681-99789703 AGTTATTTTAGGAGCCTCCTTGG - Intergenic
1031395681 7:121270994-121271016 AGATATTTTATGAGTCTTTGTGG + Intronic
1032310170 7:130779020-130779042 ACTTGTTTTATGAGTCTGGGTGG + Intergenic
1035452415 7:158986072-158986094 AGTTTGTTCAGGAGTCTGTGAGG + Intergenic
1037423726 8:18731920-18731942 AGCTATTTGAGGAGTCTGAGAGG + Intronic
1037453637 8:19041624-19041646 AGTTATTTTAGCCGTCTTTGTGG - Intronic
1037622752 8:20579423-20579445 AGTCAGTTTCTGAGTCTGGGAGG + Intergenic
1041485093 8:58367383-58367405 ACTTACTTTTGGAGTGTGGGAGG - Intergenic
1043606229 8:82003869-82003891 ACTTGTTTTAGGAGACTAGGAGG + Intergenic
1044485475 8:92748148-92748170 ACTTTTCTTAGGAGTCCGGGAGG - Intergenic
1045658336 8:104410253-104410275 GGCTATTGTAGGAGTCTGGCCGG - Intronic
1046221392 8:111220429-111220451 AGTTATTTTAGTATTATCGGAGG + Intergenic
1046361509 8:113164449-113164471 AAATATTTAAGGAGTCAGGGAGG - Intronic
1047666631 8:127098700-127098722 TGCTATTTTAGGATTCTGAGGGG + Intergenic
1048611752 8:136030636-136030658 AGTGTATTTAGGATTCTGGGTGG - Intergenic
1051782715 9:20707811-20707833 TGTTATTTTGGGAGTGTTGGTGG + Intronic
1052848884 9:33363538-33363560 AGTAATCCTAGGACTCTGGGAGG - Intronic
1052886193 9:33650417-33650439 AGTTCTTTTAGGAGCCAGGGAGG + Intergenic
1056408889 9:86305037-86305059 TGTTATTCTAGCACTCTGGGAGG + Intronic
1057691157 9:97287649-97287671 TCATATTTCAGGAGTCTGGGTGG + Intergenic
1058121849 9:101147679-101147701 AGGTATTTTGGGAGTGTGGGGGG + Intronic
1059523712 9:114968759-114968781 AGGTATTTCAGCAGTCTGGGTGG + Intergenic
1060418631 9:123451275-123451297 AGTTATTTTAGCAGGATGGGTGG - Intronic
1061165940 9:128922248-128922270 AGAAAGTTTAGGAGCCTGGGAGG - Intronic
1061378721 9:130241511-130241533 GCTTATTTTAGGTTTCTGGGAGG - Intergenic
1185984940 X:4822526-4822548 TGGAATTTTGGGAGTCTGGGTGG + Intergenic
1187200254 X:17127730-17127752 AGTTGTTTTAAGTTTCTGGGGGG - Intronic
1187416106 X:19094766-19094788 AGTTATTTTGGAAGGCTGGATGG + Intronic
1189425350 X:40895528-40895550 AGTTATGTGAGGAGTTTGTGTGG - Intergenic
1191212025 X:57894946-57894968 ATTTGTTTTATGAATCTGGGTGG - Intergenic
1194787064 X:98099170-98099192 TGTTATTATAAGAATCTGGGTGG - Intergenic
1196306848 X:114112908-114112930 AGTTATTTAACGTGTCTGTGAGG + Intergenic
1196333957 X:114507779-114507801 AGTTATTTCCAGAGGCTGGGAGG + Intergenic
1199271798 X:145892450-145892472 AGTATTTTTATGAATCTGGGTGG + Intergenic
1199434120 X:147794100-147794122 GGTTGGTTTTGGAGTCTGGGAGG - Intergenic
1200947190 Y:8855418-8855440 TGTAATTTTAGTACTCTGGGAGG + Intergenic
1202027519 Y:20540320-20540342 AGGTATTCCAGGAGCCTGGGAGG - Intergenic