ID: 1026632417

View in Genome Browser
Species Human (GRCh38)
Location 7:72048884-72048906
Sequence TGCAGCCACCTCAACATTTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026632413_1026632417 18 Left 1026632413 7:72048843-72048865 CCCAGGCTGGAGTGCAGTGCCGT 0: 161
1: 23366
2: 137362
3: 250338
4: 208309
Right 1026632417 7:72048884-72048906 TGCAGCCACCTCAACATTTTCGG 0: 1
1: 0
2: 0
3: 9
4: 170
1026632416_1026632417 -6 Left 1026632416 7:72048867-72048889 CCATGATTATAGCTCTCTGCAGC 0: 1
1: 5
2: 47
3: 207
4: 502
Right 1026632417 7:72048884-72048906 TGCAGCCACCTCAACATTTTCGG 0: 1
1: 0
2: 0
3: 9
4: 170
1026632415_1026632417 -1 Left 1026632415 7:72048862-72048884 CCGTGCCATGATTATAGCTCTCT 0: 1
1: 1
2: 10
3: 56
4: 338
Right 1026632417 7:72048884-72048906 TGCAGCCACCTCAACATTTTCGG 0: 1
1: 0
2: 0
3: 9
4: 170
1026632414_1026632417 17 Left 1026632414 7:72048844-72048866 CCAGGCTGGAGTGCAGTGCCGTG 0: 169
1: 24347
2: 116581
3: 194619
4: 221371
Right 1026632417 7:72048884-72048906 TGCAGCCACCTCAACATTTTCGG 0: 1
1: 0
2: 0
3: 9
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026632417 Original CRISPR TGCAGCCACCTCAACATTTT CGG Intronic
907346333 1:53784395-53784417 TGCAGCAATCCCAACACTTTGGG + Intronic
911686371 1:100781529-100781551 TCCAGTCACTTCCACATTTTTGG + Intergenic
912543929 1:110437523-110437545 AGATGTCACCTCAACATTTTAGG - Intergenic
914713438 1:150235287-150235309 TGCGGCCAACTCATCTTTTTAGG - Intronic
918657636 1:187047932-187047954 TGCAGCCATATGAACATTCTGGG - Intergenic
918865501 1:189892901-189892923 TGCCTCCAACCCAACATTTTGGG - Intergenic
919514776 1:198510099-198510121 TGCAGCCATATCTACATTTGGGG + Intergenic
920398008 1:205660453-205660475 TGCAGCCAACTCAACTCTTCTGG - Intronic
920692044 1:208154487-208154509 TGCAGCCACTGCCACTTTTTGGG - Intronic
924354991 1:243163347-243163369 TGCAGCCACGTCCACATATGAGG + Intronic
924491658 1:244544131-244544153 TGCAGCCACCTCTTTATTTAAGG - Intronic
1062895485 10:1100196-1100218 AGCTGCCACCTCAAGATTTGGGG + Intronic
1064460555 10:15531210-15531232 GGCAGCCACCTAATTATTTTTGG + Intronic
1066474686 10:35734594-35734616 TGCATCCTCATCCACATTTTAGG + Intergenic
1067532068 10:47081199-47081221 TGAAACCACATCAACATCTTTGG - Intergenic
1068808125 10:61223686-61223708 TATAGCCACCTCACCATTTCTGG - Intergenic
1070100104 10:73377717-73377739 TCCTTCCACCTCAACATTCTGGG + Intronic
1070790322 10:79185280-79185302 TGCTGCCGACTCAACAATTTTGG - Intronic
1072919281 10:99562213-99562235 TGCTGCAATCCCAACATTTTGGG - Intergenic
1072941325 10:99766787-99766809 TGCAGCCTCAGCGACATTTTAGG + Intergenic
1073029163 10:100511031-100511053 TGCAGCGACCTCAGCATGGTCGG + Intronic
1074405868 10:113180077-113180099 TGCAGCCCACTCCCCATTTTAGG + Intergenic
1075306817 10:121375281-121375303 AGCATCCAGCTCAACAATTTAGG + Intergenic
1075797536 10:125131369-125131391 GGCATCCACCTAAACACTTTGGG - Intronic
1076348925 10:129801589-129801611 TGCAGCCACCCCAGCATGCTGGG + Intergenic
1076611002 10:131725885-131725907 TGCAGCCACCTCCACCTCTGTGG - Intergenic
1077608870 11:3631405-3631427 TGCTGTCATCTCAGCATTTTGGG - Intergenic
1078515942 11:12022582-12022604 TGAAGTCACTTCCACATTTTTGG - Intergenic
1078879291 11:15432311-15432333 TCCAGCCACCTCAAAATGCTGGG - Intergenic
1081957855 11:47109090-47109112 TGCAGCCAGATCTTCATTTTTGG - Intronic
1083155240 11:60818837-60818859 TGCAGCCACCTCCACGTGCTGGG + Intergenic
1084927242 11:72523310-72523332 TGCAGCCACCTGCTCAGTTTAGG - Intergenic
1086063344 11:82722183-82722205 TGCAAACAACTCAACAATTTGGG - Intergenic
1086859400 11:91907424-91907446 TACAGCAAACTCAGCATTTTAGG + Intergenic
1087959930 11:104335654-104335676 TGCTGCCACCTCTACACTTCTGG - Intergenic
1089741656 11:120588682-120588704 GGCAGGCTTCTCAACATTTTGGG + Intronic
1090101973 11:123807285-123807307 TGCAGAGACCTCCCCATTTTAGG + Intergenic
1091776577 12:3188660-3188682 TGCAGCCACCTGGACACATTGGG + Intronic
1096001362 12:48133344-48133366 TCCAGCTACCTGAACATTGTGGG + Exonic
1096028896 12:48394054-48394076 ATCAGACACATCAACATTTTAGG + Intergenic
1098163998 12:67674300-67674322 TGAAGCCGCTTCCACATTTTCGG + Intergenic
1099846276 12:88031978-88032000 TGAAGTCACTTCCACATTTTTGG + Intronic
1104458609 12:128935586-128935608 TGCAGCCTCAGCGACATTTTAGG - Intronic
1105516633 13:21096791-21096813 TGCTGTAACCTCAACACTTTGGG - Intergenic
1105766380 13:23564061-23564083 TGCAGCCTTGTCAGCATTTTGGG - Intergenic
1110540165 13:76699036-76699058 TGAAGCCATTTCAACATTTGGGG - Intergenic
1111556956 13:89893232-89893254 TGCAGGCAGCTCAGCAGTTTAGG - Intergenic
1115313927 14:32006657-32006679 TGCAGGCACCTGCACATCTTGGG + Intergenic
1116858164 14:49972112-49972134 TGCAGACACCTCAGCTTTCTGGG - Intergenic
1118404202 14:65407560-65407582 TACCTTCACCTCAACATTTTGGG - Intergenic
1121770313 14:96529773-96529795 TACAGCGACATCCACATTTTTGG + Intronic
1122195194 14:100079467-100079489 TGCAGACACCTCAGCAGATTCGG + Intronic
1122657077 14:103269369-103269391 TGCAGTCAATTAAACATTTTAGG - Intergenic
1122947483 14:105019500-105019522 TGCAGCCACTTCAAAGTTTCGGG + Intronic
1123129862 14:105976275-105976297 TACATCCACTTCTACATTTTGGG - Intergenic
1124858538 15:33414494-33414516 GACAGCTTCCTCAACATTTTGGG + Intronic
1128774386 15:70308607-70308629 TGCACCCACCTCAACATGAGAGG + Intergenic
1129055937 15:72820537-72820559 GGCACCCACCTCAACCTTTCTGG - Intergenic
1129536549 15:76317817-76317839 TGCCGCCACCACACCAGTTTTGG - Intergenic
1130509820 15:84580383-84580405 GGCAGCCCCTGCAACATTTTTGG + Intergenic
1130585249 15:85175597-85175619 GGCAGCCCCTGCAACATTTTTGG - Intergenic
1133270190 16:4607547-4607569 TGCAGCTACCTCAGCATGTGAGG + Intergenic
1133924958 16:10184563-10184585 AGCAGCCACATCCACATTCTTGG - Intergenic
1135088164 16:19491084-19491106 TGCTGCAACCTCAACCTTTCAGG + Intronic
1136549674 16:30976307-30976329 TGCAGCCTCCTCAACCTCCTAGG - Intronic
1137418255 16:48305712-48305734 AGCAGAAACCTCAACATTTGTGG - Intronic
1138379121 16:56588370-56588392 TGCAGCCTCCTCAACCTCCTGGG + Intergenic
1139088749 16:63618393-63618415 CGCAGCCCCCTCCAGATTTTGGG - Intergenic
1139221119 16:65183148-65183170 TGCAGAGATCTCACCATTTTGGG + Intergenic
1141508317 16:84495638-84495660 TGCAGCCTCCTCAGCAGTCTTGG - Intronic
1147790143 17:43009072-43009094 TGCAGCCACCTCCACCTCTAGGG + Intronic
1148776722 17:50099953-50099975 GGCAGCCACCTCAACCCTGTCGG - Intronic
1151356469 17:73561414-73561436 TGCAGCCACGTCACCATTTGGGG - Intronic
1154489430 18:14908392-14908414 ATCAGCCAACTCAACATATTTGG + Intergenic
1155635210 18:27944836-27944858 TGCAGCCGCCTCAAACTTCTTGG - Intergenic
1157754416 18:50205266-50205288 TGTAGCCACCACAACCTTCTTGG + Intergenic
1158228428 18:55225784-55225806 TTAATCCACCTCCACATTTTAGG + Intronic
1158273873 18:55745663-55745685 TGCAGCCACCCCATCATCTTTGG + Intergenic
1158378556 18:56902204-56902226 AGTAGCCACATCAATATTTTAGG - Intronic
1159797027 18:72856359-72856381 TGCACCCACCTAAAAATTTCAGG + Intronic
1160007148 18:75075806-75075828 GGCAGCCACCTGGACATTGTGGG - Intergenic
1160598773 18:79996527-79996549 TGCAGCCCCGTCAATCTTTTGGG + Intronic
1167393950 19:49214890-49214912 GGCTGCTGCCTCAACATTTTAGG + Intergenic
1168666046 19:58205699-58205721 TGCTGCCTCCTCAGCATTTCAGG + Intronic
927272039 2:21222049-21222071 TACAGCCATCTCAATTTTTTTGG - Intergenic
927817215 2:26229260-26229282 TGTTGCAACCTCAACTTTTTGGG - Intronic
930106256 2:47642282-47642304 TGCTGCCACCACAACATTCTCGG + Intergenic
932156511 2:69422964-69422986 CTCAGCCTCCTCAACATTTTTGG + Intronic
932327047 2:70870288-70870310 TGCAGCCACCTCAACCTCCCAGG + Intergenic
934638598 2:96012238-96012260 CTCAGCTGCCTCAACATTTTTGG + Intergenic
934795056 2:97093169-97093191 CTCAGCTGCCTCAACATTTTTGG - Intronic
935722306 2:105990240-105990262 TCCAGCCACCCCAACATTCCTGG + Intergenic
935882077 2:107574877-107574899 GGCAGCCACCTGAACTTGTTTGG - Intergenic
936844945 2:116819942-116819964 TACAGCAACCTCAAACTTTTGGG + Intergenic
940125693 2:150321368-150321390 TGCATCTCCCTCCACATTTTTGG - Intergenic
944561517 2:200943914-200943936 CTCAGCCTCCTCAACATTCTAGG + Intronic
946012127 2:216573778-216573800 TGCAGCCTCCTAAAGAGTTTAGG + Intronic
946221931 2:218235249-218235271 TGCAGCCTCCTCCAAATCTTGGG + Intronic
947034673 2:225838487-225838509 AGCAACCACTTCAAAATTTTTGG - Intergenic
947786080 2:232821456-232821478 TGCCTCTACCTCAACACTTTAGG - Intronic
949038758 2:241834703-241834725 TACAGCCAACTCAACGTTCTGGG + Intergenic
1173616062 20:44403667-44403689 AGCAGACACCTCAACATGTGTGG + Intronic
1181751480 22:24991995-24992017 CACAGCCACATCAGCATTTTGGG + Intronic
1182480081 22:30602641-30602663 TGCAGTAACCTCAGCACTTTGGG - Intronic
1182781578 22:32872772-32872794 TGCAGTCACCCCAACATTTAAGG + Intronic
1183223898 22:36536166-36536188 AGCAGCCACTTTAACTTTTTGGG + Intergenic
953169767 3:40496476-40496498 TGCAGCCACCTCAACCTCCTGGG + Intergenic
953567018 3:44041432-44041454 TGCAGTCACCACTACAATTTTGG - Intergenic
955003707 3:54950391-54950413 TGCAACCCCCTCCTCATTTTAGG + Intronic
955064333 3:55521642-55521664 TGCAGGCACCTCAGCCTCTTTGG - Intronic
956024275 3:64965678-64965700 TACAGCAGCCTCAACCTTTTGGG + Intergenic
956909917 3:73806858-73806880 TGAAGTCACTTCTACATTTTCGG - Intergenic
958262378 3:91396719-91396741 TGCAGCCACCTGCCCATCTTTGG + Intergenic
960401117 3:117200040-117200062 TTCAGTCACCTCAACATGCTAGG + Intergenic
963977669 3:151500106-151500128 TGTAGCCAACTCAACTTCTTAGG + Intergenic
964448119 3:156782049-156782071 TGCAGGCACTCCAACAGTTTAGG - Intergenic
966048385 3:175582297-175582319 TGCAGCCATTTCAAAATATTAGG - Intronic
966924686 3:184636618-184636640 TGCAGCCCACTCAACTCTTTAGG + Intronic
970932138 4:21524390-21524412 TACAGTCACATAAACATTTTTGG - Intronic
970978933 4:22074548-22074570 TGAAGTCACTTCCACATTTTTGG - Intergenic
971867289 4:32189534-32189556 TTCAGCCCCCTCCAGATTTTGGG + Intergenic
972014497 4:34226470-34226492 TGCACACACGTCAACATTTGAGG + Intergenic
972318429 4:37949619-37949641 TGTAGTCACTTCAACAGTTTAGG - Intronic
974121311 4:57642363-57642385 AGCAGCCACCACAACACTGTAGG + Intergenic
977048355 4:92094934-92094956 CACAGCGACCTCAATATTTTTGG + Intergenic
977786173 4:101037182-101037204 AGCTTCCACCTCAGCATTTTGGG - Intronic
979207855 4:118062347-118062369 GGAAGTCACCTAAACATTTTTGG + Intronic
984342877 4:178481526-178481548 TGTAGCCACCTGCACAATTTTGG + Intergenic
985634663 5:1030134-1030156 GGCACCCACCTCAGCATTTAGGG + Intronic
987259836 5:16192365-16192387 TTCAGATACCTCTACATTTTGGG - Intergenic
987478801 5:18427678-18427700 TGAAGTCACTTCCACATTTTTGG - Intergenic
988555828 5:32235195-32235217 GGCAGCCACCTCAACAGCTGTGG + Intronic
989035152 5:37163044-37163066 TGCAGAGTCCTCAACAGTTTTGG - Intronic
989481827 5:41939923-41939945 TGCTGCAACCTCAACCTCTTGGG + Intronic
989754362 5:44935406-44935428 TGCAGCCATCTCAGCATTAGAGG + Intergenic
993293372 5:86103661-86103683 TGCAGTCACCCCAGTATTTTGGG - Intergenic
995537931 5:113156115-113156137 TGGAGCCACCCCACCAGTTTTGG + Intronic
1002468060 5:179417689-179417711 TGCAGCCACTTCAGTCTTTTGGG + Intergenic
1003766105 6:9238582-9238604 TGCACCTACATCAACATTTGTGG - Intergenic
1005209116 6:23440598-23440620 TCCACCCAACTCCACATTTTAGG + Intergenic
1006421107 6:33934802-33934824 TGCAGCCACCTTACCACTTCAGG - Intergenic
1008993039 6:57626158-57626180 TGCAGCCACCTGCCCATCTTTGG - Intronic
1013098564 6:106968223-106968245 TGCTGCAACCTCCACCTTTTGGG - Intergenic
1013352548 6:109318669-109318691 TGCAGCCATCTGCACATGTTGGG + Intergenic
1013669931 6:112389797-112389819 TTCAGCCACATCAAAATTTTAGG + Intergenic
1014048887 6:116928001-116928023 GGGAGGCACCTCAGCATTTTGGG - Intronic
1015702102 6:136048042-136048064 TCCATCTACCTCAACATTCTTGG - Intronic
1019107725 6:169682509-169682531 TGCAGCCATCTCAGCATTAGAGG - Intronic
1021056176 7:16049086-16049108 TTCAGCCAACAAAACATTTTAGG + Intergenic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1023892728 7:44404992-44405014 TGCAGCCCCCTCAGCTTTCTTGG - Intronic
1026632417 7:72048884-72048906 TGCAGCCACCTCAACATTTTCGG + Intronic
1027986156 7:85293531-85293553 TGCTGCAAACTCAAAATTTTGGG + Intergenic
1028286837 7:89012768-89012790 TGAAGTCACTTCCACATTTTTGG + Intronic
1028631155 7:92935391-92935413 TGCAACCACCTCAGCATTTAAGG + Intergenic
1034890584 7:154835574-154835596 TCCAGCCACCAAAACACTTTGGG - Intronic
1035027302 7:155834440-155834462 TGCAGCCATCACCACAGTTTCGG + Intergenic
1035841270 8:2813874-2813896 TGGAGCCACCACCACACTTTGGG - Intergenic
1041299434 8:56395332-56395354 TGCAGACACCTCAGTACTTTTGG - Intergenic
1041607063 8:59793672-59793694 TGCAGCCACATTTACATTTGGGG - Intergenic
1042846782 8:73176504-73176526 CACTGCAACCTCAACATTTTAGG - Intergenic
1044812944 8:96082725-96082747 TGCAGCCCTGCCAACATTTTGGG - Intergenic
1044814081 8:96092798-96092820 TGCAGCCACCTCCCCTTTCTAGG - Intergenic
1045565829 8:103314074-103314096 TGCAGGAACATCAACATTATTGG + Intronic
1046307584 8:112390286-112390308 TGCAGCCACCTCAAGACCTCAGG + Intronic
1047910909 8:129528173-129528195 TTCAGCTTCCTCACCATTTTGGG + Intergenic
1048972117 8:139650983-139651005 TGCATCCACCTCGATATTCTGGG - Intronic
1049690538 8:143957038-143957060 TGCAGCCACCTCCACCTTCTTGG - Intronic
1051374550 9:16389934-16389956 TGCAGCCTCAGCAACAATTTCGG + Intergenic
1051958741 9:22731965-22731987 TTCAGCCACTTTAACATTTCTGG - Intergenic
1056230438 9:84538120-84538142 TGCAGCCATATCTACATTTAGGG + Intergenic
1059063102 9:111053962-111053984 TGCTGCTACCTCAACAAGTTTGG + Intergenic
1060126916 9:121056046-121056068 TGCAGCCATCTCAGCACTTGGGG - Intergenic
1190212351 X:48458836-48458858 ACCAGCCACCTCCACATGTTGGG + Exonic
1193188393 X:78539920-78539942 TAAAGCCACTTCCACATTTTTGG + Intergenic
1193694858 X:84696064-84696086 TACAGCTAACTCAACATTTGTGG + Intergenic
1194037323 X:88892281-88892303 GGCATCCACCTTACCATTTTTGG + Intergenic
1195869822 X:109474268-109474290 TGCAGCCACTCCACCACTTTAGG - Intronic
1198979580 X:142379870-142379892 TAAAGCCACTTCAACATTCTTGG - Intergenic
1200310028 X:155068948-155068970 TGCAGTTATCTAAACATTTTTGG - Intronic