ID: 1026638353

View in Genome Browser
Species Human (GRCh38)
Location 7:72103881-72103903
Sequence CTTGCGGGTTATCGTGTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026638349_1026638353 -2 Left 1026638349 7:72103860-72103882 CCAGCTTAGAAGGCTCCAAAGCT 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1026638353 7:72103881-72103903 CTTGCGGGTTATCGTGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026638353 Original CRISPR CTTGCGGGTTATCGTGTCCT TGG Intronic
No off target data available for this crispr