ID: 1026639200

View in Genome Browser
Species Human (GRCh38)
Location 7:72109635-72109657
Sequence AGTGGCTCCACGCTCCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 169}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026639200_1026639207 27 Left 1026639200 7:72109635-72109657 CCTGGAAGGAGCGTGGAGCCACT 0: 1
1: 0
2: 0
3: 31
4: 169
Right 1026639207 7:72109685-72109707 GCTCAAGGACACTGTGGTGGAGG No data
1026639200_1026639206 24 Left 1026639200 7:72109635-72109657 CCTGGAAGGAGCGTGGAGCCACT 0: 1
1: 0
2: 0
3: 31
4: 169
Right 1026639206 7:72109682-72109704 TGTGCTCAAGGACACTGTGGTGG No data
1026639200_1026639205 21 Left 1026639200 7:72109635-72109657 CCTGGAAGGAGCGTGGAGCCACT 0: 1
1: 0
2: 0
3: 31
4: 169
Right 1026639205 7:72109679-72109701 CACTGTGCTCAAGGACACTGTGG 0: 1
1: 0
2: 2
3: 37
4: 236
1026639200_1026639203 -4 Left 1026639200 7:72109635-72109657 CCTGGAAGGAGCGTGGAGCCACT 0: 1
1: 0
2: 0
3: 31
4: 169
Right 1026639203 7:72109654-72109676 CACTACTCAGCTTGAGGTCATGG No data
1026639200_1026639201 -10 Left 1026639200 7:72109635-72109657 CCTGGAAGGAGCGTGGAGCCACT 0: 1
1: 0
2: 0
3: 31
4: 169
Right 1026639201 7:72109648-72109670 TGGAGCCACTACTCAGCTTGAGG No data
1026639200_1026639204 12 Left 1026639200 7:72109635-72109657 CCTGGAAGGAGCGTGGAGCCACT 0: 1
1: 0
2: 0
3: 31
4: 169
Right 1026639204 7:72109670-72109692 GTCATGGCACACTGTGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026639200 Original CRISPR AGTGGCTCCACGCTCCTTCC AGG (reversed) Intronic
900732576 1:4271901-4271923 AGAGGCTCCATCCTCCTTCAGGG - Intergenic
902870701 1:19312168-19312190 ACTGCCTCCGCGCTCCTCCCCGG - Intergenic
903018440 1:20377041-20377063 AATGCCTCTAGGCTCCTTCCTGG - Intergenic
903260999 1:22131890-22131912 AGGGGCTCCGAGCTCCTGCCTGG - Intronic
903649304 1:24913337-24913359 AGTGGCCCCAAGCTCATACCAGG + Intronic
904720054 1:32500806-32500828 GGAGGCTCCGCGCGCCTTCCCGG - Intronic
905325949 1:37152092-37152114 AGTTCCTCCAGGCACCTTCCAGG + Intergenic
905456480 1:38091658-38091680 AGTGGCTCCACGTTCTTTATTGG - Intergenic
919664630 1:200280047-200280069 CCTGGCTCCACGCTCTTTCCAGG - Intergenic
919771016 1:201158606-201158628 AGGGGCTCCCGGCTCCCTCCTGG - Intronic
921269270 1:213452729-213452751 GCTGGCTCCACCCTCCTCCCAGG + Intergenic
922155614 1:223038117-223038139 AGTGCCTCCTCCCTCCTCCCAGG + Intergenic
922171438 1:223159069-223159091 ACTGGCTCCAGGGCCCTTCCTGG + Intergenic
1062972425 10:1659498-1659520 TGGGGCTCCAGGCTCCTTCCAGG - Intronic
1067242144 10:44506200-44506222 CGTGGCTCCAATCTCCTTCTTGG - Intergenic
1067332408 10:45334291-45334313 TGTGCCTCCACTCACCTTCCAGG + Intergenic
1067727671 10:48783153-48783175 ATTGGCTCCAGGACCCTTCCTGG + Intronic
1070671614 10:78381364-78381386 AGTAGCTCCATGATCCTTCTTGG + Intergenic
1072241986 10:93505329-93505351 AGTGGCTCCACCTTCCTTTAGGG + Intronic
1072250749 10:93580698-93580720 AAAGTCTCCACCCTCCTTCCTGG + Intronic
1075689646 10:124386617-124386639 TGTGACTCCACCCTCCTGCCCGG - Intergenic
1076857625 10:133124938-133124960 ACCGGCTCCGGGCTCCTTCCCGG - Intronic
1077090196 11:774958-774980 AGGGGCTCCCCACTCCTCCCAGG + Intronic
1077999942 11:7485542-7485564 AGTGGTTGCAAGCTGCTTCCTGG - Exonic
1083622077 11:64054123-64054145 TGGGGCTCCAGGCTCCTGCCTGG - Intronic
1083940293 11:65891838-65891860 AGTGGCTCCAGCTCCCTTCCCGG + Intergenic
1084084133 11:66847085-66847107 AGTGACTCCAGGGTCCTTCTCGG + Intergenic
1090435846 11:126685812-126685834 AGTGGCTCCACGCCCCTTGGGGG + Intronic
1092013390 12:5136016-5136038 AGTGGTTCCAGGTCCCTTCCTGG - Intergenic
1092406122 12:8223306-8223328 AGACACTCCACGATCCTTCCAGG - Intronic
1094114248 12:26893136-26893158 AATGGCTTGAAGCTCCTTCCAGG - Intergenic
1094536016 12:31323905-31323927 AATGCCTCCCCGCTCCTCCCAGG + Intronic
1100267133 12:92988212-92988234 AGAGGCTCCTCCCTCCTGCCAGG - Intergenic
1103327743 12:120132660-120132682 AGCGGCTCCGTGCTCCTCCCTGG + Intronic
1104463495 12:128972470-128972492 AGTTGCTCCCCGGTTCTTCCCGG - Intronic
1105546579 13:21355272-21355294 AGTGGCTCCAGGCTCCACTCGGG + Intergenic
1105722038 13:23126390-23126412 AGTGCCACCGCACTCCTTCCTGG + Intergenic
1108227368 13:48303574-48303596 CGTGGGTCCAGGCGCCTTCCAGG - Intergenic
1111125393 13:83907368-83907390 AGTGTATCCACGCCACTTCCTGG + Intergenic
1111371670 13:87327369-87327391 AATGGCTTCCAGCTCCTTCCAGG - Intergenic
1113108211 13:106793808-106793830 AGTGGCTCCAGCCTCTTTGCTGG + Intergenic
1113671957 13:112181622-112181644 AGTGGCTCCACAGTCCCACCTGG + Intergenic
1114778252 14:25511207-25511229 TGTGGCTCCCCACTGCTTCCAGG + Intergenic
1119614059 14:76086733-76086755 AGTGGGCACACCCTCCTTCCTGG - Intergenic
1121047896 14:90801315-90801337 AGTGGTTTCGCGTTCCTTCCGGG - Intronic
1122025025 14:98869397-98869419 AGGGCCTCCAGGGTCCTTCCTGG - Intergenic
1126990027 15:54363571-54363593 AGTGGCTCCACATTTCCTCCAGG - Intronic
1127198236 15:56613940-56613962 AGTGGCCCCTAGCTGCTTCCTGG - Intergenic
1129590420 15:76909956-76909978 ACTGGCTCCACTGTCCCTCCAGG + Intergenic
1131437348 15:92433789-92433811 TGTGGCTTCACCCTCCTCCCTGG - Intronic
1132566627 16:626409-626431 AGTGTGTGCTCGCTCCTTCCTGG + Intronic
1136494108 16:30631311-30631333 GGTGGCACCAGGCTTCTTCCAGG - Intergenic
1136516963 16:30774190-30774212 AGTGGCCCCACCCTCCATTCCGG + Exonic
1137238181 16:46632938-46632960 AGTGGCTCCTCGCTGCTGGCAGG + Intergenic
1138537245 16:57666670-57666692 AGTGGCTCCAGGCTAGTCCCTGG + Intergenic
1139225232 16:65228131-65228153 CCTGGCTCCTCGCTCTTTCCTGG - Intergenic
1139361281 16:66401733-66401755 GGTGGCCCCACGCTGCCTCCCGG - Intronic
1139955032 16:70689067-70689089 AGTGCCTGCACCCCCCTTCCCGG - Intronic
1140201518 16:72898651-72898673 AGTGGCTCCACACTCCTTTGTGG - Intronic
1142601267 17:1054090-1054112 AGGGGCTCAAGGTTCCTTCCTGG - Intronic
1142611183 17:1109771-1109793 GGTGGCGCCGCGCTCCTGCCTGG - Intronic
1143009942 17:3860669-3860691 AGTGGGTCCACGTTTCTCCCCGG - Intronic
1143034573 17:3987067-3987089 AGGGGCTCCAGGCTTCCTCCTGG + Intergenic
1143183480 17:4997866-4997888 GGTCGCTCCCGGCTCCTTCCCGG + Intergenic
1143191831 17:5045513-5045535 AGTGCCTCTACACTCCTGCCTGG + Intronic
1144727826 17:17510787-17510809 AGGGGCTCCACCCACCATCCTGG + Intronic
1145061394 17:19736515-19736537 CATGTCTCTACGCTCCTTCCCGG - Intergenic
1146581111 17:34039894-34039916 TGCCGCTCCACGCTCCTCCCTGG + Intronic
1148199522 17:45740651-45740673 TCTGGCTCCTCCCTCCTTCCTGG - Intergenic
1148440266 17:47708551-47708573 CATGGCTACCCGCTCCTTCCCGG - Intronic
1149703150 17:58672247-58672269 ACTGGTACCATGCTCCTTCCAGG + Intronic
1150108655 17:62479252-62479274 CGCCGCTCCACGCTCCTCCCGGG - Exonic
1150250687 17:63702786-63702808 AGGGGCTACAGGCTGCTTCCTGG - Intergenic
1151433122 17:74078342-74078364 ATTGGGTCCTGGCTCCTTCCAGG - Intergenic
1152395509 17:80030553-80030575 AGTGGCTCCAGGCTACCTCCAGG - Intronic
1157102250 18:44741749-44741771 AGTGGCTTCACGCTCCTCAGTGG - Intronic
1157285611 18:46375155-46375177 AGAGGCCCCAGGCTCCTTCCAGG + Intronic
1160928687 19:1559565-1559587 AGTGGCTCAAAACTCCTTCACGG - Intronic
1161150254 19:2703819-2703841 GGTGGCTCCATCTTCCTTCCAGG - Intergenic
1161203408 19:3028502-3028524 AGTCCCTCCCCGCCCCTTCCTGG + Intronic
1162829603 19:13276102-13276124 AGGGGCTCCCCACTCCTCCCTGG - Intronic
1164939504 19:32241639-32241661 AGAGGCTCCAAGCTCCCTCTCGG + Intergenic
1165874043 19:38993150-38993172 AGTGGCCCCACCATCCTCCCAGG + Intronic
1165903302 19:39178688-39178710 CGTGGCACCACCCTCCTTGCTGG + Exonic
1167510480 19:49893168-49893190 AGTGGCTCCCCGCTGCCTCCAGG - Intronic
925611684 2:5706788-5706810 AGTGGCCCCTGGCTCCCTCCGGG - Intergenic
925631936 2:5903423-5903445 TGTGGCTCCACGATGCTCCCTGG + Intergenic
925926695 2:8676292-8676314 GGTGTCTCCACGTTCCCTCCTGG + Intergenic
930997448 2:57737529-57737551 AGTGTCTCCACGCTCTGTCCAGG - Intergenic
941920023 2:170840964-170840986 AGTGGTTCAACTCACCTTCCCGG - Intronic
942047378 2:172107761-172107783 TTTGGCTCCACACTCCCTCCTGG + Intergenic
947382311 2:229556900-229556922 AGTGGCTGGAGGCTCCTTCCAGG + Intronic
948572424 2:238926075-238926097 AATGGCACCATGCTCCTCCCAGG + Intergenic
1169732688 20:8803351-8803373 AGTTGCTTCAAGCTTCTTCCAGG - Intronic
1174417042 20:50374230-50374252 AGTGGCACCTCTCTCCTTCCAGG - Intergenic
1175795074 20:61766073-61766095 TGTGGGCCCAGGCTCCTTCCTGG - Intronic
1178614174 21:34116049-34116071 TGTGGCACCACACTCCATCCTGG - Intronic
1184825330 22:46946749-46946771 AGGGGCCCCAGGCTCATTCCAGG - Intronic
952945919 3:38477857-38477879 AGTGGCCACACACTCCTGCCTGG - Exonic
953138498 3:40205067-40205089 GGGGGCTCCAGGGTCCTTCCTGG - Intronic
954107270 3:48416079-48416101 AATGGCTCCAAGCTCCTGACTGG - Exonic
955644896 3:61126755-61126777 ACTCTCCCCACGCTCCTTCCGGG - Intronic
961322971 3:126090990-126091012 AGTGGCTCCAATCCCCTTCTAGG + Intronic
962920304 3:139944297-139944319 AGTGGCTCCACTTTGCATCCAGG - Intronic
962956140 3:140268632-140268654 AGAGGTTCCATTCTCCTTCCTGG + Intronic
963150317 3:142039428-142039450 AGTGGCACCACACTCCAGCCTGG - Intronic
964545718 3:157831030-157831052 AGAGGCTGCAGGCTCCTTGCAGG - Intergenic
966399847 3:179537085-179537107 AGAGGCCCGAAGCTCCTTCCAGG + Intergenic
967135373 3:186508633-186508655 AGTGGCTGCCCTCTCCTTCCAGG + Intergenic
968289607 3:197528349-197528371 ACTGGCTCCACGCTCTCTCCTGG - Intronic
968662063 4:1802770-1802792 AGTGCCTCCACGCCTCCTCCAGG + Intronic
969086478 4:4660249-4660271 AGTGGCTCCCTGCTGCCTCCAGG - Intergenic
969606935 4:8206478-8206500 AGAGGCTCCCAGCTCCTCCCTGG - Intronic
969760004 4:9174677-9174699 AGGGACTCCACGATCCTTCCAGG + Intronic
971829182 4:31668235-31668257 ATTGGCTCCATGCTGCTTTCAGG + Intergenic
975536903 4:75460576-75460598 AGTGGCTCCCAGTTGCTTCCTGG - Intergenic
985743591 5:1634069-1634091 ATTGTCTCCAAGCGCCTTCCCGG - Intergenic
985966052 5:3339457-3339479 AGGGGCTCCACGCTGCACCCAGG + Intergenic
986215719 5:5717114-5717136 ATTGGCCCCAGGCTGCTTCCTGG + Intergenic
986370661 5:7077316-7077338 AGTGACCCCAGGCTCCCTCCAGG + Intergenic
988064614 5:26218595-26218617 AGTGGCTCCAGGGCGCTTCCAGG - Intergenic
990982068 5:61610867-61610889 AGTGGCTCCAGTCTGTTTCCTGG + Intergenic
993467834 5:88269404-88269426 CGTAGCTCTACCCTCCTTCCGGG + Intronic
997751248 5:136347915-136347937 ACTGGCTCCTGGCTGCTTCCAGG - Intronic
999273841 5:150315057-150315079 AGTGGCTCTTAGTTCCTTCCTGG - Intronic
1000582238 5:163048618-163048640 CCTGGCTTCAGGCTCCTTCCAGG + Intergenic
1001449194 5:171810960-171810982 AGTGGCTCCCTACTGCTTCCAGG + Intergenic
1002182262 5:177436715-177436737 AGAGGCTCCAAGCCCCATCCAGG - Intronic
1006606109 6:35259179-35259201 AGAGCCTCCAGGCTTCTTCCCGG - Intronic
1008393089 6:50975671-50975693 TGTGGCTCCAGACTGCTTCCAGG - Intergenic
1016361791 6:143275279-143275301 AGTCGCTCCCCTCTCCTGCCTGG - Intronic
1018608792 6:165626124-165626146 GCTGGCTGCACCCTCCTTCCTGG - Intronic
1019147688 6:169985485-169985507 AACGGCTCCACGCACCCTCCAGG + Intergenic
1023827365 7:44018662-44018684 AGTGGCTCCTCGCTGCCTGCGGG - Intergenic
1026639200 7:72109635-72109657 AGTGGCTCCACGCTCCTTCCAGG - Intronic
1029738521 7:102478409-102478431 AGTGGCTCCTCGCTGCCTGCGGG - Intronic
1029755651 7:102572072-102572094 AGTGGCTCCTCGCTGCCTGCGGG - Intronic
1029773600 7:102671152-102671174 AGTGGCTCCTCGCTGCCTGCGGG - Intronic
1031567326 7:123316989-123317011 AATGGCTCCTAGCTCCATCCAGG - Intergenic
1032037675 7:128531768-128531790 CGCCGCTCCACGCTCCTCCCGGG - Intergenic
1033610895 7:142962219-142962241 TGTGGCTCCAGAATCCTTCCTGG + Exonic
1034564045 7:151899414-151899436 GGTGGCTCCAGGGTCCATCCTGG + Intergenic
1034698428 7:153075476-153075498 ACTGGCTCCAAGAGCCTTCCTGG - Intergenic
1035092821 7:156328698-156328720 AGTGGCTCCTTGCTTCTTCTTGG + Intergenic
1035779672 8:2217433-2217455 AGTGGCTCCAGGCTGCTGTCTGG - Intergenic
1036263619 8:7258408-7258430 AGGGACTCCACGATCCTTCCAGG + Intergenic
1036264920 8:7266030-7266052 AGGGACTCCACGATCCTTCCAGG + Intergenic
1036266221 8:7273652-7273674 AGGGACTCCACGATCCTTCCAGG + Intergenic
1036267522 8:7281274-7281296 AGGGACTCCACGATCCTTCCAGG + Intergenic
1036268824 8:7288896-7288918 AGGGACTCCACGATCCTTCCAGG + Intergenic
1036270127 8:7296518-7296540 AGGGCCTCCACGATCCTTGCAGG + Intergenic
1036297768 8:7550537-7550559 AGGGACTCCACAATCCTTCCAGG - Intergenic
1036299072 8:7558185-7558207 AGGGACTCCACAATCCTTCCAGG - Intergenic
1036300377 8:7565835-7565857 AGGGACTCCACAATCCTTCCAGG - Intergenic
1036301681 8:7573479-7573501 AGGGACTCCACGATCCTTCCAGG - Intergenic
1036302978 8:7581128-7581150 AGGGACTCCACGATCCTTCCAGG - Intergenic
1036315660 8:7716947-7716969 AGGGACTCCACGATCCTTCCAGG + Intergenic
1036316968 8:7724595-7724617 AGGGACTCCACGATCCTTCCAGG + Intergenic
1036318275 8:7732243-7732265 AGGGACTCCACGATCCTTCCAGG + Intergenic
1036319584 8:7739890-7739912 AGGGACTCCACGATCCTTCCAGG + Intergenic
1036320891 8:7747538-7747560 AGGGACTCCACGATCCTTCCAGG + Intergenic
1036322201 8:7755186-7755208 AGGGACTCCACGATCCTTCCAGG + Intergenic
1036323510 8:7762834-7762856 AGGGACTCCACGATCCTTCCAGG + Intergenic
1036324805 8:7770481-7770503 AGGGACTCCACAATCCTTCCAGG + Intergenic
1036351229 8:8013826-8013848 AGGGACTCCACGATCCTTCCAGG - Intergenic
1036352535 8:8021472-8021494 AGGGACTCCACGATCCTTCCAGG - Intergenic
1036353827 8:8029120-8029142 AGGGACTCCACGATCCTTCCAGG - Intergenic
1036846500 8:12174245-12174267 AGGGACTTCACGATCCTTCCAGG - Intergenic
1036867863 8:12416564-12416586 AGGGACTTCACGATCCTTCCAGG - Intergenic
1039595702 8:38788106-38788128 AGTCGCTCCCCGGCCCTTCCCGG + Intronic
1040110437 8:43564807-43564829 AGGGACTCCACGGTCCTCCCTGG + Intergenic
1041284025 8:56242086-56242108 AGTGGCTCCATGCTGCTATCTGG + Intergenic
1043354658 8:79398508-79398530 AGTTCCTCAATGCTCCTTCCTGG + Intergenic
1046618661 8:116504172-116504194 TGTGGCTCCACCCTCTTTCCAGG - Intergenic
1048638026 8:136320977-136320999 AGTTGCTTCACCTTCCTTCCAGG - Intergenic
1049593341 8:143472464-143472486 AGGGGCTGCACACTCCTCCCTGG - Intronic
1050241319 9:3638640-3638662 AGTGACTCCACCTTCCCTCCTGG - Intergenic
1053417296 9:37954796-37954818 AGTGGCTCCACATTACCTCCAGG - Intronic
1053653701 9:40194667-40194689 AGTGCCCCCAAGCTCCTGCCTGG - Intergenic
1053904085 9:42823826-42823848 AGTGCCCCCAAGCTCCTGCCTGG - Intergenic
1054530900 9:66181687-66181709 AGTGCCCCCAAGCTCCTGCCTGG + Intergenic
1056757248 9:89389456-89389478 AGTGGCGGCAGCCTCCTTCCAGG + Intronic
1057042516 9:91857762-91857784 TGTGGCTCCAGGCCCCTCCCAGG - Intronic
1057918457 9:99075724-99075746 AGTGGCTCCACCATCCAGCCAGG + Intergenic
1060434925 9:123585043-123585065 TGTGGCTCCACCCTCCTGCTGGG - Intronic
1061485647 9:130919327-130919349 AGTGTCCCCACGCTACTGCCTGG - Intronic
1061800591 9:133111652-133111674 AGTGGCTCCAGCCTCCCTTCTGG + Intronic
1061954117 9:133952882-133952904 AGTGGGGCCATGCTCCCTCCAGG - Intronic
1062115331 9:134805446-134805468 AGTGGCTCCTCCCGCCCTCCAGG - Intronic
1062191645 9:135250914-135250936 ACCGGCTCCACCCTGCTTCCTGG - Intergenic
1062389633 9:136328753-136328775 AGGGGCTCAGCGCTCCATCCAGG - Intronic
1062390877 9:136333415-136333437 AGTGACCCCACACTCCTCCCCGG + Intronic
1186485037 X:9927780-9927802 CCTGCCTCCACGCTCCTCCCTGG - Intronic
1187293545 X:17977735-17977757 ATTGGCTCCACACTCCTGCATGG + Intergenic
1187300541 X:18045001-18045023 AGTGACTTTACGCTCCTTTCTGG + Intergenic
1187698152 X:21941072-21941094 GCTGGCTCCGCGCTCCGTCCCGG + Intronic
1189411263 X:40774041-40774063 CGTGACTCCTCTCTCCTTCCTGG - Intergenic
1190497471 X:51040502-51040524 CATGTCTCCACCCTCCTTCCTGG + Intergenic
1193625944 X:83819896-83819918 TTTGGCTCCACGCTGCTCCCGGG + Intergenic
1193919464 X:87407283-87407305 AGTGGCTCCACCCTCCTGGGCGG - Intergenic
1200903823 Y:8460859-8460881 TATGACTCCACTCTCCTTCCTGG + Intergenic