ID: 1026639202

View in Genome Browser
Species Human (GRCh38)
Location 7:72109653-72109675
Sequence CATGACCTCAAGCTGAGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 78}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026639202_1026639205 3 Left 1026639202 7:72109653-72109675 CCACTACTCAGCTTGAGGTCATG 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1026639205 7:72109679-72109701 CACTGTGCTCAAGGACACTGTGG 0: 1
1: 0
2: 2
3: 37
4: 236
1026639202_1026639208 15 Left 1026639202 7:72109653-72109675 CCACTACTCAGCTTGAGGTCATG 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1026639208 7:72109691-72109713 GGACACTGTGGTGGAGGACATGG No data
1026639202_1026639209 25 Left 1026639202 7:72109653-72109675 CCACTACTCAGCTTGAGGTCATG 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1026639209 7:72109701-72109723 GTGGAGGACATGGCCTCATGTGG No data
1026639202_1026639206 6 Left 1026639202 7:72109653-72109675 CCACTACTCAGCTTGAGGTCATG 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1026639206 7:72109682-72109704 TGTGCTCAAGGACACTGTGGTGG No data
1026639202_1026639207 9 Left 1026639202 7:72109653-72109675 CCACTACTCAGCTTGAGGTCATG 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1026639207 7:72109685-72109707 GCTCAAGGACACTGTGGTGGAGG No data
1026639202_1026639204 -6 Left 1026639202 7:72109653-72109675 CCACTACTCAGCTTGAGGTCATG 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1026639204 7:72109670-72109692 GTCATGGCACACTGTGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026639202 Original CRISPR CATGACCTCAAGCTGAGTAG TGG (reversed) Intronic
903021102 1:20395760-20395782 AAGGACATCATGCTGAGTAGGGG + Intergenic
905395539 1:37664100-37664122 CTTGTCCTCAAGCTTAATAGGGG - Intergenic
906545983 1:46619810-46619832 CATGTGCCCAGGCTGAGTAGTGG - Intergenic
908422989 1:63977811-63977833 CATCCCCTCAGGCTGAATAGTGG + Intronic
908804534 1:67916620-67916642 CCTGACCTCAAGTAGAGCAGTGG - Intergenic
909407485 1:75307762-75307784 CATAACCTCAAGCTGTGGATTGG - Intronic
915640782 1:157224339-157224361 CAGGACCTGGTGCTGAGTAGAGG - Intergenic
918444020 1:184597948-184597970 CATGATCTCCAGCTGACTATGGG - Intronic
922009890 1:221572511-221572533 CCTGAGCTCAAGCAGAGCAGGGG + Intergenic
922525252 1:226297084-226297106 CCTGACCACAAGCAGAGAAGAGG + Intronic
1067170001 10:43898591-43898613 CACGAATTTAAGCTGAGTAGAGG + Intergenic
1068490290 10:57714622-57714644 AATCACCTGAAGCTGAGAAGTGG - Intergenic
1068618400 10:59148340-59148362 CATGTCCACAACCTGAGTTGAGG - Intergenic
1072312928 10:94173689-94173711 TATGACCTACAGCTGGGTAGAGG + Intronic
1073338588 10:102728667-102728689 TATTTTCTCAAGCTGAGTAGGGG + Intronic
1075448642 10:122531420-122531442 AGTGACCCCAAACTGAGTAGCGG - Intergenic
1077671839 11:4165012-4165034 AATGACATCAAGCTGAGAATTGG + Intergenic
1080413798 11:32051055-32051077 CATTAGCTGGAGCTGAGTAGTGG - Intronic
1084978880 11:72817994-72818016 CCTGACCTGAAGCTGAGCAGGGG + Intronic
1087337966 11:96867698-96867720 CATGCCCTTAAGCTGACTTGGGG + Intergenic
1090407427 11:126485372-126485394 TATGAGCTCCAGCTGAGAAGTGG - Intronic
1097244401 12:57599200-57599222 TATGACCTCAAGGTAAGAAGAGG + Exonic
1098430208 12:70410967-70410989 CCTGAGCTCAAATTGAGTAGTGG + Intronic
1099930838 12:89072550-89072572 CCTGGCCTTAAGCTGTGTAGTGG - Intergenic
1101638767 12:106569945-106569967 CATAACTTCATGCTGTGTAGTGG - Intronic
1102726868 12:115073470-115073492 CATGGCCCCAGGCTGAGTAAGGG + Intergenic
1103852007 12:123939420-123939442 CATGACCCCATGCTAAGTCGAGG - Intronic
1107982229 13:45744699-45744721 CATTAATTCATGCTGAGTAGAGG + Intergenic
1109269329 13:60236795-60236817 CATGACTGCAGGCTGCGTAGGGG + Intergenic
1110619657 13:77581068-77581090 CATGACATCAAACTTTGTAGAGG - Intronic
1111993479 13:95139460-95139482 CATGAGGGCAAGCTGTGTAGGGG + Intronic
1112489377 13:99848180-99848202 CGGCACCTCAAGCTGAGAAGGGG - Intronic
1113362624 13:109645260-109645282 CTTGACCTCAAGGGGAGAAGAGG + Intergenic
1113364737 13:109665565-109665587 CCTGACATCAAGCTGAGCAGTGG + Intergenic
1118743962 14:68760778-68760800 CATGATCTCAAAATAAGTAGTGG + Intergenic
1120720122 14:87881420-87881442 TGTGACCTCATGCTGATTAGTGG + Intronic
1121426795 14:93857984-93858006 CATGACCTGAAGGTGAGAAAGGG + Intergenic
1121508940 14:94497994-94498016 CAGGACCTCAAACTGAGCATTGG - Exonic
1122193316 14:100065500-100065522 CATGGCCACAAGGTGAGTATTGG + Exonic
1125213783 15:37245706-37245728 TGTGACCTCAATCTGACTAGGGG + Intergenic
1127187562 15:56494977-56494999 TATGACCACCAGCTGAGTACTGG - Intergenic
1128588422 15:68872740-68872762 CATGTCATCAGGCCGAGTAGGGG - Intronic
1129267618 15:74402536-74402558 CATTTCCTCAAGCTGAGGAATGG + Intergenic
1132629414 16:909777-909799 CATGACCTGAAGCTGAACACAGG + Intronic
1135500996 16:22995528-22995550 CATGACCTCAACATAAGTTGAGG - Intergenic
1141361778 16:83401933-83401955 CAAGACCTCAAGCTCTGGAGGGG - Intronic
1142095258 16:88235927-88235949 GATGACTTCAAGGTGAGGAGGGG + Intergenic
1142236126 16:88923413-88923435 AGAGACCTCAAGCTGAGTGGGGG + Intronic
1148117120 17:45182641-45182663 CCTGACCCCTAGCTGAGTGGTGG - Intergenic
1151163779 17:72187293-72187315 GATGACCTTAAGCTGGGTGGGGG - Intergenic
1161009191 19:1952014-1952036 CAGGACCTTAAGCTGAGAAGTGG + Intronic
1163152478 19:15423403-15423425 CATGACCCCATGGTGAGTGGAGG - Intronic
1163833939 19:19562235-19562257 GATGACCTCCAGCTCAGTGGAGG + Intronic
931518148 2:63064874-63064896 CATAACCTCATGGTGAGTAAAGG - Intergenic
935357834 2:102221061-102221083 CATGTGCTCAGGGTGAGTAGAGG - Intronic
938549732 2:132369035-132369057 CATGGCATCAAGCTGAGGAGCGG - Intergenic
941884492 2:170514217-170514239 CATGACCTCAAGGTCACGAGCGG - Intronic
944537240 2:200723209-200723231 CATGACCTGAAGATAAGAAGAGG - Intergenic
1169798344 20:9490207-9490229 CATGACCTCAAACTATGTGGAGG + Intergenic
1170793295 20:19525532-19525554 GATGACCTCAAGCAGGGCAGGGG + Intronic
1173190397 20:40871432-40871454 AAAGACCTCAGGCTGGGTAGGGG - Intergenic
1174270004 20:49361215-49361237 CATCACCTCCAGTTGAGAAGAGG - Intergenic
1181468863 22:23125876-23125898 CAGGACCTCAAGCAAAGTGGGGG + Intronic
1185358388 22:50389286-50389308 CATGACCTCAAGGTCAGCACTGG - Intronic
949904459 3:8847322-8847344 CAAGACCTCGGGCTGAGTAGCGG + Intronic
956956178 3:74343536-74343558 CATCACCTCAAGGTATGTAGAGG + Intronic
972490616 4:39583424-39583446 AATGACCTGAAGCTGATTATCGG - Intronic
975812450 4:78182982-78183004 CAGGAACTCAGGCTGAGAAGAGG + Intronic
977421100 4:96800811-96800833 CATGACATCTATCTGTGTAGGGG - Intergenic
987068340 5:14311117-14311139 CAAGGCCTCAAGCTGAGTTTGGG - Intronic
999496335 5:152102404-152102426 CGTGTCCTGAAGCTGAGTAGAGG + Intergenic
1005636157 6:27755279-27755301 CATGATCTCAAGGTGAGAAGGGG - Intergenic
1011718654 6:90132750-90132772 CATGAATACAAGCTGAGTTGTGG - Intronic
1011764395 6:90604606-90604628 CTTGACCTCAAGCTCTTTAGTGG + Intergenic
1012411956 6:98968907-98968929 CATCACCAAAAGCTGAGCAGAGG - Intergenic
1021628021 7:22614100-22614122 CATCTCCTCAAGCTGAATTGTGG + Intronic
1026639202 7:72109653-72109675 CATGACCTCAAGCTGAGTAGTGG - Intronic
1031173797 7:118323901-118323923 AATGAACCCAAGATGAGTAGAGG - Intergenic
1034291154 7:149932840-149932862 CAAGACCTGAACCTGAGCAGAGG + Intergenic
1034814944 7:154164092-154164114 CAAGACCTGAACCTGAGCAGAGG - Intronic
1039009139 8:33074173-33074195 CATGTCCCCAAGCTGGGTAGGGG + Intergenic
1051233122 9:14973450-14973472 CATAATATCAAGGTGAGTAGAGG - Intergenic
1055154953 9:73051043-73051065 CAAGACCGCCAGCTGAGCAGAGG + Intronic
1187040930 X:15595120-15595142 CTTGACCTTCAGCGGAGTAGAGG - Intronic
1197386968 X:125813872-125813894 AATGACCACAAGATGAGTATGGG + Intergenic
1199722186 X:150549859-150549881 CATACCGTCAAGCTGAGTATGGG - Intergenic
1199768036 X:150954550-150954572 CAAGTCCTCAAGCTGTGGAGGGG + Intergenic