ID: 1026639206

View in Genome Browser
Species Human (GRCh38)
Location 7:72109682-72109704
Sequence TGTGCTCAAGGACACTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026639200_1026639206 24 Left 1026639200 7:72109635-72109657 CCTGGAAGGAGCGTGGAGCCACT 0: 1
1: 0
2: 0
3: 31
4: 169
Right 1026639206 7:72109682-72109704 TGTGCTCAAGGACACTGTGGTGG No data
1026639202_1026639206 6 Left 1026639202 7:72109653-72109675 CCACTACTCAGCTTGAGGTCATG 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1026639206 7:72109682-72109704 TGTGCTCAAGGACACTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026639206 Original CRISPR TGTGCTCAAGGACACTGTGG TGG Intronic
No off target data available for this crispr