ID: 1026642600

View in Genome Browser
Species Human (GRCh38)
Location 7:72140427-72140449
Sequence CAGGAGCAGCAGAAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1118
Summary {0: 1, 1: 0, 2: 12, 3: 108, 4: 997}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026642600 Original CRISPR CAGGAGCAGCAGAAGGAGGT GGG (reversed) Intronic
900367525 1:2317360-2317382 CAGGAGGGGCACAGGGAGGTAGG + Intergenic
900858262 1:5203709-5203731 CAGGAGCAGGAGGAAGAGGGTGG + Intergenic
901195089 1:7435940-7435962 CAGGAGCAGAGGAGGGAGCTGGG + Intronic
901210173 1:7520197-7520219 GAGGAGGAGGAGGAGGAGGTCGG - Intronic
901276660 1:7996826-7996848 CAGGAGCAAGAGATGGGGGTCGG + Intergenic
901604731 1:10450237-10450259 GAGCAGCAGCAGCAGGAGGCCGG - Exonic
901737542 1:11321998-11322020 CAGGCTCAGCAGAAGGATGGAGG - Intergenic
901762676 1:11480765-11480787 CAGGTGTAGTAGTAGGAGGTGGG - Intronic
902513459 1:16978241-16978263 CAGGAATAGCAGGAAGAGGTAGG + Exonic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
902783922 1:18721025-18721047 CGGGAGCAGCAGCAGCAGGCAGG + Intronic
902828650 1:18995454-18995476 GAGGAGGAGGAGGAGGAGGTAGG - Intergenic
903271356 1:22190369-22190391 CAGGAGCACCAGAATGGGGAAGG + Intergenic
903413811 1:23168224-23168246 CAGCAGCAGGAGGAGGAGGGCGG - Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903603527 1:24558632-24558654 CAGGAGCAACAGGATGAGGGGGG - Intronic
903651768 1:24926939-24926961 CTTGAGCAGCAGAAGGAAGGCGG - Intronic
903907403 1:26696488-26696510 CAGCAGCAGCGGGAGGAGGCGGG + Exonic
903959213 1:27046213-27046235 AAGGAGGAGAAGAAGAAGGTGGG - Intergenic
904286026 1:29453798-29453820 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
904295184 1:29515711-29515733 GAGGAGCAGGAGGAGGAGGAGGG - Intergenic
904540170 1:31227516-31227538 CAGTTACAGCAGAATGAGGTGGG + Intronic
904601299 1:31674081-31674103 CAGAAGCAGCCAGAGGAGGTCGG - Intronic
904945782 1:34197786-34197808 CAGGACGTGCAGGAGGAGGTCGG - Exonic
904946783 1:34205200-34205222 CAGAAGCAGCAGAAGGACCCTGG + Intronic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905402782 1:37715711-37715733 CAGGAGCAGTAGAACCAGGGAGG - Intronic
905431842 1:37930453-37930475 CAATGGCAGCAGAAAGAGGTGGG - Intronic
905824611 1:41018667-41018689 CAGGAGGCGCAGAAGAAAGTGGG - Intronic
905948447 1:41924218-41924240 CACCAGGAGCAGAAAGAGGTAGG + Intronic
906052714 1:42888035-42888057 CACGAGCAGCAGCAGCAGGAAGG + Intergenic
906112990 1:43337082-43337104 CAGGAGCAACAGCATTAGGTGGG - Intergenic
906124442 1:43418835-43418857 AAAGAGCAGCAGCAGGAGGAGGG + Intronic
906124443 1:43418838-43418860 GAGCAGCAGCAGGAGGAGGGTGG + Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906192113 1:43905280-43905302 GAAGAGGAGCAGAAGGAGGCAGG - Intronic
906237874 1:44222740-44222762 CAGGAGCATCTAAGGGAGGTGGG - Intronic
906258412 1:44367986-44368008 CAGGGGCAGCAGGAGGTCGTAGG - Intergenic
906262523 1:44405367-44405389 CAGCAGCAGCAGTAGGCGGCTGG - Exonic
906510071 1:46405742-46405764 CAGATGCCGCAGAAGGAGGAGGG - Exonic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906702638 1:47871236-47871258 CAGGAGCAGGAGAATGTGCTTGG + Intronic
906860375 1:49352869-49352891 TAGTAGCAGCAGATGGAGTTGGG + Intronic
906952175 1:50343881-50343903 AGGGACCAGGAGAAGGAGGTTGG - Intergenic
907320560 1:53599597-53599619 CAGGAGAAGCTGTAGGAGGCGGG + Intronic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907559282 1:55373978-55374000 CATGCTCAGCAGAAGGAGTTTGG + Intergenic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
907894545 1:58673872-58673894 CAGGAGCACCAGTAGCAGGTGGG + Intronic
907916377 1:58873554-58873576 CAGCAGCAGAATAGGGAGGTTGG - Intergenic
908349165 1:63267111-63267133 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
908776958 1:67649701-67649723 AAGGAGAATCAGGAGGAGGTAGG + Intergenic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909362448 1:74779200-74779222 CAGGAGCAGAAGAGGGGTGTAGG - Intergenic
910017555 1:82546350-82546372 GAGGAGCATCAGAAAGAGGGAGG + Intergenic
910444033 1:87282519-87282541 CAGGAGCAACATAAGGAAGCTGG + Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911474309 1:98357482-98357504 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
912215972 1:107612787-107612809 CAGCAGCTGGAAAAGGAGGTAGG - Intronic
912502326 1:110130511-110130533 CAGGAGCAGCAGGGGGAGCCAGG + Intergenic
912518391 1:110229761-110229783 CGGGAGCGGCAGGAGCAGGTGGG - Intronic
912565773 1:110586174-110586196 CAGGAGCAGAAGAAGCAAGGGGG - Intergenic
913223401 1:116677636-116677658 GACGGGCAGCAGAAGGAGGAAGG - Intergenic
913275635 1:117135318-117135340 CAGGAGGTGCGGTAGGAGGTGGG + Intergenic
913317252 1:117563632-117563654 CAAGAGCTGCAGCAAGAGGTTGG + Intergenic
913582741 1:120243060-120243082 GAGGAGCAGGAGAAAGAGGCAGG - Intergenic
913625432 1:120655300-120655322 GAGGAGCAGGAGAAAGAGGCAGG + Intergenic
914564671 1:148854554-148854576 GAGGAGCAGGAGAAAGAGGCAGG - Intronic
914608155 1:149275688-149275710 GAGGAGCAGGAGAAAGAGGCAGG + Intergenic
914741966 1:150472755-150472777 CAGGAGGGGGAGGAGGAGGTGGG - Exonic
914747452 1:150510643-150510665 CTTGAGAAGCAGGAGGAGGTGGG + Intronic
914996483 1:152547164-152547186 CAGCTGCAGCACAAGCAGGTGGG - Intronic
914998297 1:152563990-152564012 CAGGGGCTGCAGAACAAGGTTGG - Intronic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915361619 1:155289400-155289422 CAGGAGGAGTAGGAGGAGGCAGG + Exonic
915622977 1:157097530-157097552 CTGGGGCAGGTGAAGGAGGTGGG - Intronic
915727772 1:158030912-158030934 CAGGATGAGCAGATGGAGCTGGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915835386 1:159171782-159171804 CAGGAGCAGGAGCAGGAGCGAGG - Exonic
915916004 1:159941429-159941451 CAAGAGCTCCAGACGGAGGTAGG + Intronic
916199890 1:162260699-162260721 AAGGAGCAGCAAAAAAAGGTGGG - Intronic
916407324 1:164510293-164510315 CAGGAAGAGGAGGAGGAGGTAGG - Intergenic
916412306 1:164558902-164558924 GAGGAGGAGCTGAAGGAGGCTGG + Intronic
916436687 1:164784228-164784250 CAGGAGCTACAGAAGTTGGTAGG - Intronic
916797509 1:168180322-168180344 CAGGAGGAGGAGAAGCAGATGGG + Intronic
916944999 1:169717613-169717635 CAGGAGCAAGAGAGGGATGTGGG + Intronic
916987324 1:170205861-170205883 AAGAAGGAGGAGAAGGAGGTAGG - Intergenic
917097961 1:171418391-171418413 CAGGACAACTAGAAGGAGGTGGG + Intergenic
917216275 1:172681307-172681329 GAGAAGGAGAAGAAGGAGGTTGG + Intergenic
917339647 1:173962030-173962052 CAGGAGCAGATGGTGGAGGTCGG + Exonic
917733532 1:177899832-177899854 AAGGAACAGTGGAAGGAGGTTGG + Intergenic
917792984 1:178511752-178511774 CAAAATTAGCAGAAGGAGGTGGG + Intergenic
917854972 1:179092404-179092426 CAGGTCCAGCAGAATGAGGGAGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918105967 1:181415489-181415511 GAGAAGGAGTAGAAGGAGGTGGG + Intronic
918309472 1:183275490-183275512 CAGAGGCAGCAGAAGGATTTGGG - Intronic
918547012 1:185696517-185696539 TAGCTGCAGCAGAAGGAGGACGG - Intergenic
919059212 1:192609220-192609242 CAGTAGCAGCAGATGGTGCTTGG - Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919879942 1:201894811-201894833 CAGGTGCAGGGGAAGGAGCTAGG + Intergenic
919924102 1:202183378-202183400 CTGCAGGAGCTGAAGGAGGTGGG + Intergenic
920095529 1:203484056-203484078 CAGGTGGAGCACAAGCAGGTTGG - Exonic
920178225 1:204116662-204116684 CGGCAGCAGCAGGAGCAGGTAGG + Exonic
920843836 1:209577003-209577025 GAGGAGCAGCACCTGGAGGTAGG + Intergenic
920845240 1:209588139-209588161 CAGCACCAGCAAAAGGAGGGTGG + Intronic
920857597 1:209675627-209675649 CAGGAGGAGCAGCAGGAGAGGGG - Intronic
921060251 1:211578961-211578983 CCGGAGCAGGAGCAGGAGGGCGG + Intergenic
921718401 1:218443350-218443372 AAAGAGCAGCATAAGGAGGCGGG + Exonic
921734505 1:218612007-218612029 GAGGAGAAGGAGAAGGGGGTAGG - Intergenic
921734794 1:218614574-218614596 CAAAAGCAGCAGAAGGAGGTGGG - Intergenic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
922342415 1:224668658-224668680 CTGGACCAGAAGAAGGAGGGAGG + Intronic
922356291 1:224779521-224779543 CAGGAGCAGGAGAGAGAGGGTGG + Intergenic
922451095 1:225737937-225737959 CAGGACCAGGTGAAGGAGGAAGG - Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922983365 1:229847578-229847600 CAGGAGCAGCAGAATGACCAAGG + Intergenic
923000397 1:230002283-230002305 CAGGTGCAGCAGGAGGAGCAAGG + Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923658542 1:235939123-235939145 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
923788043 1:237086822-237086844 CAGCTGCAGTAGAACGAGGTTGG + Intronic
923976534 1:239270726-239270748 CCTGATCAGGAGAAGGAGGTAGG - Intergenic
924679864 1:246220616-246220638 CATGAACAGCAGCAGGAGGCAGG + Intronic
1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG + Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1064234969 10:13565365-13565387 CAGGAGCAGGGGATGGGGGTGGG - Intergenic
1064510777 10:16088511-16088533 GAAGAGCAGAAGGAGGAGGTGGG + Intergenic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1065108925 10:22420930-22420952 CAGGAGAACCAGCAGCAGGTTGG + Intronic
1065588362 10:27241441-27241463 GAGGAGCAGCCGAAGGAGAGAGG + Intronic
1065905466 10:30247327-30247349 TAGGAGCAGTTGAAGGAGGAGGG - Intergenic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1066499027 10:35972180-35972202 CAGGAGCAAGAGAGAGAGGTAGG + Intergenic
1066554000 10:36591117-36591139 AAGGAGCAGGAGAAGGTGCTGGG + Intergenic
1066602842 10:37126028-37126050 CCGGGGCTGCAGGAGGAGGTGGG + Intronic
1066608517 10:37209416-37209438 CAGGAGCAAGAGAGAGAGGTGGG + Intronic
1067019123 10:42780041-42780063 CTGGAGCAGGAAAAGGTGGTGGG + Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067545313 10:47188463-47188485 GAGGAGAAGGAGAAGGAAGTGGG + Intergenic
1067560356 10:47300692-47300714 CAGCAGCAGCAGCAGCAGCTGGG - Exonic
1067564975 10:47329984-47330006 CAGGAGCATCAGGCGGGGGTGGG - Intergenic
1067712123 10:48657689-48657711 CATTAGCAGCAGCAGAAGGTAGG + Intergenic
1067945141 10:50684456-50684478 CAGGAGCTGGAGCAGGAGGAAGG + Intergenic
1068453612 10:57226407-57226429 CAGGAAGAGCAGAAGTAGGGAGG + Intergenic
1068981799 10:63070470-63070492 GAGGAGGAGAAGGAGGAGGTGGG - Intergenic
1069668746 10:70183624-70183646 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070393862 10:75994542-75994564 CGGGAGCAGGAGAGGGAGGCTGG + Intronic
1070538022 10:77393888-77393910 CAGGACCGGCAGAAGCAGGCCGG + Intronic
1070599083 10:77853379-77853401 GAGGAGGACCAGAAGGAGATCGG - Exonic
1071059219 10:81549641-81549663 TAGGAGCACCAGAAGGAGATGGG + Intergenic
1071119696 10:82263164-82263186 CAGTAGCAGTAACAGGAGGTGGG + Intronic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1071427963 10:85578578-85578600 AAGGAGAAGCAGAGGGAAGTGGG + Intergenic
1071598946 10:86946969-86946991 AAGGGGCTGCAGAAGGAGGCTGG + Intronic
1071633558 10:87233551-87233573 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1071647005 10:87365767-87365789 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1072092093 10:92138422-92138444 GAGGAGCAGCAGGAGGCGGAAGG + Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072563328 10:96596997-96597019 CAGGAGCAAGAGAGGGAGGCAGG + Intronic
1072740669 10:97907236-97907258 CACGGGCAGCAGGAGGAGGAAGG + Intronic
1072743526 10:97924360-97924382 GAGGAGCAGCTGAAGGAATTGGG + Intronic
1072806378 10:98426156-98426178 CAGGAGCAGCTGAGGGAGAGGGG - Intronic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1074080258 10:110162949-110162971 CAAGAACAGCAGAAGGGTGTGGG - Intergenic
1074134957 10:110618148-110618170 AAGGAGGAGGAGGAGGAGGTAGG + Intergenic
1074297023 10:112199383-112199405 CAGCAGCTGCAGGAGGAGATGGG + Intronic
1074509661 10:114100902-114100924 CCGGAGCAGAAGGAGGAGGCGGG + Intergenic
1075016647 10:118914537-118914559 CAGGAGCAAGAGAAAGAGTTGGG + Intergenic
1075148045 10:119899998-119900020 CAGGAGGAGAAGCAGGAGGAAGG - Intronic
1075411744 10:122233527-122233549 CATGAGCAAGAGAAGGAGTTGGG + Intronic
1075565464 10:123500481-123500503 CAGAAGCAGAGGAAGGAGGAAGG - Intergenic
1076128847 10:127997360-127997382 CAGCAGCAGCAGAGGGACTTGGG - Intronic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076634875 10:131875599-131875621 CAGAAGCAGCTGAAGGTGTTGGG - Intergenic
1076809432 10:132878943-132878965 GAGGAGCAGGACAAGGAGGGGGG + Intronic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1077103310 11:831635-831657 CAACAGCAGCAGCAGCAGGTGGG - Exonic
1077249083 11:1552841-1552863 CGGGGGCTGCAGGAGGAGGTAGG - Intergenic
1077250547 11:1558822-1558844 CAGGAGCTCCAGAAGCAGCTTGG - Intronic
1077251233 11:1561581-1561603 GAGGAGCGGCAGGGGGAGGTGGG + Intronic
1077562435 11:3272282-3272304 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077568329 11:3318102-3318124 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077592381 11:3502419-3502441 CAGGGGCTGCAGGAGGGGGTAGG - Intergenic
1077628931 11:3797710-3797732 GAGGAGGGGCAGAAGGAGTTCGG + Exonic
1077631982 11:3817153-3817175 CAGGAGCAGCAGAGACAGGCAGG - Intronic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1078040015 11:7851633-7851655 CAGGAACTGCAGAAGGTGCTGGG - Intergenic
1078060685 11:8040703-8040725 AAGGAGCAGTAGGAGGAGGAGGG + Intronic
1078190468 11:9089745-9089767 CAGGAGCACTTGTAGGAGGTGGG + Exonic
1078544571 11:12237748-12237770 CAGGAGCAGCAGCAGCAGCTGGG + Intronic
1078759155 11:14237857-14237879 TAAGAGCAGCAGAAGTAGGAGGG + Intronic
1079107018 11:17578291-17578313 CAGGGGCAGCAGCTGGAGGATGG - Intronic
1080394208 11:31875063-31875085 CAGGAGCAGCAGGAGGGGGAAGG - Intronic
1080640251 11:34154491-34154513 CAGGAGTATCAGAAGGTAGTGGG - Intronic
1080640520 11:34155785-34155807 CAGGGGCTGCAGAAGGCCGTGGG - Intronic
1081179027 11:39965224-39965246 GAGGAGCAGCATCAGGTGGTTGG - Intergenic
1081559645 11:44201775-44201797 CTGGAGCAGTAGAAGGAGAAGGG - Intronic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1082176511 11:49066254-49066276 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1082790467 11:57343250-57343272 AAGGAGGAGGAGGAGGAGGTAGG + Intronic
1082809045 11:57467621-57467643 CAGGAGCATCAGCAGGAGGCAGG - Exonic
1082883253 11:58058754-58058776 CAGCAGCTGCAGAAGCAGATCGG - Intronic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1083045318 11:59729249-59729271 CAGGAGAACCACAATGAGGTGGG - Intronic
1083049394 11:59763414-59763436 CTGGAGAAGCAAAAGCAGGTAGG + Intronic
1083880575 11:65546486-65546508 CAGGTGCAGCGGAAGGAGCCCGG + Exonic
1084764967 11:71302241-71302263 CAGCAGCAGCAGTAGGAGCATGG + Intergenic
1085477040 11:76795338-76795360 CAAGAGCAGCAGATGAAGGCGGG - Intronic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086486912 11:87315117-87315139 CAGTAGCAGCAGTAGTAGGGGGG - Intronic
1086689202 11:89769621-89769643 CAGGAGCAGCAGAAGCTGTAAGG + Intergenic
1086716656 11:90070350-90070372 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1087321178 11:96660703-96660725 CAGCAGGAGCTGAAGGAGCTTGG - Intergenic
1087541716 11:99530191-99530213 CAGGAGCAGGCCAAGGAGTTAGG - Intronic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1088757290 11:112896314-112896336 CAGGAGCAGGAGTGGGAGGTGGG - Intergenic
1089106989 11:116018678-116018700 CAGGAGCAAGAGAGTGAGGTGGG + Intergenic
1089276263 11:117338063-117338085 CAAGAGCAGCAGAAGGCAGAAGG - Intronic
1089666137 11:120021203-120021225 CAGGAGCAGGAGGAGGGGTTGGG - Intergenic
1090017317 11:123097749-123097771 CAGGAGGACAAGAAGGAGGAGGG + Intronic
1090072968 11:123560364-123560386 TAACAGCAGCAGAGGGAGGTGGG + Intronic
1090542368 11:127722392-127722414 CAGGAGGAGAAGAGTGAGGTGGG - Intergenic
1090938385 11:131365664-131365686 CATGAGGAGGAGGAGGAGGTGGG - Intergenic
1091131653 11:133151765-133151787 GAAGAGCAGGAGATGGAGGTGGG + Intronic
1091284779 11:134402521-134402543 CAGGTGTAACAGAGGGAGGTGGG - Intronic
1091297702 11:134485534-134485556 CAGGGGCAGCAGAAGGATGTGGG + Intergenic
1091545624 12:1499703-1499725 TGGGAGCAGCAGGAGGAGTTGGG - Intergenic
1091635553 12:2194102-2194124 GAGGAGCAGGAGGAGGAGGACGG - Intronic
1091690983 12:2597298-2597320 CAGGAGGAGCAGAAGGGGATGGG - Intronic
1091826214 12:3514703-3514725 CAGGAGCACCAGTGGGAGGGTGG + Intronic
1091848201 12:3673939-3673961 CAGAAGCAGCAGAGCGAGGTGGG - Intronic
1091907818 12:4203068-4203090 CAGGATCTAGAGAAGGAGGTGGG - Intergenic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092253243 12:6913099-6913121 AAGCTGCTGCAGAAGGAGGTGGG + Intronic
1092465673 12:8729473-8729495 CAGGAGAAGCAGCTGGACGTCGG - Intronic
1093561974 12:20552514-20552536 GAGGAGGAGCAGCAGGAGGGGGG + Intronic
1093661170 12:21758608-21758630 CAGGAGCAGCAGGAGAAGTATGG - Intergenic
1093917660 12:24823686-24823708 CAGGAGGAGGAGAGGGAGGGTGG - Intronic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1094404002 12:30094945-30094967 CAGGAGAAGAAGAAGGAGCGGGG - Intergenic
1095514505 12:42991114-42991136 GAGTATCAGCATAAGGAGGTGGG - Intergenic
1095973420 12:47921931-47921953 CAGGACTAGCAGAAGAATGTGGG - Intronic
1096037681 12:48486860-48486882 CACGAGCAACAGAACAAGGTGGG - Intronic
1096143890 12:49264861-49264883 CAGGAGCAGGAAGAGGAGGAAGG - Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1097053824 12:56238648-56238670 CTGGAGCTGGAGAAGGGGGTAGG + Exonic
1097221885 12:57455900-57455922 CAGGAGCAGCAGAGGGAGTGGGG + Intronic
1097410223 12:59243334-59243356 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1097616641 12:61891682-61891704 TAGGAGGAGGAGAAGGAGGAGGG + Intronic
1098058263 12:66532542-66532564 CAAGTGCAGCATAATGAGGTAGG - Intronic
1098227368 12:68338629-68338651 CTGCAGTAGGAGAAGGAGGTTGG - Intergenic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1099423916 12:82499751-82499773 CAGCGGTAGCAGAAGAAGGTGGG + Intergenic
1100002552 12:89855049-89855071 CAGGAGCAAGAGAGGGGGGTAGG + Intergenic
1100449926 12:94696063-94696085 GAGGAGCAGCAGCAGGGGGAAGG + Intergenic
1100725830 12:97407587-97407609 CAGGAGCTGCAGAGTGAGGTTGG - Intergenic
1100998872 12:100334253-100334275 CAAGAACAGCAGAAGTAAGTAGG + Exonic
1101022248 12:100565144-100565166 CAGGAGCAACAGAAGGAAGGTGG + Intergenic
1101147772 12:101857443-101857465 CAAGAGCAGGAGGAGGAGGAAGG - Intergenic
1101997586 12:109535955-109535977 CAGGTGCAGGAGCATGAGGTGGG - Exonic
1102822962 12:115923841-115923863 GAGGAGAAGGAGAAGGGGGTGGG - Intergenic
1102966934 12:117135148-117135170 CAGGAGCAGAGGCAGGAGGGAGG - Intergenic
1103548743 12:121720823-121720845 CAGGAGCATCAGAAGTCGCTGGG - Intronic
1103851560 12:123936920-123936942 CAAGAGAAGCAGAAGGAGAATGG + Exonic
1103904064 12:124318549-124318571 GAGGAGAAGCTGCAGGAGGTCGG - Intergenic
1104021248 12:124993828-124993850 CAGCAGCAGCAGCAGGAGCCCGG - Exonic
1104641765 12:130471710-130471732 CAGGAGCAGCAGGAGCATCTGGG - Intronic
1104642008 12:130473416-130473438 CAGGAGCAGCAGCAGCATCTGGG + Intronic
1104655375 12:130570533-130570555 CAGGAGCAACAGAAGGTGACAGG + Intronic
1104900843 12:132188857-132188879 GAGGAGCAGGAGCAGGAGGGAGG + Intergenic
1105782053 13:23714352-23714374 CAGGAGAAGAAAAAAGAGGTTGG - Intergenic
1106012201 13:25835676-25835698 CAGGAGCTGAAGAAGGTGCTTGG - Intronic
1106102642 13:26708046-26708068 CAGGGGCAGGGGAATGAGGTGGG - Intergenic
1107835481 13:44409581-44409603 CACGAACAGCAGAACAAGGTGGG + Intergenic
1107899255 13:44995822-44995844 CAGCAGCAGCAGCAGCAGCTGGG - Intronic
1108160568 13:47633848-47633870 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108639708 13:52371709-52371731 CAGCAGCAGCAGCAGGATGGGGG + Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1110028710 13:70576676-70576698 TAGGGGGAGCAGGAGGAGGTGGG - Intergenic
1110627412 13:77666873-77666895 GAGGAGGAGCAGAAGGAAGTTGG + Intergenic
1110628227 13:77675958-77675980 CAGAAGCAGCAGAAGCAGTAAGG + Intergenic
1111494941 13:89035313-89035335 CAGGAGCAAGAGAAAGAGGGAGG - Intergenic
1111664098 13:91245498-91245520 CAAGAGCAGCAGAGTGTGGTTGG - Intergenic
1111746018 13:92270413-92270435 CAGGAGCAGGAGAAAGAGAGAGG - Intronic
1113001926 13:105649329-105649351 CATGAACAGCTGAAAGAGGTGGG + Intergenic
1113491186 13:110693328-110693350 CAGCACCAGCAGCAGTAGGTGGG - Intronic
1113538963 13:111092070-111092092 GAGGAGGAACAGGAGGAGGTGGG + Intergenic
1114009193 14:18348970-18348992 CATGAGCAGGAGAAGGATCTGGG - Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115399424 14:32939833-32939855 GAGGAGCAGGAGGAGGAGGCCGG + Intronic
1115812460 14:37124835-37124857 CAGGAGCAAGAGAGAGAGGTAGG - Intronic
1115944846 14:38648455-38648477 CAGCAGCAGCAAAATGAGTTAGG + Intergenic
1116475344 14:45332794-45332816 CAGGAGCAGTAGAGGGAGATTGG + Intergenic
1116591020 14:46772838-46772860 CAGGAGGAGCCAAAGTAGGTAGG - Intergenic
1117325427 14:54664575-54664597 CAGGAGGAAGAGAAGGAAGTGGG - Intronic
1117625755 14:57636139-57636161 CAGGAGAACCAGTAGGAGTTAGG + Intronic
1117656395 14:57960831-57960853 CAGGAGCTGCAGAGGGACCTGGG - Intronic
1117963814 14:61187589-61187611 TTGGAGCAGCAGCAGGAGGCAGG - Intronic
1118638460 14:67769745-67769767 CAGGAGGAGAAGAAAGAGGGAGG + Intronic
1118878986 14:69810302-69810324 CAGGGACAGCAGGAGGAGCTGGG - Intergenic
1119021992 14:71124015-71124037 CAGGATCACCAGGAGGAGGCGGG - Intergenic
1119181018 14:72605289-72605311 CAGGAGCAGGAGGAGGGGATGGG + Intergenic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1120008864 14:79390422-79390444 CTGTAGCAGCAGAAAGAGGTAGG - Intronic
1120145969 14:80978663-80978685 CAGGTGCTGCAGATGGAGGCTGG + Intronic
1120262834 14:82209261-82209283 GAGGAGGAGGAGAAAGAGGTGGG + Intergenic
1120707904 14:87763320-87763342 CCAGAGCAGGAGAAAGAGGTGGG + Intergenic
1120880811 14:89413979-89414001 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1120949082 14:90024313-90024335 CAGGTGCAGCAGGCAGAGGTGGG - Intronic
1120953726 14:90063526-90063548 CTGGAGCAGGGGAGGGAGGTTGG + Intronic
1121224291 14:92309879-92309901 CATGAGTAGCAGAATCAGGTAGG - Intergenic
1121269199 14:92626676-92626698 TAGGAGTAGCAGAAGGATCTGGG + Intronic
1121614589 14:95304759-95304781 TCGGAGCTGCAGAAGGAAGTGGG - Intronic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1121827494 14:97022452-97022474 CAGGAGCAACAGGAAGACGTAGG - Intergenic
1121978124 14:98425094-98425116 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1122271704 14:100571183-100571205 CTGGACCACCAGAAAGAGGTAGG - Intronic
1122326453 14:100883547-100883569 CATGAGCAGCAGGAAGAGGTGGG + Exonic
1122886228 14:104711648-104711670 CCGGGGCAGCTGCAGGAGGTCGG - Exonic
1123107907 14:105851533-105851555 AAGGGGCCGCAGAAGCAGGTGGG - Intergenic
1123579430 15:21703251-21703273 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1123616057 15:22145762-22145784 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1123681982 15:22770101-22770123 CAGGAGCAGGAGGAGCAGATGGG - Intergenic
1124420511 15:29517076-29517098 CAGGAGGAGGAGAGGCAGGTTGG + Intronic
1124439281 15:29675039-29675061 CCAGAGCTGCAGCAGGAGGTCGG - Intergenic
1124593785 15:31077344-31077366 CACCTGGAGCAGAAGGAGGTGGG + Intronic
1124957876 15:34371263-34371285 AAGGAGGAGGAGAAGGAGGTGGG - Intergenic
1125136920 15:36354298-36354320 CCAGAGCAGCAAAAGTAGGTGGG + Intergenic
1125795793 15:42403095-42403117 CAGGAGCAGCAGAAGGACCCTGG - Intronic
1126450783 15:48806340-48806362 CAGAAGCAGCAGCAGGAAATGGG + Intronic
1127395572 15:58541710-58541732 CAGGAGCTGGAGAAGGAAGAAGG + Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128554746 15:68623696-68623718 CAGGAGCAGCAGCAGCGGGTGGG + Intronic
1128704575 15:69829215-69829237 GAGGAGGAGGGGAAGGAGGTGGG - Intergenic
1128726815 15:69994049-69994071 TAGGAACAACAGCAGGAGGTGGG + Intergenic
1128749541 15:70139225-70139247 GAGGAGCAGCAGGCGGAGGTGGG - Intergenic
1128809274 15:70558535-70558557 GTGGAGCAGCAGTAGGAGGGAGG - Intergenic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1128965248 15:72051831-72051853 CATGAACAGCAGGAGGAGGCAGG + Intronic
1128983328 15:72201736-72201758 GAGGAGCAGCAGATGGGCGTGGG - Intronic
1129093762 15:73181608-73181630 CAGGATCAGGAGAGTGAGGTGGG + Intronic
1129265653 15:74391906-74391928 CAGAGGCAGCAGTAGGCGGTGGG - Intergenic
1129327672 15:74809713-74809735 GAGGAGGAGCAGATGGAGGCAGG + Intergenic
1129839472 15:78734873-78734895 CAGGAGCAGCAGAAGAGGCTGGG + Intergenic
1130539293 15:84810449-84810471 CAGGATCAGCAGAAAGAACTGGG + Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1131885022 15:96903175-96903197 GAGGAGCAGTAGAAGGAGATTGG - Intergenic
1202988300 15_KI270727v1_random:437496-437518 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1132549152 16:547232-547254 GAGGAGCAGGAGGAGGAGGAGGG + Exonic
1132590871 16:725961-725983 AAGGAGCAGCAGCTGCAGGTGGG - Exonic
1132663422 16:1071406-1071428 GAGGGGCAGCAGATGGAGATGGG + Intergenic
1132729737 16:1355546-1355568 CAGGAGGAGCAGAGGTTGGTAGG + Intronic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133404767 16:5514720-5514742 GAGGAGCAGGAGGAGGAGGAGGG + Intergenic
1133436484 16:5784472-5784494 CAGGAGCAGCAGAGAGACGGGGG + Intergenic
1134065334 16:11224746-11224768 AAGGAGCAGGGGAAGGAGGCGGG - Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134794144 16:17019188-17019210 CACCAGCAACACAAGGAGGTGGG - Intergenic
1135815341 16:25627463-25627485 CAGGAGCAAGAGAGGGAGGGAGG + Intergenic
1135937521 16:26793668-26793690 AAGGAGCAGAAGAGGGAGGGAGG - Intergenic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136185683 16:28587555-28587577 CAGGGCCAGAAGATGGAGGTAGG - Intronic
1136252440 16:29014704-29014726 CAGAAGCAGAATAAAGAGGTGGG - Intergenic
1136616591 16:31402050-31402072 CAGGAGCTGCAGGAGGGGGTTGG + Intronic
1137468227 16:48730584-48730606 AAAGAGCAGCAGAAAGAGGGCGG - Intergenic
1137775014 16:51047213-51047235 CAGAAGCAGCAGCAGCAGCTGGG + Intergenic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1137908830 16:52354600-52354622 CAAGTGCAGCAGAAAGAGGGAGG - Intergenic
1138126174 16:54440503-54440525 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138969574 16:62128685-62128707 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1139389895 16:66600759-66600781 CAGCAGCAGCAGAAAAAGCTGGG + Intergenic
1139447462 16:67006669-67006691 CAGAAGCAGCAGGAGTAGGGTGG + Intronic
1139478644 16:67216045-67216067 AAAGAGCAGGAGAAGGAGGAAGG - Intronic
1139582189 16:67880292-67880314 CAGGATCAGCAGCAGGGGGCTGG - Intronic
1140199620 16:72884629-72884651 CAGGAGGAGGAGAAGGAGAAAGG + Intronic
1140421243 16:74821165-74821187 CAAGAGCAAGAGAAAGAGGTAGG - Intergenic
1140457208 16:75112438-75112460 CAGCTGCTGCAGGAGGAGGTGGG - Exonic
1140474813 16:75234573-75234595 GGGGAGCAGCAGGAGGTGGTGGG - Intronic
1140482186 16:75267629-75267651 CAGGAGCAAGGGAGGGAGGTGGG - Intronic
1140854709 16:78967881-78967903 CAGTAGCTGCAGGAGGAGGAGGG + Intronic
1140903546 16:79391914-79391936 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1141235431 16:82211517-82211539 CCAGAGCAGGAGAAAGAGGTGGG + Intergenic
1141323375 16:83033190-83033212 CAGGAGGAGCATGAGTAGGTTGG - Intronic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141578474 16:84981162-84981184 CAGGAGCAGAAAAAGGAGTCAGG + Intronic
1141623631 16:85250051-85250073 CAGGAGCTGCAGCAGGAGCCAGG - Intergenic
1141775760 16:86121753-86121775 CAGGAGGAGGAGGAGGAGGGAGG - Intergenic
1141810449 16:86372194-86372216 CAGCTGGTGCAGAAGGAGGTGGG - Intergenic
1142221406 16:88856764-88856786 CATGAGCAGGAGCAGGATGTTGG + Exonic
1142263946 16:89055007-89055029 CAGCAGCTGCAGAGGAAGGTGGG - Intergenic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142642479 17:1292444-1292466 GAGCAGCACCAGAAGGAGGGTGG - Intronic
1142698843 17:1647775-1647797 CAGGCTCAGCAGAATGAGGGAGG + Intronic
1142748460 17:1972950-1972972 CTGGAGCAGCAGGTGGGGGTCGG - Intronic
1143095815 17:4477767-4477789 TTGGAGCAGCACAGGGAGGTGGG - Intronic
1143100699 17:4503209-4503231 CAGGAGCCCCAGGTGGAGGTAGG + Intronic
1143141982 17:4745906-4745928 CAGGAGGAGCAGAGGGAGTTGGG - Exonic
1143542597 17:7578536-7578558 GAGGAGCAGCAGGAGGGGGGAGG + Exonic
1143588335 17:7863730-7863752 CAGGAGTAGGAGTAGGGGGTTGG - Intronic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144200286 17:12934868-12934890 CAGGAGTACCACAAGGAGGCTGG + Intronic
1144584608 17:16480731-16480753 CTGTAGCAGGAGAAGGAGATGGG - Intronic
1144626157 17:16845376-16845398 GAGGAGCTGCAGAACAAGGTAGG - Intergenic
1144633286 17:16887077-16887099 CAGAAGCAGCATAAGAAGTTGGG + Intergenic
1144880276 17:18427344-18427366 GAGGAGCTGCAGAACAAGGTAGG + Intergenic
1145006457 17:19341350-19341372 CAGGAGCAGCTGAGGGTGCTGGG + Intronic
1145151957 17:20517043-20517065 GAGGAGCTGCAGAACAAGGTAGG - Intergenic
1145212990 17:21028940-21028962 CAGGATCAGGAGCAGGAGGTGGG - Intronic
1146163327 17:30571314-30571336 GAGGAGCTGCAGAACAAGGTAGG - Intergenic
1146662417 17:34673641-34673663 AAAGAGCAGGAGAAGGAAGTAGG - Intergenic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147267587 17:39244268-39244290 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1147340425 17:39750456-39750478 CAGGTCCAGCAGACAGAGGTGGG + Intergenic
1147580300 17:41624073-41624095 GAGGAGCTGCAGAACAAGGTAGG - Exonic
1147584175 17:41643582-41643604 CAGGAGAAGCAGGTGGAGCTAGG + Intergenic
1147769376 17:42857027-42857049 CAGGAGGAGGAGGAGGAAGTAGG - Exonic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1148047678 17:44753937-44753959 GAAGAGCAGCAGAAGGAAGGAGG + Intergenic
1148070441 17:44905701-44905723 CAGCAGCAGCAGCAGGTGGCAGG + Intronic
1148087130 17:45001046-45001068 CAGGAGCAGCAAAGGGAGTGGGG + Intergenic
1148241997 17:46005729-46005751 CTGGAGCTGCGGAAGGAGGTGGG - Intronic
1148742697 17:49901882-49901904 CAGGAGGAGCAGACTGTGGTTGG - Intergenic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1148847718 17:50538950-50538972 CAGGAGCACGAGAAGGTAGTGGG + Exonic
1148888255 17:50789136-50789158 AAGGAGCAGTAGAGGGTGGTAGG + Intergenic
1149066423 17:52485921-52485943 CAGGAGGAGGAGGAGGAGATGGG - Intergenic
1149185746 17:53995406-53995428 CAAGAGGAGCCTAAGGAGGTGGG + Intergenic
1149430509 17:56593302-56593324 CAGGAGGAGGAGAAGGGGGGTGG + Intergenic
1150285157 17:63950116-63950138 CTGGCCCAGCAGGAGGAGGTGGG - Intronic
1150463864 17:65375272-65375294 CAGGTGCACCAGTAAGAGGTGGG + Intergenic
1150507542 17:65714990-65715012 CAGGTGGAGCAGAAGGAGCAAGG + Intronic
1150576339 17:66434025-66434047 CAGGAGCAGCAGAGCCAGGATGG + Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150923766 17:69511393-69511415 GAAGCGCAGCAGAAGGAGGCAGG - Intronic
1150964023 17:69947225-69947247 GAGGAGCAGGAGGAGGAGGAGGG - Intergenic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1151250680 17:72831978-72832000 GAAGAGGAGGAGAAGGAGGTTGG + Intronic
1151441467 17:74132078-74132100 GAGGAGCAGCAGAAGCGGGAAGG - Intergenic
1151509472 17:74549504-74549526 CAGGACCAGGAGCAGGACGTAGG + Intergenic
1151560330 17:74866392-74866414 CAGGGGCTGCAGAAGGAGGCCGG - Intronic
1151895128 17:76974941-76974963 CATGAACAGCAGCAGGAGGCAGG + Intergenic
1151960229 17:77401966-77401988 AAGGAGCAGCAGAGGAAGGCAGG - Intronic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1152437176 17:80283556-80283578 CAGCAGCAGCACACGGAGGTTGG - Intronic
1152630320 17:81408080-81408102 CAGGGGCAGCAGGAGGAAGGGGG - Intronic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1152734095 17:81988504-81988526 CAGGGACAGCAGGAGGTGGTGGG + Intronic
1153135673 18:1914691-1914713 CAGCAGCTGCACAAGGAGGTGGG + Intergenic
1153333770 18:3901082-3901104 AGGGAGCAGCAGAAGGGAGTAGG - Intronic
1153498938 18:5728826-5728848 CAGGAGGTACAGAAGGAGGTCGG - Intergenic
1153723520 18:7932138-7932160 AAAGAGCAGAAGACGGAGGTGGG + Intronic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155086887 18:22467603-22467625 CAGGAGCAGCAGGAGGGGGCTGG + Intergenic
1155185502 18:23383529-23383551 CAGGAGCAGCAGAAGGTGACAGG + Intronic
1155449819 18:25951827-25951849 AAGGAGTAGCAGAAGTGGGTAGG - Intergenic
1155688102 18:28580566-28580588 CAGGAGCAAGAGAGAGAGGTGGG + Intergenic
1155789958 18:29953087-29953109 AAGGAGCAGTTGAAGCAGGTGGG - Intergenic
1156035385 18:32760879-32760901 CAAGGGCATCAGAAGGAAGTGGG - Intronic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156196609 18:34781120-34781142 CAGGGGCAGGAGAAAGAGGCAGG + Intronic
1156486343 18:37468357-37468379 CTGGAGCTCCAGAAGAAGGTTGG + Intronic
1156812666 18:41271789-41271811 CAGAAGCAAGAGAGGGAGGTGGG - Intergenic
1157244426 18:46040894-46040916 CAGGAGAGGGAGAAGGAGCTGGG + Intronic
1157276069 18:46311896-46311918 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1157407902 18:47438816-47438838 CAGGAGCAGGAGAGTGAGGCAGG - Intergenic
1157476774 18:48028879-48028901 CAGCCACAGCAGGAGGAGGTAGG - Exonic
1158870257 18:61679920-61679942 TACGAGCAACAGAAGGAGGATGG - Intergenic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1159333383 18:67030844-67030866 CAGGAGCAACAGAAAGTGGGAGG - Intergenic
1159491502 18:69140749-69140771 CAAGAGAAGAAGAAGGGGGTGGG + Intergenic
1159706468 18:71695634-71695656 CAGGGGCATCTGAAGGATGTCGG - Intergenic
1160032804 18:75277708-75277730 CAGTAATGGCAGAAGGAGGTAGG - Intronic
1160187784 18:76688841-76688863 CAGGAGGAGCAGAAGCAGCCGGG + Intergenic
1160845623 19:1164806-1164828 GAGGAGGAGCAGGAGGAGGGAGG + Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161021057 19:2011747-2011769 GAGGAGCAGGAGCAGGAGGGTGG - Intronic
1161234317 19:3190357-3190379 CGGGTGCAGCACAAGGAGGTGGG - Intronic
1161390640 19:4018685-4018707 AAGGAGCAGCAGAGTGATGTAGG + Intronic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1161552754 19:4923267-4923289 CAGGAGGAGCAGACGGAGCCAGG - Intronic
1161557802 19:4954416-4954438 GAGGAGGAGCAGCAGGAGGGGGG + Exonic
1161610548 19:5240059-5240081 CAGGAGAAGCAGAAGGGGTGAGG + Intronic
1161769137 19:6222036-6222058 CTGGAACAGCGGAAGGAGGTGGG - Intronic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG + Exonic
1161981703 19:7633426-7633448 CAGGAGGAGAAGACGGAGGAAGG - Exonic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162289536 19:9768560-9768582 CCGGAGCAGCAGCGGGAGGCCGG + Exonic
1163054188 19:14706080-14706102 CAGGAGAGGCAGCTGGAGGTGGG - Intronic
1163159219 19:15454776-15454798 CAGGAGCCGCAGGAAGAGGGAGG + Exonic
1163510686 19:17733345-17733367 CAGGACCAGCGCAAGGAGGAAGG + Exonic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163612291 19:18307873-18307895 CTGGAGGAGGAGGAGGAGGTAGG + Intronic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164718701 19:30415250-30415272 CAGGAGGAGGAGAAGGGGGAGGG - Intronic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165230193 19:34381932-34381954 CAGGAGCTGCAGGAGGAGCTGGG + Intronic
1165236537 19:34426606-34426628 CAGGAGCAGAAGATGGGAGTGGG - Intergenic
1165331126 19:35141588-35141610 CAGGAGCGGGCGAAGGAGGGCGG - Intronic
1165377006 19:35449875-35449897 CAGCAGCAGCAGGAGGAGGTCGG - Exonic
1165741992 19:38210233-38210255 CGGGAGGAGGAGAAGGAGGACGG - Intergenic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166322701 19:42028483-42028505 CAGGAGGGGCAGAAGGTGGCTGG - Intronic
1166831826 19:45643823-45643845 CTGGACCTGCAGAGGGAGGTGGG + Intronic
1166853042 19:45769415-45769437 CAGGCGCAGTGGAAGGAGGATGG + Intergenic
1167077418 19:47257892-47257914 CAGGATGAGCACAGGGAGGTGGG + Intronic
1167360529 19:49028135-49028157 CAGGAGCCACAGCAGGAGGATGG - Intronic
1167363119 19:49040665-49040687 CAGGAGCCACAGCAGGAGGATGG + Intergenic
1167365448 19:49052921-49052943 CAGGAGCCACAGCAGGAGGATGG - Intergenic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167435362 19:49475692-49475714 CAGCAGCAGCAGGAGGAGATAGG - Exonic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167591536 19:50406911-50406933 GTGGAGCAGGAGAAGGAAGTGGG - Intronic
1167853570 19:52220263-52220285 CAGGAGCAGCAAGAGGAGATGGG + Intronic
1168147254 19:54426681-54426703 CAGGAGCAGCAGGAGGACGTAGG - Exonic
1168384888 19:55954891-55954913 CAAGAGCAGCAGAAGTTGGTCGG - Exonic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
1168695604 19:58402301-58402323 CAGAAGGAGCAGAGGGTGGTGGG + Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925188215 2:1864001-1864023 CAGGAGCATCACAAGGTGGCTGG + Intronic
925433102 2:3814138-3814160 CTGGAGTACCAAAAGGAGGTGGG - Intronic
925534336 2:4900501-4900523 CAGGGGCAGCAGAAGCTGGTGGG - Intergenic
925553684 2:5104990-5105012 CAGGAGCACCAGCTGGAGGGAGG + Intergenic
926166162 2:10523082-10523104 CAGGGGCAGCAGAGGGCAGTGGG + Intergenic
926231583 2:11008234-11008256 GAGCTGCAGCAGAAGGAGGAAGG - Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926861773 2:17317493-17317515 AAGGAGGAGGAGAAGGAAGTGGG + Intergenic
926951505 2:18248481-18248503 CAGGAGCAAGAGAAAGAGGAAGG + Intronic
927053695 2:19351808-19351830 CAGGGGCGGGAGGAGGAGGTGGG + Exonic
927139149 2:20118066-20118088 CAGGAGCAGCTGGAGGAGCAGGG + Intergenic
927217735 2:20677968-20677990 CAGCAGCAGCAGCAGCAGCTGGG + Intergenic
927339830 2:21970585-21970607 CAGAAGCAGCAGAAAAAGGATGG + Intergenic
927455207 2:23242859-23242881 CAGGAGCAGGAGAAGGTTGGGGG - Intergenic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
927853114 2:26512145-26512167 TTTGGGCAGCAGAAGGAGGTGGG + Intronic
927885012 2:26712977-26712999 GAGGAGCAGAAGATGGAGATGGG + Intronic
928060410 2:28107111-28107133 CAGGAGCAACAGTAGCAAGTTGG - Intronic
928067014 2:28175201-28175223 CAGTAGCAGCAGGTGCAGGTAGG - Intronic
928278819 2:29926072-29926094 CAGGAGCAGCAGCAGCAAGCAGG + Intergenic
928317021 2:30254626-30254648 CAGGCCCAGCAAAAGGAGGAGGG - Intronic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
928647542 2:33370480-33370502 CAGCAGCAGCAGCAGCAGCTTGG - Intronic
928703691 2:33925031-33925053 CAGGAGCAGGAAAAAGAAGTTGG + Intergenic
929095946 2:38263425-38263447 CAGAAGCAAGAGAAGGACGTGGG + Intergenic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
929604359 2:43225370-43225392 CAGCAGCAGCAGAAGGGGGGCGG - Exonic
929989945 2:46778438-46778460 GGGGGGCAGCAGAGGGAGGTGGG + Intergenic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931163888 2:59724493-59724515 CAGGAGAAGCAGAGGGAGTGAGG + Intergenic
931295805 2:60923984-60924006 CTGGAGCTGCATGAGGAGGTGGG - Exonic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
932402223 2:71488958-71488980 GAGGAGCAGCTGAAGGAGGAAGG - Intronic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
933196043 2:79391270-79391292 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
933309003 2:80637488-80637510 CAGGAGAGGAAGAAAGAGGTGGG + Intronic
933502874 2:83138874-83138896 AAGGAGCAGGAGAAGGAGAAGGG + Intergenic
934037450 2:88100022-88100044 TAGGAGAAGGAGCAGGAGGTGGG - Intronic
934473477 2:94576891-94576913 CAGGAGCATCAGAGAGAGGAGGG + Intergenic
934512486 2:94956967-94956989 CAGGGGGAGCAGAAGGAAATGGG - Intergenic
934778320 2:96952922-96952944 GAGAAGCAGAAGGAGGAGGTTGG - Intronic
934882553 2:97996144-97996166 CTGGCGCAGGAGAAGGAGGGAGG + Intergenic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
936598128 2:113868896-113868918 CAGCAGCAGCAGCAGAAGGAAGG + Intergenic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
936720998 2:115253156-115253178 CAGGAGCAGGAGAGGGAGTGGGG + Intronic
937369340 2:121286650-121286672 CAGGAACAGCAGAGTGAGGGAGG - Intergenic
937403430 2:121605843-121605865 CAGGTGTTGCAGAAGGATGTGGG - Exonic
937931664 2:127209890-127209912 CTGGAGCACCAGAAGGAGACGGG + Intronic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938208010 2:129440085-129440107 CAGGAGCGCCAGAAGGCGCTGGG - Intergenic
938257132 2:129868264-129868286 CAGGAGCAGCAGCAGGACAGAGG + Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938293820 2:130164331-130164353 CAGGGTCAGAAGCAGGAGGTGGG + Intronic
938462724 2:131508631-131508653 CAGGGTCAGAAGCAGGAGGTGGG - Intergenic
939023366 2:136984438-136984460 CAGGAGCAAGAGAAGGAGCAAGG - Intronic
939059335 2:137400849-137400871 CTGGAGCAGGGGAAGAAGGTAGG + Intronic
939101331 2:137897835-137897857 GAGAAGCAGCAGCTGGAGGTTGG - Intergenic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
939545566 2:143548217-143548239 CAGGGGCAAAAGAAGGAAGTGGG + Intronic
939809126 2:146809409-146809431 CTGGAGTACCAGAAGGAGATGGG + Intergenic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
940847038 2:158652721-158652743 CAGGAGCTGGGGCAGGAGGTGGG + Intronic
941063827 2:160878450-160878472 CAGGAGGGTCAGAAGGAGATGGG - Intergenic
941319633 2:164038985-164039007 CAGGAGCAAGAGAGGGAGGGTGG + Intergenic
941396478 2:164980275-164980297 GAGGAGAAGAAGGAGGAGGTGGG - Intergenic
941439409 2:165514700-165514722 AAGGAGCAGGAGGAGGAGTTGGG - Intronic
941684768 2:168437120-168437142 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
942898379 2:181085748-181085770 TAGGAGCAGCATAAGAAGGAAGG + Intergenic
942951728 2:181729196-181729218 CATGATCAGCCGGAGGAGGTAGG - Intergenic
942985413 2:182134781-182134803 GAGGAGCAGCAGGATGAGGGTGG + Intergenic
943238638 2:185356129-185356151 CAGGAGCAAGAGAGGGAGGCAGG - Intergenic
943810343 2:192179663-192179685 CAGGATCTGGAGATGGAGGTAGG - Exonic
945225771 2:207530139-207530161 GAGGAGCAGGAGGAGGAGGCAGG + Intronic
945517050 2:210775281-210775303 CAAGAGCAGCACTAGGAGGATGG - Intergenic
945521492 2:210833095-210833117 CAGTTGCAGCAGAAGCAGGTAGG + Intergenic
945555439 2:211269892-211269914 CAGGACCAGCAAACTGAGGTGGG - Intergenic
946061122 2:216942417-216942439 CAGGGGCAGCAGAAGGCCGGGGG - Intergenic
946372713 2:219290422-219290444 GAGGAGGCGCAGAAGCAGGTGGG + Intronic
946415527 2:219538098-219538120 CAGGAGCAGGAGAATGTGCTGGG - Exonic
946448173 2:219757562-219757584 CAGGAGTAGCAGAGGGCTGTGGG - Intergenic
947043354 2:225949462-225949484 CAGCAGCAGCAGCCGTAGGTTGG - Intergenic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948219058 2:236254980-236255002 CAGGAGCAGGAGAAAGAGTGGGG - Intronic
948251865 2:236535987-236536009 CTGGGCCAGCAGAGGGAGGTGGG + Intergenic
948302140 2:236915508-236915530 CAGGAAATTCAGAAGGAGGTTGG - Intergenic
948571162 2:238917952-238917974 CACGAGGAGCAGAAACAGGTGGG + Intergenic
948599160 2:239098386-239098408 CAGGAGCAGCAGCGAGAGGATGG - Intronic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
948992760 2:241563151-241563173 CGGGAGCAGCAGGAGCAGGGAGG - Intronic
1169208383 20:3752532-3752554 CAGGAGGAGCCGCAGGAGGAAGG + Exonic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1169498108 20:6133912-6133934 AGGGAGCACCTGAAGGAGGTGGG - Intergenic
1170532997 20:17313381-17313403 CAGGAGCAGCAGGAGTGGGAGGG - Intronic
1170841131 20:19925042-19925064 GAGGAGGAGCACAAAGAGGTGGG - Intronic
1170999111 20:21396194-21396216 CAGCAGCTGCAGCAGGAGGGCGG - Exonic
1171186136 20:23125688-23125710 CAGGAGCAAAAAAAGGAAGTCGG + Intergenic
1171370999 20:24661780-24661802 CAGGAGCGTCAGAAGGAAGCAGG + Intronic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1171543052 20:25979218-25979240 CAGGTGCACCAGAAGGTGGAGGG - Intergenic
1171941186 20:31331312-31331334 GAGGAGCAGGAGAAGGAGGAGGG + Intergenic
1172205425 20:33159863-33159885 CAGGAGCTGCAGGAGGTGGTGGG + Intergenic
1172856632 20:38009352-38009374 GAGGAGCAAGAGAAGGAGTTTGG - Intronic
1172877916 20:38177282-38177304 GAAGGGCAGCAGGAGGAGGTGGG + Intergenic
1173019394 20:39254411-39254433 CACGAGAAGAAGAAGGAGGGAGG - Intergenic
1173106974 20:40146100-40146122 CAGGAGGAGGAGGAGGAGGGAGG - Intergenic
1173235873 20:41244897-41244919 CAGGAAAAGCAAAAGGAGTTGGG + Intronic
1173443308 20:43096512-43096534 CAGGAGCCCCAGGAGGAGGAGGG - Intronic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173882292 20:46424640-46424662 CAGTAGCAGCAGAAGAACCTGGG + Intronic
1173997053 20:47346439-47346461 GGGGAGCAGCAGGAGGAGGCTGG - Intronic
1174671425 20:52311344-52311366 CAGGAGCAGGTTAAGGAAGTCGG + Intergenic
1174951367 20:55044819-55044841 CAGGAGCAAGAGAGCGAGGTGGG - Intergenic
1175073392 20:56353616-56353638 CAGGAGCAGCAGGAGGGGGTGGG - Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175269445 20:57723534-57723556 CAGGAGCTGCAGAGGCAGGTGGG + Intergenic
1175874596 20:62223404-62223426 CAGAGGCAGCAGCAGCAGGTGGG - Intergenic
1175902190 20:62364358-62364380 CACGAGCAGCAGAGGGAAGCTGG + Intronic
1175919671 20:62444791-62444813 CTGGGGCAGGAGAAGGAGGGTGG + Intergenic
1175997172 20:62817087-62817109 CAGGAGCAGGAGCAGGAGCGGGG - Exonic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1176709384 21:10136409-10136431 CAGGAGCTGCAAAAGGAGAGAGG - Intergenic
1176720448 21:10388294-10388316 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1176726802 21:10442657-10442679 CAGGAGCTGGAGTGGGAGGTAGG - Intergenic
1177152492 21:17468959-17468981 CAAAAGCAGCAGAAGTTGGTGGG + Intergenic
1177483767 21:21728409-21728431 GAGGAGCAACAGGAGGAAGTTGG - Intergenic
1177913828 21:27062944-27062966 CAGCTGCAGCATAAGCAGGTGGG - Intergenic
1178285490 21:31322269-31322291 CAGGAGGAGAAGAAGGAGCAAGG - Intronic
1178691511 21:34754124-34754146 TGGGGGCAGCAGTAGGAGGTGGG - Intergenic
1178748297 21:35274969-35274991 GAGGGAGAGCAGAAGGAGGTGGG - Intronic
1178943309 21:36925566-36925588 CAGAGGAAGCAGAAGAAGGTGGG - Intronic
1179046631 21:37850556-37850578 CAGGGGCAGGAGGAGGGGGTGGG - Intronic
1179150651 21:38805879-38805901 CAGGAGCGGGAGGAGGAGGGAGG - Intronic
1179926319 21:44536217-44536239 CAGGAGCAGCAGCCTGAGGATGG - Intronic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180301652 22:11041143-11041165 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1180433694 22:15279780-15279802 CATGAGCAGGAGAAGGATCTGGG - Intergenic
1180743132 22:18067593-18067615 CAAGGGCAGGAGCAGGAGGTGGG - Intergenic
1180744539 22:18078501-18078523 CAGGTGCACCACCAGGAGGTCGG - Exonic
1180784114 22:18537359-18537381 CAGGAACAGCAGGAGGCTGTAGG + Intergenic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1180885553 22:19240873-19240895 GGGCAGCAGCAGGAGGAGGTTGG + Intronic
1181127681 22:20711408-20711430 CAGGAACAGCAGGAGGCTGTAGG + Exonic
1181241015 22:21476711-21476733 CAGGAACAGCAGGAGGCTGTAGG + Intergenic
1181493942 22:23277504-23277526 CAGCAGCAGCAGCAGGGGATGGG - Intronic
1181500669 22:23313951-23313973 AAAGAGCTGCAGAAGGCGGTGGG - Exonic
1181541568 22:23575789-23575811 CAGGTACAGCAGAAGGACCTTGG - Intronic
1181551443 22:23641126-23641148 CAGGTACAGCAGAAGGACCTTGG - Intergenic
1181755069 22:25018016-25018038 GAGGAGGAGGAGGAGGAGGTTGG - Intronic
1181796817 22:25317516-25317538 CAGGTACAGCAGAAGGACCTTGG + Intergenic
1181828477 22:25539349-25539371 CTGGAACAGAAGAAGGAGATTGG - Intergenic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1181941841 22:26483807-26483829 CAGGAGCTGGAGGGGGAGGTAGG - Exonic
1182428689 22:30288109-30288131 CAGCAGCAGGAGGAGGAGCTAGG + Intronic
1182460747 22:30481882-30481904 CAGCAGCAGCAGGAGCAGGAGGG + Intergenic
1182460748 22:30481885-30481907 CAGCAGCAGGAGCAGGAGGGCGG + Intergenic
1182744266 22:32593605-32593627 GAGGAGGAGGAGAAGGAGGGAGG + Intronic
1182796671 22:32995992-32996014 CAGCTGCACCAGAAGGAGGAGGG + Intronic
1182806159 22:33072282-33072304 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
1182887328 22:33786523-33786545 GAGGTGCCTCAGAAGGAGGTTGG + Intronic
1183093357 22:35538587-35538609 CAGGAGCAGAAGACAGAGGCTGG + Intergenic
1183161248 22:36114788-36114810 CAGGTGCAGCAGAAGGGAGACGG - Intergenic
1183338053 22:37262215-37262237 CAGCAGCAGCAGATGGTGGTGGG + Intergenic
1183381578 22:37492898-37492920 GAGGAGCAGCAGCAGGACTTAGG - Intronic
1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG + Intergenic
1183521503 22:38298441-38298463 CAGGAGCAGCAGGACGGTGTAGG + Intronic
1183572181 22:38661884-38661906 CAGGAGGAGCAGTGAGAGGTCGG + Intronic
1183585852 22:38752550-38752572 CAGCAGCAGCGGAGGGAGCTCGG - Exonic
1184160356 22:42693916-42693938 GAGCAGCCGCAGCAGGAGGTCGG + Exonic
1184406705 22:44304628-44304650 CAGGAGGGCCAGAAGGAGGCTGG - Intronic
1184821064 22:46909636-46909658 CAGCAGCAACAGAAGGAAGAAGG - Intronic
1184859172 22:47163459-47163481 CAGGTGCATCTGAAGGTGGTAGG + Intronic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
1184921800 22:47610443-47610465 CAGGAGCAGCTGAGGAAGGCAGG - Intergenic
949479356 3:4478700-4478722 CAGCAGCAGCAGAACAGGGTAGG + Intergenic
949962076 3:9320486-9320508 CAGGAGCAAGAGAGAGAGGTGGG - Intronic
949980265 3:9498421-9498443 CAGCAGCAGCAGAAGGGGTCAGG + Exonic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
952476685 3:33717947-33717969 CAGGTGCAGCAGAAGGACGTCGG - Intronic
953543353 3:43841896-43841918 CAGGAGGAGCAGAGGGAGTGGGG + Intergenic
953563449 3:44012390-44012412 GAGGAGCAGCAGCAGTAGGCTGG - Intergenic
953965304 3:47300182-47300204 AAGGAGGAAAAGAAGGAGGTGGG - Intronic
954264492 3:49461850-49461872 GAGGAGGAGGAGAAGGAGGGTGG - Intergenic
954808969 3:53236299-53236321 CAGGGGCAGCAGGAAGAGGCTGG + Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
956238668 3:67104657-67104679 CAGGAGCAGGATAATGAGTTTGG + Intergenic
956785783 3:72641122-72641144 CGGGAGCAGTAGATGGAAGTAGG + Intergenic
958154597 3:89740355-89740377 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
960166573 3:114409493-114409515 CAGAAGCAGCTGAAGGAAGGGGG + Intronic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
960190401 3:114697734-114697756 AAGGAGCAGGAGAGGGAGGGAGG + Intronic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960574793 3:119218875-119218897 CAGGAGAAGCAGGAGTGGGTGGG - Intronic
960760163 3:121064267-121064289 GAGGAGGAGCAGAAGCAGGGTGG - Intronic
960764932 3:121115822-121115844 CAGGAGCAAGAGGAGGAGTTAGG + Intronic
960854880 3:122092659-122092681 AAGGAGCAGCAGGAAGGGGTGGG - Intronic
960907960 3:122620668-122620690 CAGGAGCAGAGGATGAAGGTGGG + Intronic
961101450 3:124202598-124202620 CAGGAGGAGGAGGAGGAGGGAGG - Intronic
961508015 3:127384223-127384245 CTGGAGCAGGAGGAGGAGGTGGG + Intergenic
961568639 3:127782715-127782737 CAGCAGCAGTAGAAGTTGGTGGG - Intronic
961612502 3:128152457-128152479 AAGGAGCAGGAGAGGGAGGATGG - Intronic
961990073 3:131180105-131180127 CACAAGCAGCAGAAGTAGATTGG + Intronic
962186974 3:133270538-133270560 CAAAAGCAGCAGCAGGTGGTAGG - Intronic
962324532 3:134422462-134422484 CAGGAGCAAGAGAAGGAGAGGGG - Intergenic
962352366 3:134665265-134665287 CAGGGGCAGCACCAGGAGGTAGG - Intronic
962379496 3:134886136-134886158 CAGCAGAAGCAGGAGGATGTGGG + Intronic
962391277 3:134974876-134974898 CAGGAGCAGCTCAAGCAGGAAGG - Intronic
962498405 3:135965681-135965703 GAGGAGGAGGAGAAGGAGGTAGG + Exonic
962621665 3:137186310-137186332 AAGGAGAAGGAGAGGGAGGTAGG + Intergenic
963117020 3:141738672-141738694 CAGGAGCCGCAGCAGGAGCGTGG - Intronic
964314783 3:155432123-155432145 CAGGAGCAGCAGGATGTGTTGGG - Intronic
965143138 3:164864832-164864854 CAGGGCCAGCTGAATGAGGTGGG - Intergenic
965587013 3:170327703-170327725 CAGGAGCAGGAGCGGGAGGTGGG - Intergenic
966521915 3:180882423-180882445 GAGGAGGAGGAGAAGGAGGAAGG - Intronic
967131930 3:186478541-186478563 CAGGGGTTTCAGAAGGAGGTTGG - Intergenic
967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG + Intronic
967524648 3:190476946-190476968 CAAGAGCAGAAGAAGAAGATGGG - Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968262120 3:197333974-197333996 CAGCAGCAGCAGCAGGAGCTAGG + Intergenic
968331008 3:197870173-197870195 TAGGTGCAGCAGATGGAGGAAGG - Exonic
968921375 4:3523904-3523926 CAGGAGGAGGAAACGGAGGTGGG + Intronic
969134562 4:5019743-5019765 CAGGAACAGCAGATGGAGAGGGG + Intergenic
969271819 4:6108226-6108248 CAGAAGCAGCAGAGTGAGGCTGG + Intronic
969277780 4:6148622-6148644 CAGGAGCAGAGGAAGAAGGGAGG + Intronic
969457458 4:7308299-7308321 CTGGAGCAGCAGAAGGGGCAGGG - Intronic
969608205 4:8212678-8212700 CTGGAGGGGCAGACGGAGGTTGG - Intronic
969616438 4:8255618-8255640 CAAGTGCACCAGAAGCAGGTGGG + Intergenic
969689714 4:8697855-8697877 CAGGAGCAGGAGAAGCAGGAAGG - Intergenic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
969979534 4:11140494-11140516 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970350998 4:15201708-15201730 CAGGAGCAAGAGAAGAAGGGAGG - Intergenic
970418671 4:15884027-15884049 GAGGAGTAGCAGCAGGCGGTTGG + Intergenic
970920221 4:21385302-21385324 CAGAACCACCAGCAGGAGGTGGG + Intronic
973728741 4:53802858-53802880 CAGGGGCAGCATATGGTGGTTGG + Intronic
973830284 4:54752502-54752524 CAGCAGCAGCTGAAGCAGGAGGG + Intergenic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
974251862 4:59394798-59394820 GAGGGCCAGCAGAAGCAGGTTGG - Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
974517270 4:62934105-62934127 CTGGAGCTGGAGAAGTAGGTAGG - Intergenic
975096473 4:70462859-70462881 CAGGAACTGCAGCAGGAGGATGG + Intronic
975491884 4:74998196-74998218 CAGTTGCAGCAGTTGGAGGTTGG + Intronic
975884723 4:78951397-78951419 GAGGAGCTGAAAAAGGAGGTGGG + Intergenic
976974944 4:91154484-91154506 CAGGAGCAGGAGCAGGAGCAGGG - Intronic
977522354 4:98100970-98100992 TAAGAGCAGCTGAAGGAGGCGGG - Intronic
977701477 4:100027931-100027953 AATGAGTAGCAGAAGAAGGTAGG - Intergenic
977934399 4:102784780-102784802 GAGGAGGAGGAGGAGGAGGTTGG - Intergenic
978136406 4:105266785-105266807 TTGGAGTACCAGAAGGAGGTGGG + Intronic
978237933 4:106482604-106482626 GAGGAGCGGGAGAAGGAGGTGGG - Intergenic
978400725 4:108327707-108327729 AAGGAGAAGAAGAAGGAAGTAGG - Intergenic
979345674 4:119584135-119584157 CTGGAGCAGGAGAAAGAAGTAGG + Intronic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981076225 4:140595175-140595197 CAGCTGCAGCACAAGCAGGTAGG + Intergenic
981221119 4:142236291-142236313 CAGTAGAAGCATAAGGAGTTTGG - Intronic
981398328 4:144281057-144281079 AAGGAACAGTGGAAGGAGGTTGG + Intergenic
981735206 4:147942581-147942603 AAGGGGCAGGAGAAGGAGGACGG - Intronic
981780219 4:148420822-148420844 CAGGAGCAAGAGAAGGAGTGGGG - Intronic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983363096 4:166752121-166752143 CTGAGGCAGGAGAAGGAGGTTGG - Intronic
983926849 4:173412015-173412037 CAGGAGTAGCAGAACAAGCTGGG - Intergenic
983946311 4:173589752-173589774 AAGGAGCAGAGGAAGGGGGTGGG + Intergenic
985285521 4:188332947-188332969 CTGGAACAGGAGAAGGAGCTTGG + Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985515726 5:343751-343773 CACGAGGAGGAGCAGGAGGTGGG + Intronic
986279239 5:6309969-6309991 AATGAACAGGAGAAGGAGGTGGG - Intergenic
986552900 5:8978627-8978649 CTGGAGGAGGAGAAAGAGGTGGG - Intergenic
986759926 5:10870542-10870564 GAGGAGGAGAAGGAGGAGGTGGG - Intergenic
986784909 5:11105247-11105269 CAGGATTATCTGAAGGAGGTTGG - Intronic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
987081206 5:14427190-14427212 GAGGAGCTGCAGAAAGGGGTGGG - Intronic
987901248 5:24014648-24014670 CAGGAAAAGCAGAAGCAGTTCGG - Intronic
988211990 5:28215862-28215884 AAGGAGGAGAAGAAGGAGGTGGG - Intergenic
988494375 5:31732498-31732520 AAGGCTGAGCAGAAGGAGGTGGG + Intronic
988565947 5:32320249-32320271 CATGAACAGCAGCAGGAGGCAGG - Intergenic
988833144 5:35006494-35006516 CAGGAGCAAGAGAGGGAGTTAGG + Intronic
988908265 5:35812130-35812152 CAGCAGTAGTAGAAGTAGGTTGG - Intronic
988961835 5:36378601-36378623 CAGGAGCAGGAGAGGGACTTTGG - Intergenic
989139613 5:38189788-38189810 CGGGTGCAGCAGAAGGACCTGGG - Intergenic
990037927 5:51345484-51345506 CAGGAGCATAAGGAGGAGGGAGG + Intergenic
990358131 5:54990544-54990566 CAGGACCAGAAGACGTAGGTTGG + Intronic
990526483 5:56633170-56633192 AAGGAGGAGCAGGAGGAGGGAGG + Intergenic
991435958 5:66597001-66597023 GAGGAGCAGGACGAGGAGGTGGG + Exonic
991562656 5:67970953-67970975 AAGGAGGAGGAGAAAGAGGTAGG + Intergenic
991656076 5:68904982-68905004 CAGGAACAGCACATGGATGTGGG + Intergenic
991860883 5:71011996-71012018 TAAGAGCAGTAGAAGGAGGGTGG + Intronic
992004125 5:72461146-72461168 CGGGAACAGCAAAGGGAGGTTGG + Exonic
992228376 5:74640584-74640606 CAGGCGCCGCGGAAGGAGGCGGG + Exonic
992769716 5:80035557-80035579 CAGGTGCAGCAGGAGGACGGCGG - Exonic
992816335 5:80443547-80443569 CAGGAGCACCAGGAGGTGCTTGG + Intronic
992912335 5:81408164-81408186 GAGGAGGAGGAGGAGGAGGTGGG + Intergenic
993021136 5:82592477-82592499 GAGGAGGAGGAGAAGGAGGAAGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994497794 5:100535577-100535599 CAGCAACAGCAGGAGGAGGACGG - Exonic
994569989 5:101503857-101503879 CAGGAGCAAGAGAAAGAGGAAGG - Intergenic
994662212 5:102667618-102667640 CAGTAGCAGCAAAATGAGATTGG + Intergenic
995052747 5:107724809-107724831 CAGCAGCAGCAGCAGAAAGTGGG + Intergenic
995614827 5:113950194-113950216 TGGGAGCAGCAGAATGAGGGAGG - Intergenic
995831649 5:116361407-116361429 CAGGGGCAACCCAAGGAGGTGGG + Intronic
996165745 5:120220734-120220756 GAGGAGGAGGAAAAGGAGGTGGG - Intergenic
996441139 5:123492069-123492091 TCAGAGCAGCAGATGGAGGTGGG + Intergenic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
998799638 5:145856365-145856387 CAGGAGCAGCAGCAGCAGCTAGG - Intergenic
998957607 5:147453618-147453640 CCGGAGCAGAAGAAGGAGGGAGG - Intronic
999137219 5:149329952-149329974 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
999232186 5:150068239-150068261 CAGGAGCAGCAGCAGCAGCAAGG + Exonic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999827251 5:155285559-155285581 GGGGTGCAGCAGAAGGTGGTGGG + Intergenic
1000046210 5:157523986-157524008 CAGGAACAGCAGTTGGAGGAAGG - Intronic
1000747655 5:165055053-165055075 GAGGAGGAGTAGAAGGAGGAAGG - Intergenic
1001549042 5:172588661-172588683 CAGGAGCACCAGCTGGAGGTGGG + Intergenic
1001769511 5:174282611-174282633 CAGGAGCAGCTAATGGGGGTCGG - Intergenic
1002076690 5:176712639-176712661 CTGGGGCAGGAGAGGGAGGTGGG + Intergenic
1002193455 5:177490443-177490465 CAGGAGGAACAGAAAGAGGGAGG + Intronic
1002560253 5:180076845-180076867 AAGGGGCAGGAGCAGGAGGTGGG - Intergenic
1002787490 6:414666-414688 CAGGAGCAGAAGGAGGAAGTGGG - Intergenic
1003127347 6:3365823-3365845 CAGCAGCAGCAGAAGGAAAAAGG + Intronic
1003402685 6:5803949-5803971 CAGGAACAGTAGAAGTAGGAAGG + Intergenic
1003529272 6:6924598-6924620 CAGGAGCAGGAGAGAGAGGAGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1003856940 6:10286045-10286067 GAGGAGGAGGAGAAGGAGGGAGG + Intergenic
1003924095 6:10860667-10860689 CAGGAGCAAGAGAGGGAGTTGGG + Intronic
1004161834 6:13221164-13221186 CAGGAGCAGAGGGAGGAGGCAGG + Intronic
1004421259 6:15472205-15472227 CAGAAACAGCAGTAGGAGGTGGG - Intronic
1004698564 6:18057248-18057270 CAGGAACAGCAGGAGGGGGATGG - Intergenic
1004973418 6:20937191-20937213 CAGGAGCTGAAGTAGGAGGATGG - Intronic
1005081954 6:21965396-21965418 GAGGAGGAGAAGAAGGAGGAGGG - Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005455688 6:26017687-26017709 CAGGAGCAGCAGAAGCGGCGGGG + Exonic
1005495450 6:26383862-26383884 GAGGAGCAGGAGGAGGAGGAGGG - Exonic
1005497818 6:26404118-26404140 CAAGATCTGCAGAGGGAGGTGGG - Intronic
1005835004 6:29702335-29702357 CAGGAGCAGCAGCAGGAACAAGG + Intergenic
1005948313 6:30611664-30611686 GAGCAGCAGCAGAAGCAGGGAGG + Intronic
1005987371 6:30883533-30883555 GAGGAGCAGGAGAAGGATGGAGG - Intronic
1005990413 6:30898644-30898666 GAGGAGCAGAAGGAAGAGGTGGG + Intronic
1006243041 6:32703482-32703504 CAGGAAGAGAAGACGGAGGTTGG - Intergenic
1006311891 6:33266915-33266937 CAGGAGTAGCAACAGCAGGTGGG - Intronic
1006324460 6:33342940-33342962 CAAGTGCAGCAGATGTAGGTTGG - Intergenic
1006429692 6:33988146-33988168 CAGGACCAGGAGAAGGAGCTTGG - Intergenic
1006881096 6:37340868-37340890 CAGCAGCAGCAGAAGGCAGTGGG - Intergenic
1007335820 6:41154256-41154278 CAGGAGCAGCAGCAAGAGCAGGG + Exonic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007397641 6:41586713-41586735 CTGAAGCAGCGGAAGGAGGGAGG + Intronic
1007827105 6:44608762-44608784 GAGGAGGAGGAGAAGGAGGATGG - Intergenic
1008054821 6:46935684-46935706 CAGGAGCAGGAGAGGGACTTGGG - Intronic
1010737123 6:79455476-79455498 CAGGTGCAGGAGAAGGAAGAGGG + Intergenic
1011016593 6:82763228-82763250 CAGGAGCAGTAGGTGGAGGAAGG + Intergenic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1012624968 6:101393766-101393788 GAGGAGCAGCCGGAGGAGGTCGG - Intergenic
1013033821 6:106361109-106361131 AAGGAGGAGGAGGAGGAGGTGGG - Intergenic
1013492359 6:110660742-110660764 GAGGAGAAGCAGCTGGAGGTTGG - Intronic
1013993194 6:116278460-116278482 CAGGTCCAGCAGAAGGTGGTAGG + Exonic
1014280674 6:119440198-119440220 GAAGTGCAGCTGAAGGAGGTGGG - Intergenic
1014707317 6:124763435-124763457 CAGGAGCAAGAGATGGAGGGAGG + Intronic
1014994525 6:128125373-128125395 CAGGAGCAGGAGCAGGATGGGGG - Intronic
1015018392 6:128442288-128442310 AGGGAGCTGCAAAAGGAGGTAGG - Intronic
1015452642 6:133388929-133388951 GAGCAGAAGCAGAAGGACGTGGG - Intronic
1015961845 6:138658352-138658374 CAGGAGCTGGAGTGGGAGGTAGG - Intronic
1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG + Intergenic
1016560667 6:145392419-145392441 AAGGAGCAGTAGAAGGAGAATGG - Intergenic
1017712197 6:157180938-157180960 CAGAAGCAGCATGTGGAGGTGGG - Intronic
1017987916 6:159460668-159460690 CTGGAGCTGCAGGAGCAGGTAGG - Intergenic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018440970 6:163813061-163813083 CAGGAGTAGGAGAAAGAGTTGGG - Intergenic
1018946717 6:168352400-168352422 CTGGAGCAGGAGAAAGAGGTGGG + Intergenic
1019113373 6:169736930-169736952 TTGGAGTAGCAGAAGGAGATGGG - Intergenic
1019178638 6:170174164-170174186 CAGAAGCAGCAGAAGCAGCTAGG - Intergenic
1019293057 7:259745-259767 CAGGAGCTGCAGACGCAGGTAGG - Exonic
1019660186 7:2219775-2219797 CTGGAGCACCAGGAGGAGGGTGG - Intronic
1019729545 7:2622670-2622692 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1019729556 7:2622695-2622717 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1020555913 7:9670157-9670179 GAGGAGGAGGAGGAGGAGGTTGG + Intergenic
1020577336 7:9949778-9949800 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1020685499 7:11288854-11288876 CAGCAGCAGTAGATGGTGGTGGG - Intergenic
1020747442 7:12094863-12094885 CAGGAGCAGAGGAGGGAGATAGG + Intergenic
1021117040 7:16755242-16755264 CACCAACAGGAGAAGGAGGTTGG + Intronic
1021411061 7:20330682-20330704 CAGGAGCAGCAGTAACAGCTCGG - Intronic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1021879085 7:25076523-25076545 CAGGAGCAGCTCCAGGAAGTTGG + Intergenic
1022171705 7:27837792-27837814 CAGCAGCAGCAGATGCAGGAAGG + Intronic
1022419840 7:30210103-30210125 CAGGAGCTGCCGGAGGAGGCCGG + Intergenic
1022591798 7:31670866-31670888 GAGGAGAAGCAGCTGGAGGTCGG + Intergenic
1022662376 7:32379066-32379088 CTGGAGCAGGAGAGGTAGGTAGG - Intergenic
1022712437 7:32864526-32864548 CAGGAGCAAGAGAGAGAGGTGGG + Intergenic
1022753022 7:33252109-33252131 CAGGAGCAAGAGAGGGAGGGGGG + Intronic
1022910562 7:34896478-34896500 CAGGAGCAAGAGAGAGAGGTGGG - Intergenic
1023045174 7:36204423-36204445 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1023450758 7:40282537-40282559 CAGATGCAGAAGAATGAGGTTGG + Intronic
1023710977 7:42992279-42992301 CAGGAGTAGCAGAAGGGGACAGG - Intergenic
1023843041 7:44107408-44107430 CAGGAGTTCCAGAAGCAGGTGGG - Intronic
1023990489 7:45125616-45125638 CAGGAGCGGCTGCAGGAGCTGGG + Intergenic
1024147602 7:46533215-46533237 CAGGGCCAGCAGACTGAGGTGGG + Intergenic
1024698641 7:51883403-51883425 CAGGAGCAGGGGTAGGAGGCAGG - Intergenic
1024895042 7:54249213-54249235 CAGGAGCAAGAGAACGAGGCGGG + Intergenic
1026294172 7:69036604-69036626 CAGGAGGAGGAGAAGCAGGTTGG + Intergenic
1026294248 7:69037448-69037470 CAGGAGGAGGAAAAGCAGGTTGG - Intergenic
1026487613 7:70834990-70835012 CAGGAGCAGGAGAGTGAGGGGGG + Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1027859832 7:83563489-83563511 CAGCAGCAGCAGCAGCAGCTAGG + Intronic
1028888132 7:95957441-95957463 CAGCAGCAGGAGGAGGAGGAGGG - Intronic
1029103373 7:98153051-98153073 CAGGAGAGGCAGGAGGAAGTCGG + Intronic
1029110943 7:98212769-98212791 CAGCAGCAGCAGCAGGTGGCTGG + Exonic
1029152133 7:98488207-98488229 CAGGAGCAGCAGCAGAACCTGGG + Intergenic
1029160045 7:98545023-98545045 AATGATCAGCAGTAGGAGGTGGG + Intergenic
1029524551 7:101087077-101087099 GAGGAGGAGGAGAAGGAGGAGGG + Exonic
1029923596 7:104292402-104292424 CAGGAGCAGGAGAATAAGGAGGG - Intergenic
1030058909 7:105607544-105607566 CAGTAGCAGCATCAGGAGCTAGG + Exonic
1030257456 7:107526871-107526893 CAGGACTAGCAGAAGCGGGTAGG + Intronic
1030917275 7:115330954-115330976 CAGGAGCAAGAGAAAGAGGTGGG + Intergenic
1030919031 7:115356861-115356883 CAGGAGAAGCAGAAGCAAGTTGG + Intergenic
1031874486 7:127122972-127122994 CAGGAACAGGAGAAGAAGATGGG + Intronic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1032553170 7:132804893-132804915 CGGGAGCAGCAGTGGGAGGAGGG + Intronic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033332524 7:140428334-140428356 GAGGAGCAGCAGAATGCGGCTGG - Intergenic
1033582702 7:142751619-142751641 CATGGGCAGCAGAGGGATGTGGG - Intronic
1034166415 7:149028370-149028392 CAAGAGCAGCAGGAGCAGGAAGG + Exonic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034603311 7:152285297-152285319 CAGGAGCTGGAGTGGGAGGTAGG + Intronic
1034875638 7:154722615-154722637 CAGGGGCGGCAGCAGGAGGCAGG + Intronic
1035057537 7:156046097-156046119 CAGGAGCAGGAGCAGGAGAGAGG + Intergenic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1036470483 8:9048441-9048463 CCAGAGCTGCAGAAGGAGTTTGG - Intronic
1036597495 8:10227156-10227178 GAGGAGCAGATGAAGGAGCTTGG + Intronic
1037143057 8:15540507-15540529 CAGCAGCAGCAGGAGAAGGAAGG - Exonic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1037921599 8:22810204-22810226 CAGCAGCAGCGGAAGGAAGTAGG - Intronic
1038885619 8:31659533-31659555 CAGGAGCAACAGATTGGGGTAGG + Intronic
1039293688 8:36126559-36126581 TTGGAGTACCAGAAGGAGGTGGG - Intergenic
1039309337 8:36298563-36298585 CAGGAGCAGGAGAGCAAGGTGGG + Intergenic
1039887750 8:41664878-41664900 CAGGAGCTGGACAAGGAGCTGGG - Intronic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1040487637 8:47888930-47888952 CAGGAGCAGCTGCAGGAGCACGG + Intronic
1041326167 8:56667661-56667683 CAGGAGTAGCAGCTGGAGCTGGG - Intergenic
1041682070 8:60604136-60604158 CAGGAGAAAGAGAAAGAGGTGGG - Intronic
1041802193 8:61812444-61812466 CAGCAGCATCAGAAAGAGGGTGG - Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042312075 8:67388795-67388817 CAGGAGCAGGAGGAGGAGGGAGG - Intergenic
1042444024 8:68862548-68862570 CGGCAGCAGCAGCAGCAGGTGGG - Intergenic
1042940166 8:74099386-74099408 GAGGGGCAGCATAAGGTGGTTGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043464088 8:80487419-80487441 CTGCAGCAGCAGCAGGCGGTCGG + Exonic
1043586833 8:81779629-81779651 GAGGAGGAGCAGATGTAGGTGGG + Intergenic
1044743523 8:95351123-95351145 CATGGGCAGCATAAGGAGATTGG + Intergenic
1044916037 8:97113311-97113333 CAGCAGCAGGAGAAGGGTGTGGG + Intronic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1045894035 8:107192774-107192796 CAGGGGCAGCAAGATGAGGTAGG + Intergenic
1046053716 8:109054831-109054853 AAGGAGCAGGAGGAGGAGGAAGG - Intergenic
1046103668 8:109643208-109643230 CAGGACCAGCATAGGGAAGTAGG - Intronic
1046783970 8:118245941-118245963 GAGAAGCAGCTGCAGGAGGTAGG + Intronic
1047309044 8:123676828-123676850 CCTGTGCAGCAGAAGGAAGTGGG + Intergenic
1048276118 8:133067299-133067321 AAGGAGAAGCAGATGGGGGTGGG - Intronic
1048392097 8:133976796-133976818 CAGGAGCAGGAGAGAGAGATGGG - Intergenic
1048413414 8:134199461-134199483 GAGGAGCCCCAGAAGGAGATGGG + Intergenic
1049255182 8:141609980-141610002 CAGGAGCAGAGGGAGGAGGCGGG - Intergenic
1049291715 8:141806839-141806861 CAGGAGCAGGGAAACGAGGTGGG + Intergenic
1049558182 8:143294084-143294106 GAGGGGCAGCAGGAGGAGGGGGG - Intronic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1050937827 9:11421176-11421198 CACTAGCAAGAGAAGGAGGTAGG + Intergenic
1051266699 9:15316166-15316188 CAGCAGCAGCAGCAGCAAGTGGG - Intergenic
1051606612 9:18923300-18923322 CTGGAGCAGAGGATGGAGGTGGG + Intergenic
1052204050 9:25816605-25816627 CAGGAGCATGAGAAGCAGATTGG - Intergenic
1052323911 9:27196726-27196748 CAGGAGCAGAAGAGTGAGGGGGG + Intronic
1052540453 9:29804801-29804823 GAGGAGAAGCAGATGGATGTGGG - Intergenic
1052709966 9:32042154-32042176 GAGGAGCAGCAGCTGGAGGATGG - Intergenic
1052830618 9:33212258-33212280 AGGGAGCAGCAGAAGAAGGGAGG + Intergenic
1052964505 9:34329580-34329602 CACCCGAAGCAGAAGGAGGTAGG - Exonic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053055572 9:34991458-34991480 CAGGGACACCAAAAGGAGGTGGG + Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053469374 9:38335262-38335284 TAGGGGCAGAAGAAGGAGCTGGG + Intergenic
1053477152 9:38390824-38390846 GAGGAGCAGCTGAAGGAACTGGG - Intergenic
1053577086 9:39364094-39364116 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1053730914 9:41056107-41056129 CTGGAACAGAAGAAGGAGGGCGG - Intergenic
1053841592 9:42192019-42192041 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1053873045 9:42513776-42513798 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1053899707 9:42782144-42782166 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1054098657 9:60922784-60922806 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1054120057 9:61198413-61198435 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1054261938 9:62875449-62875471 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1054269285 9:62952976-62952998 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1054587699 9:66984149-66984171 CAGGATCAGCAGGAGGAGCTGGG - Intergenic
1054697599 9:68375983-68376005 CTGGAACAGAAGAAGGAGGGCGG + Intronic
1054991475 9:71331964-71331986 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1055379034 9:75685980-75686002 GAGGAGGAGGAGAAGGAGTTGGG + Intergenic
1056456533 9:86766163-86766185 CAGCAGCAGCTGCAGGAGGAGGG + Intergenic
1056666746 9:88587476-88587498 AAGGAGCAGCAGAGGAAGGGTGG + Intergenic
1056766201 9:89446216-89446238 CAGAGGCAGCAGAGGGAGATCGG - Intronic
1056948997 9:91026887-91026909 GAGGAGCCAAAGAAGGAGGTGGG - Intergenic
1057147511 9:92768212-92768234 CAGGAGAAGCAGCTGGATGTCGG - Intergenic
1057353800 9:94319629-94319651 CAGGAGCTGGAGCAGGAGGAAGG - Exonic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1057653951 9:96937963-96937985 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058374463 9:104306439-104306461 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1058567718 9:106304337-106304359 CAGATGCAGCATAAGGAGGAAGG + Intergenic
1058593636 9:106591570-106591592 GGGGAGGAGCAGCAGGAGGTGGG + Intergenic
1058636577 9:107044041-107044063 CGGGAGCAGCAGATGGAGCCGGG + Intergenic
1059508551 9:114822371-114822393 AAAGAGTAGCATAAGGAGGTGGG + Intergenic
1059529701 9:115024327-115024349 CAGAAGCAGCATAATGTGGTGGG + Intronic
1060225178 9:121786100-121786122 CAGGTGCAGCTGAAGGGGCTTGG - Intergenic
1060403823 9:123363035-123363057 CAGTAGCAGCGGAAGCCGGTGGG - Exonic
1060406805 9:123376899-123376921 CAGGAGGAGGAGGAGGAGGCAGG - Exonic
1060521490 9:124296552-124296574 CAGGAGCAGAAGAGGCAGGCAGG + Intronic
1060531585 9:124350099-124350121 CAGCAGCAGCAGCAGGAAGCTGG - Intronic
1060549052 9:124476625-124476647 AAGGGGCAGCAGAAGGAGTGGGG + Intronic
1060989402 9:127839457-127839479 AAGAAGCAGCAGGAGGAGGAAGG + Intronic
1061309122 9:129750928-129750950 CAGGAGCAGCCCAAGGAGTGGGG + Intronic
1061396379 9:130346079-130346101 CGGTAGCAGCAGAAGGCGGGTGG + Intronic
1061444603 9:130630863-130630885 CACAAGCAGCACAAGGTGGTGGG - Intronic
1061481765 9:130900911-130900933 TAGGGGCACCAGAAGGAGGTAGG + Intergenic
1061668800 9:132176346-132176368 CAGGGGCAGGGGAAGGAGATGGG - Intronic
1061717750 9:132531547-132531569 AAGGAGCTGGAGAAGGAGGCAGG + Intronic
1061817954 9:133207571-133207593 CAGGAGCAGCTGCTGGAGCTGGG - Intronic
1061967595 9:134025104-134025126 GAGGAGCAGGAGGAGGAGCTGGG - Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062242445 9:135547603-135547625 CAGGAGCAGCTGCTGGAGCTGGG + Intronic
1062349661 9:136132734-136132756 CAGGAGCCGCACAGGGAGGATGG - Intergenic
1062362934 9:136196053-136196075 CATGAGCACTGGAAGGAGGTGGG - Intergenic
1062589304 9:137266338-137266360 CCGGAGCAGCAGCAGGAGGTCGG - Exonic
1062610018 9:137369427-137369449 CAGGAGGAGCAGAGGGCGGGCGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1202794143 9_KI270719v1_random:105376-105398 CAGGAGCTGCAAAAGGAGAGAGG - Intergenic
1203780235 EBV:96626-96648 CAGGAGCAGGAGGTGGAGGCCGG + Intergenic
1185775569 X:2800403-2800425 CAGGGCCAGCAGACTGAGGTGGG - Intronic
1186125547 X:6409943-6409965 CATGAGGAGGAGAAAGAGGTAGG + Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186382449 X:9075011-9075033 CAGAGGCAGGAGAAGCAGGTAGG + Intronic
1186431094 X:9504836-9504858 GTGGAGTACCAGAAGGAGGTGGG + Intronic
1186672821 X:11783985-11784007 CAGGAGCAAGAGAGAGAGGTGGG - Intergenic
1186701025 X:12090284-12090306 CAGGAGCAAGAGAGAGAGGTGGG - Intergenic
1186720797 X:12301373-12301395 GAGAAGCTGCAGAAGTAGGTTGG - Intronic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1187114413 X:16334463-16334485 CAGGAGCAACAGAGTGAGGCAGG + Intergenic
1187297046 X:18012127-18012149 CCTGATCAGCAGGAGGAGGTAGG + Intergenic
1188643793 X:32538693-32538715 CAGTAGCAGCAGAATCACGTGGG + Intronic
1189122302 X:38407745-38407767 CAGAAGCAGAGGATGGAGGTGGG + Intronic
1189263921 X:39699305-39699327 CAGGAGCAGGACCAGGAGATGGG + Intergenic
1189481339 X:41394445-41394467 CAGGCACAGAAGAAGGAGGAGGG + Intergenic
1189656506 X:43250498-43250520 CAGGAGCAAGAGAGAGAGGTAGG + Intergenic
1189948149 X:46201784-46201806 CAAGATCAACAGAAGGAAGTTGG - Intergenic
1190048010 X:47128002-47128024 CAGGAGAAGGAGAGAGAGGTAGG + Intergenic
1190757408 X:53412942-53412964 AAGGAGAAGAAGAAGGAGCTGGG - Exonic
1190924221 X:54887423-54887445 CAGGAGCAGCAGGTGGTGGTAGG + Intergenic
1191008469 X:55737040-55737062 CAGCTGCAGCTGAAGTAGGTGGG + Intronic
1191713133 X:64174156-64174178 CAGCATCAGCAGAAGCAAGTTGG - Intergenic
1191934448 X:66411351-66411373 CAGGACCAGTAAAAGGAGTTGGG - Intergenic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192362930 X:70450494-70450516 GAGGAGCAGAGGCAGGAGGTAGG - Intronic
1192494327 X:71604856-71604878 CAGGAGCATGAGAAAGATGTGGG - Intronic
1192631614 X:72781929-72781951 ATGGAGCAGCAGAAGGGGCTTGG + Intronic
1192639091 X:72846163-72846185 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1192642620 X:72874642-72874664 GAGGAGGAGAAGAAGGAGGAGGG - Intronic
1192650095 X:72938872-72938894 ATGGAGCAGCAGAAGGGGCTTGG - Intronic
1192795495 X:74421695-74421717 CAGGAACAGCAGGAGCCGGTGGG + Exonic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1197773597 X:130106202-130106224 CAGCAGCAGCTGGAGGAGGGAGG - Intronic
1198270401 X:135051562-135051584 CAGGAGCTGCAGCAGGAGCCTGG + Exonic
1198301986 X:135342576-135342598 CAGGAGCAGCTGGAGAATGTGGG - Exonic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199239416 X:145528970-145528992 CAGGAGCAAGAGAGTGAGGTGGG - Intergenic
1199263974 X:145808734-145808756 CAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1199697564 X:150353614-150353636 CAGGAGCAGCAGCAGGTTCTAGG + Intergenic
1199717757 X:150518460-150518482 CAGGAGGAATAGAAGGAGGCTGG + Intergenic
1200075157 X:153547111-153547133 CCGGGGCAGAAGAGGGAGGTGGG + Intronic
1200125711 X:153813431-153813453 CAGGAGGACCAGGAGGATGTGGG + Intronic
1200259098 X:154602462-154602484 CGGGGGCAGTAGCAGGAGGTGGG + Intergenic
1200709671 Y:6472242-6472264 CTGGAGCATGAGAAGGAGGCCGG - Intergenic
1201024441 Y:9692466-9692488 CTGGAGCATGAGAAGGAGGCCGG + Intergenic
1201294348 Y:12450954-12450976 CAGGACCAGCAGACTGAGGTGGG + Intergenic
1201300219 Y:12498670-12498692 AAGCAGCAGCAGGAGGAGGAGGG - Intergenic
1201739734 Y:17311109-17311131 CAGCAGCAGGAGGAGGAGGAGGG - Intergenic
1201906782 Y:19093557-19093579 CAGGAGCTGGAGATGGAGGAGGG - Intergenic