ID: 1026645130

View in Genome Browser
Species Human (GRCh38)
Location 7:72160891-72160913
Sequence TCCATACCGGATAGAAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026645124_1026645130 3 Left 1026645124 7:72160865-72160887 CCTGCAACCATTCCCAAAATCTT 0: 1
1: 0
2: 1
3: 21
4: 227
Right 1026645130 7:72160891-72160913 TCCATACCGGATAGAAAGCTAGG No data
1026645126_1026645130 -9 Left 1026645126 7:72160877-72160899 CCCAAAATCTTCCTTCCATACCG No data
Right 1026645130 7:72160891-72160913 TCCATACCGGATAGAAAGCTAGG No data
1026645125_1026645130 -4 Left 1026645125 7:72160872-72160894 CCATTCCCAAAATCTTCCTTCCA No data
Right 1026645130 7:72160891-72160913 TCCATACCGGATAGAAAGCTAGG No data
1026645121_1026645130 14 Left 1026645121 7:72160854-72160876 CCCAAGCTAGCCCTGCAACCATT 0: 1
1: 0
2: 0
3: 12
4: 105
Right 1026645130 7:72160891-72160913 TCCATACCGGATAGAAAGCTAGG No data
1026645122_1026645130 13 Left 1026645122 7:72160855-72160877 CCAAGCTAGCCCTGCAACCATTC 0: 1
1: 0
2: 1
3: 15
4: 135
Right 1026645130 7:72160891-72160913 TCCATACCGGATAGAAAGCTAGG No data
1026645127_1026645130 -10 Left 1026645127 7:72160878-72160900 CCAAAATCTTCCTTCCATACCGG No data
Right 1026645130 7:72160891-72160913 TCCATACCGGATAGAAAGCTAGG No data
1026645120_1026645130 15 Left 1026645120 7:72160853-72160875 CCCCAAGCTAGCCCTGCAACCAT No data
Right 1026645130 7:72160891-72160913 TCCATACCGGATAGAAAGCTAGG No data
1026645123_1026645130 4 Left 1026645123 7:72160864-72160886 CCCTGCAACCATTCCCAAAATCT No data
Right 1026645130 7:72160891-72160913 TCCATACCGGATAGAAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026645130 Original CRISPR TCCATACCGGATAGAAAGCT AGG Intronic