ID: 1026648380

View in Genome Browser
Species Human (GRCh38)
Location 7:72192939-72192961
Sequence GCACTCTGGGATGCTGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026648373_1026648380 14 Left 1026648373 7:72192902-72192924 CCAGGGCCAGGAACAGTGGCTCA 0: 2
1: 159
2: 1107
3: 3135
4: 6425
Right 1026648380 7:72192939-72192961 GCACTCTGGGATGCTGAAACAGG No data
1026648374_1026648380 8 Left 1026648374 7:72192908-72192930 CCAGGAACAGTGGCTCACGCCTG 0: 78
1: 8942
2: 54034
3: 127973
4: 145145
Right 1026648380 7:72192939-72192961 GCACTCTGGGATGCTGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026648380 Original CRISPR GCACTCTGGGATGCTGAAAC AGG Intronic
No off target data available for this crispr