ID: 1026649941

View in Genome Browser
Species Human (GRCh38)
Location 7:72208181-72208203
Sequence AAATCCTGATTCACATAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026649938_1026649941 25 Left 1026649938 7:72208133-72208155 CCTCAGATGGCATTCACTTATTT 0: 1
1: 0
2: 0
3: 26
4: 211
Right 1026649941 7:72208181-72208203 AAATCCTGATTCACATAGATGGG 0: 1
1: 0
2: 4
3: 45
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026649941 Original CRISPR AAATCCTGATTCACATAGAT GGG Intronic