ID: 1026649941

View in Genome Browser
Species Human (GRCh38)
Location 7:72208181-72208203
Sequence AAATCCTGATTCACATAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026649938_1026649941 25 Left 1026649938 7:72208133-72208155 CCTCAGATGGCATTCACTTATTT 0: 1
1: 0
2: 0
3: 26
4: 211
Right 1026649941 7:72208181-72208203 AAATCCTGATTCACATAGATGGG 0: 1
1: 0
2: 4
3: 45
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026649941 Original CRISPR AAATCCTGATTCACATAGAT GGG Intronic
902061321 1:13645775-13645797 AAATCTTGCCTCACACAGATAGG + Intergenic
902126075 1:14212541-14212563 AAATCATGATTCTCTTAGAATGG + Intergenic
905138582 1:35821874-35821896 AAATCCTTATTCAAGTATATTGG - Intronic
906890324 1:49705967-49705989 TATCCCTGATTAACATAGATGGG - Intronic
907013679 1:50990210-50990232 AAATCCTTTTTGACATAGAATGG + Intergenic
908142241 1:61198309-61198331 AAAGTCTGATTTGCATAGATTGG - Intronic
908848222 1:68346827-68346849 AAATCCTCATTGATAAAGATGGG - Intergenic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
909749604 1:79142677-79142699 TTATTCTGGTTCACATAGATAGG - Intergenic
911404142 1:97415268-97415290 AGATCCTGATTCATTTAGATAGG - Intronic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
915080421 1:153348330-153348352 AAATCCAGACTCATATGGATGGG + Intronic
918017006 1:180644998-180645020 AAAACCTGCTTCACAAAGATAGG + Intronic
918481620 1:184983735-184983757 AGATCCTGATTAACCTAGTTTGG - Intergenic
918750947 1:188268590-188268612 AAACCCTGCTTCACAAAAATAGG + Intergenic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
920924872 1:210331342-210331364 AGACCCTGCTTCACAAAGATAGG + Intronic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
924244505 1:242070668-242070690 AAACCCTGTTTCACAAAGACAGG + Intergenic
1063005885 10:1970249-1970271 AAATCCTGCTTCACAAAGACAGG - Intergenic
1063594393 10:7420640-7420662 AAACCCTGCTTCCCAAAGATAGG - Intergenic
1063740881 10:8817824-8817846 ATATCCTGTTTCACTTAGAAAGG - Intergenic
1064732024 10:18341343-18341365 CCATCCTGATTTACACAGATAGG - Intronic
1066781587 10:38953730-38953752 AAATTCTGATTGACATAATTTGG - Intergenic
1066955293 10:42163234-42163256 AAATTCTGATTGACATAATTTGG + Intergenic
1067151255 10:43736848-43736870 AATTCCTGATAGACAGAGATGGG + Intergenic
1068112829 10:52700949-52700971 AAATCCTGATTGAGATATATGGG - Intergenic
1068163331 10:53296745-53296767 AGACCCTGCTTCACAAAGATAGG + Intergenic
1070615233 10:77964555-77964577 AAACCCTGCTTCACAAGGATAGG - Intergenic
1071452604 10:85811221-85811243 AAAGCCTTATTCCTATAGATGGG - Intronic
1074330637 10:112504556-112504578 AAAAGCTAATTCACATGGATTGG - Intronic
1075018043 10:118925426-118925448 AAATCCTGATTTTCAGTGATGGG - Intergenic
1077968376 11:7160286-7160308 AACTCCAGATCCACATATATGGG - Intergenic
1078208789 11:9253341-9253363 AAATCCTGAGTCACAGTGTTTGG - Intronic
1078826109 11:14931718-14931740 AAATCCTGCTTCACAAAGATAGG + Intronic
1079000617 11:16752005-16752027 AAACCCTGTTTCACAAAGACAGG - Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1080914405 11:36641089-36641111 AAATCCAGACTCATATAGATAGG - Intronic
1081001754 11:37682418-37682440 ATATCCTGCTTCACTAAGATAGG - Intergenic
1081495561 11:43606472-43606494 AAATCCTAATGAACATAGACAGG - Intronic
1083083813 11:60121921-60121943 AAACCCTGCTTCATAAAGATAGG - Intergenic
1084889793 11:72231019-72231041 ACATCCTGGTTCACATCGAAGGG + Exonic
1085275143 11:75293605-75293627 ACAGCCTGATTCACAGAGCTGGG + Intronic
1085961556 11:81468402-81468424 AAATCCTAAGTCCCATAGCTGGG - Intergenic
1086620182 11:88878327-88878349 AACTCTTTATTCACATAGAGAGG + Intronic
1088134276 11:106535268-106535290 AAAACCTGATTTATATAGAAAGG - Intergenic
1090575920 11:128103591-128103613 AAATCTTGATTCAGATGGGTTGG + Intergenic
1092820911 12:12352759-12352781 AAATCTTTCTCCACATAGATGGG - Intergenic
1092982225 12:13808169-13808191 AAATGCTGATGCACACTGATGGG - Intronic
1093233962 12:16583549-16583571 AAGACCTCATTCCCATAGATGGG + Intronic
1093557812 12:20498213-20498235 AAATCCCAAGTCTCATAGATTGG + Intronic
1094143378 12:27203924-27203946 AATTCCTGATTCACATAAACAGG - Intergenic
1094812782 12:34156141-34156163 AAAGCCTGCTTCACAAAGACAGG - Intergenic
1096095137 12:48929911-48929933 AAGTCCTGATTCTCTTAGCTAGG + Intronic
1099018856 12:77378590-77378612 AAATCCTGATTTACCTTGAGTGG + Intergenic
1099657699 12:85515633-85515655 AAATTCTCATTTCCATAGATTGG + Intergenic
1102955084 12:117053935-117053957 AAATCCTGGTTCTCAGAGAAAGG - Intronic
1105376208 13:19847389-19847411 AAATCTGGCCTCACATAGATAGG - Intronic
1108922992 13:55699442-55699464 AAAACCTGAATAATATAGATTGG - Intergenic
1109018050 13:57045588-57045610 TAATTCTGATTTACATGGATTGG - Intergenic
1109371929 13:61433533-61433555 AAATTATTATACACATAGATTGG - Intergenic
1110003998 13:70242470-70242492 AAATCCTGATTCACTTCCAAAGG - Intergenic
1110256069 13:73435271-73435293 AAATCCTCATTCTCAAAAATGGG - Intergenic
1110728268 13:78851528-78851550 AAATCCTGATTTTAATAGAATGG - Intergenic
1112000743 13:95207392-95207414 AAATACTGATTCATATAGTTTGG + Intronic
1113401436 13:109997657-109997679 AAACCCTGCTTCAGAAAGATAGG - Intergenic
1115067984 14:29288807-29288829 AGATCTTGATTCACATAAAGTGG - Intergenic
1116087526 14:40259600-40259622 AAATCTTGATTAGCATATATTGG - Intergenic
1116140382 14:40985936-40985958 AAACCCTGCTTCACAAAAATGGG + Intergenic
1116529879 14:45956989-45957011 AAAGCCTGATTAACATAAATGGG + Intergenic
1116770182 14:49118398-49118420 AAATCCTGATGTACCAAGATAGG + Intergenic
1117236987 14:53788465-53788487 AAATACTTATTCAGAGAGATTGG - Intergenic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1118571812 14:67201637-67201659 AAATCCTGATTAACTTAAATGGG - Intronic
1120131292 14:80810560-80810582 CATTCCTGATGAACATAGATGGG - Intronic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1121675371 14:95748212-95748234 AATTCATGACTCCCATAGATAGG + Intergenic
1124712598 15:32028459-32028481 AAAACCTGAGTCCCATAGATGGG + Intergenic
1125115121 15:36081279-36081301 AAAGCCTTATTCACATGAATGGG - Intergenic
1126457249 15:48877140-48877162 AAATCCTGCCTCACAAAGATAGG - Intronic
1126998210 15:54470184-54470206 ATATCCTGATGAACATAGATGGG - Intronic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1134847546 16:17453111-17453133 AGATCCTGAGTCACATAGAAAGG + Intronic
1137085633 16:36118806-36118828 AAATTCTGATTGACATAATTTGG + Intergenic
1138425540 16:56929768-56929790 AAACCCTGCTTCACAGAGATGGG + Intergenic
1140581985 16:76241360-76241382 AAATCCTCCTTCACAAAGATAGG - Intergenic
1144188582 17:12821750-12821772 AAACCGTGATTCACATTGTTTGG - Intronic
1145710834 17:26974167-26974189 AAATTCTGATTGACATAATTTGG - Intergenic
1146486147 17:33244373-33244395 AAATCCTGATTTACATCATTTGG + Intronic
1148177219 17:45577271-45577293 GAATCCTGAATGAGATAGATTGG - Intergenic
1149440340 17:56668629-56668651 AAACCCTGCTTTACAAAGATAGG - Intergenic
1203182256 17_KI270729v1_random:71031-71053 AAATTCTGATTGACATAATTAGG - Intergenic
1155112243 18:22727506-22727528 AAATTCTGCTTCACTAAGATAGG - Intergenic
1155411017 18:25544970-25544992 AAATGCTGATTCTGATATATAGG + Intergenic
1159714135 18:71799942-71799964 AAATACTTTTTCATATAGATTGG + Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1167928181 19:52840147-52840169 AAATCCAGCTTCAAATACATAGG - Exonic
1168546149 19:57251907-57251929 AAATCCCCTTGCACATAGATGGG - Intronic
1202668439 1_KI270709v1_random:22947-22969 AAATTCTGATTGACATAATTTGG - Intergenic
925507382 2:4583673-4583695 AAAGCCTGATTCTCAGAGAAGGG + Intergenic
925841640 2:7997547-7997569 AAATGCTGATTCTCATAGTTTGG + Intergenic
928040359 2:27869835-27869857 AAACTCTGCTTCACAAAGATAGG + Intronic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
929509964 2:42558887-42558909 AAATCCTGATTTAATTAGTTTGG - Intronic
930629382 2:53735649-53735671 AAAAACTGATTCATACAGATGGG + Intronic
932946986 2:76246710-76246732 AAATACTTATTCCTATAGATGGG + Intergenic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
934252863 2:90376947-90376969 AAATTCTGATTGACATAATTTGG + Intergenic
934256578 2:91426000-91426022 AAATTCTGATTGACATAATTTGG - Intergenic
935113230 2:100110915-100110937 AAATCCTGACTGACATAAACGGG - Intronic
936689924 2:114874410-114874432 AAACCCTGCTTCACCAAGATAGG - Intronic
936866270 2:117078374-117078396 GAATCATGGTTCACATAGTTTGG - Intergenic
937018048 2:118624286-118624308 AAACCCTATTTCACAAAGATAGG - Intergenic
937573227 2:123389728-123389750 ATATCCTTATGCACATAGATGGG - Intergenic
938469908 2:131549776-131549798 ATATCCTGGTTTACATTGATAGG + Intergenic
939306519 2:140418567-140418589 AAATCCTGCTTCACAAATATGGG - Intronic
939886232 2:147684966-147684988 ATGTCCTGAATCACAGAGATGGG - Intergenic
943097093 2:183442498-183442520 AAATCCATTTTCACATAAATTGG + Intergenic
943163729 2:184288579-184288601 ACATCCAGATTCACATAGTCTGG - Intergenic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
944381552 2:199116550-199116572 CAATCCTGATTCATATACAGAGG - Intergenic
944404438 2:199366978-199367000 AATTCCAGATTCAGAAAGATTGG - Intronic
1170744220 20:19084355-19084377 AAATCCTGATTCCCAAAGATAGG - Intergenic
1174189679 20:48731415-48731437 AAGTCCTTATTCTCATAGAGTGG - Intronic
1174740819 20:53012439-53012461 AAATCCTGATTCATTTGGGTTGG - Intronic
1175570744 20:60019858-60019880 AAAAACTTATTCATATAGATGGG + Intronic
1176013745 20:62916725-62916747 AAATCTTGCCTCACACAGATAGG + Intronic
1177126444 21:17199299-17199321 AGATACTGATTCACATAAAGAGG + Intergenic
1177273880 21:18881698-18881720 AAACCATGATTCACATAGATAGG + Intergenic
1177725939 21:24967931-24967953 AAATCAAGATTCACAGAGATGGG - Intergenic
1178893327 21:36538701-36538723 GCATCCTGATTCTCATACATGGG - Intronic
1178980613 21:37260749-37260771 AGATCATGATTCAAATAAATTGG - Intronic
1179183639 21:39066386-39066408 ACATACTGATTTACATAGCTTGG - Intergenic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1181983313 22:26781850-26781872 TAATCCTGATTCACAGAAAAAGG + Intergenic
1203288369 22_KI270735v1_random:6518-6540 AAATTCTGATTGACATAATTTGG + Intergenic
1203326199 22_KI270738v1_random:22426-22448 AAATTCTGATTGACATAATTTGG + Intergenic
950273330 3:11637572-11637594 TAGTCATGATTCACATTGATAGG + Intronic
950758430 3:15197996-15198018 AAACCCTGCTTCATAAAGATAGG + Intergenic
951745645 3:25974432-25974454 AATGCCTGATTAACACAGATTGG - Intergenic
954224757 3:49174445-49174467 AAATCCTCATCCTCATAGGTTGG + Intronic
954342283 3:49964355-49964377 AAATGCTGAATGACAGAGATTGG + Intronic
955767374 3:62359057-62359079 AATTCCTTTTTCACATAAATTGG - Intergenic
955993969 3:64658947-64658969 AAATCCTTAGTCACTTAGGTGGG - Intronic
956089506 3:65650761-65650783 AAATTCTGATTCACAAAGTCTGG - Intronic
956806760 3:72821871-72821893 AAATCCTGGTTCAAATATTTGGG - Intronic
957412460 3:79859221-79859243 AAATCCTGATTCAAAGACATGGG + Intergenic
961093590 3:124136496-124136518 AAATCCTGATTCCAATCAATGGG - Intronic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
964612923 3:158632946-158632968 AAATGCTACTTCACAAAGATAGG + Intergenic
965841382 3:172909521-172909543 AAAGCCCAATTCACATAGAGAGG + Intronic
966681997 3:182651665-182651687 AAATCCTGTTGCACTAAGATCGG - Intergenic
967611884 3:191516228-191516250 AAATTGTGATTCACATAAAATGG + Intergenic
967658976 3:192082062-192082084 AATCCCTGATTCACAAAGAAAGG + Intergenic
969982847 4:11176639-11176661 ATATCCAAATTCACATAGTTAGG - Intergenic
973227818 4:47805926-47805948 AAATCCTGATTCATATCATTAGG + Intronic
975347782 4:73313416-73313438 AAATCCTGACTCTTATAAATTGG + Intergenic
975357974 4:73430612-73430634 AGAGCATGATTCAAATAGATAGG + Intergenic
975417449 4:74121401-74121423 AAACCCTACTTCACAAAGATAGG - Intronic
975625355 4:76340567-76340589 AAACACTGCTTCACAAAGATAGG - Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
976327490 4:83788648-83788670 AATTCCTCATTAACATTGATAGG + Intergenic
977115049 4:93013686-93013708 AAATACAGATTTACATAGGTAGG - Intronic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
979436458 4:120698427-120698449 AAATCCTGACTGACTTAGTTAGG - Intronic
979829230 4:125280146-125280168 AAACCCTTCTTCACAAAGATAGG - Intergenic
980599398 4:135000157-135000179 AATTTCGGATTCACATAGCTAGG - Intergenic
981390013 4:144178539-144178561 AAATACTCTATCACATAGATAGG + Intergenic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
982975682 4:162057036-162057058 AACTGCTGTTTCACATAGAAAGG + Intronic
983837735 4:172413145-172413167 AAATCCTGATTGACTTAAACAGG + Intronic
984080938 4:175249568-175249590 AAATCTTCATGTACATAGATAGG + Intergenic
984123367 4:175773397-175773419 AAAACCTAATTGGCATAGATTGG + Intronic
984149954 4:176116425-176116447 ACATCCTCATTCACATAAATTGG + Intronic
984736229 4:183110942-183110964 AAATCCTGATTTACAGGGCTGGG + Intronic
986350178 5:6870326-6870348 CAACCCTGCTTCACAAAGATAGG + Intergenic
987458193 5:18172693-18172715 AAATTTTGATTCACATCTATGGG - Intergenic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
988701041 5:33674734-33674756 AAATCCTGAGTCACAGACAAAGG - Intronic
988882938 5:35523342-35523364 TAATCCTGGTTCACATAGGTGGG - Intergenic
988912221 5:35854850-35854872 TAAGCCTGATTCACAAAAATTGG - Intronic
990643384 5:57814784-57814806 AAAGCCTGTTTCAAATAGCTAGG + Intergenic
992950657 5:81853989-81854011 AAAGCCTGATTTACAAAGACTGG + Intergenic
992969887 5:82045585-82045607 AACTCCTGCTTCCCATAGCTTGG - Intronic
993735634 5:91474030-91474052 AAATCCAAAGTCACATAGAGTGG - Intergenic
994170597 5:96655826-96655848 AAATCCCGATTTACACAAATAGG - Intronic
994630802 5:102285132-102285154 AAATCCTGATTCAGTAAGTTTGG - Intronic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
997900374 5:137758015-137758037 AAACCCTGCTTCACAAATATAGG + Intergenic
999193773 5:149768103-149768125 AAACCCTGCTTCACAGGGATAGG + Intronic
999589875 5:153133155-153133177 AACTTCTGATCCACATAAATAGG - Intergenic
1000970405 5:167708097-167708119 AAATTCTGATTCCTATTGATTGG + Intronic
1001894462 5:175366505-175366527 AAACCCTGCTTCGCAAAGATAGG - Intergenic
1004599281 6:17132154-17132176 AAACCCTGCTGCACAAAGATGGG - Intergenic
1005917599 6:30367005-30367027 AAATAGTGATTCACATAAAATGG + Intergenic
1006754463 6:36403256-36403278 AAATCCTGACTCACATTCACTGG - Intronic
1008374302 6:50773794-50773816 AAGTCCTGCTTCTCAGAGATGGG + Intergenic
1008780464 6:55097378-55097400 TTTTTCTGATTCACATAGATTGG + Intergenic
1009502622 6:64434937-64434959 AAATCATGAAGGACATAGATGGG - Intronic
1009817075 6:68749977-68749999 ATATTCTGATTAACATAGAGAGG - Intronic
1010978966 6:82348542-82348564 GTATCCTAATTCACATAAATAGG + Intergenic
1011571544 6:88742132-88742154 AAATGCTGATTCAGACAAATAGG + Intronic
1012639170 6:101587460-101587482 AAATCCTATTTCAGATAGGTGGG - Intronic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1016442483 6:144098021-144098043 AAACCCTCATTCACATAGATAGG + Intergenic
1017090749 6:150756625-150756647 ATCTCCTGAGTCACATAGATTGG - Intronic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1017616295 6:156250106-156250128 AAAGCCTGATTTACTTAGTTAGG - Intergenic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1020149564 7:5671199-5671221 AAATCCTGATGAACACAGAGGGG + Intronic
1021750068 7:23788563-23788585 AAATCCTGATTCACCTCTAATGG + Intronic
1023653650 7:42397387-42397409 AAATCCAGCCTCACACAGATAGG - Intergenic
1024276627 7:47682480-47682502 AAATCTAGGTTCACGTAGATAGG - Intergenic
1025318946 7:58070344-58070366 AAATTCTGATTGACATAATTTGG - Intergenic
1025473846 7:60894812-60894834 AAATCTGCATTCACATAGACAGG - Intergenic
1025477371 7:60940954-60940976 AAATTCTGATTGACATAATTTGG - Intergenic
1025513158 7:61595062-61595084 AAATCTGCATTCACATAGACAGG + Intergenic
1025554768 7:62292708-62292730 AAATTCTGATTGACATAATTTGG + Intergenic
1025560013 7:62360568-62360590 AAATTCTGATTGACATAATTTGG - Intergenic
1026649941 7:72208181-72208203 AAATCCTGATTCACATAGATGGG + Intronic
1028352617 7:89867779-89867801 AAATACTGATTCACTGAGTTTGG - Intergenic
1028354149 7:89886212-89886234 AAATGCTGAGACACATAGAGGGG - Intergenic
1028951798 7:96644587-96644609 AAATCCTGTTTAGAATAGATAGG - Intronic
1029857317 7:103530591-103530613 AGATGCTGATTCACAGAGTTGGG - Intronic
1031678585 7:124642176-124642198 AGATCCTGATTCAGATACCTGGG - Intergenic
1032711542 7:134464323-134464345 AAAGACTTATTCTCATAGATCGG - Intergenic
1032841831 7:135720526-135720548 AAAGCCTGAATCACTGAGATGGG - Intronic
1034135412 7:148763277-148763299 ACATCCTGGTTCCCATAGAGGGG + Intronic
1036382638 8:8247412-8247434 AAATCCTGCTTCACAAAGACAGG - Intergenic
1042135950 8:65633247-65633269 AAATCCTTATTCAGTTAGGTGGG + Intronic
1043050992 8:75385339-75385361 AAACCCTGCTTCACAAGGATAGG - Intergenic
1045407872 8:101885293-101885315 AAATCCAGATAACCATAGATGGG - Intronic
1046238127 8:111454068-111454090 GAAGCCTGCTTCACAAAGATAGG - Intergenic
1047698306 8:127425818-127425840 AAATCGTGATTCCTAAAGATAGG - Intergenic
1047805322 8:128353407-128353429 AAATCCTTATTCACTTGGAAAGG - Intergenic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1050559729 9:6822357-6822379 AAATCCTTTTTGAGATAGATGGG + Intronic
1050901724 9:10958738-10958760 AAATCCTGATTGAAAGAGAGTGG - Intergenic
1052517089 9:29496005-29496027 AAATGATGAATTACATAGATTGG - Intergenic
1052993080 9:34533459-34533481 CAATCCTGATTGATATAGGTAGG - Intergenic
1053407461 9:37889857-37889879 AAATCCAGATCCAAATAGCTGGG + Intronic
1055511360 9:76998773-76998795 AAGTCCTAATTCACACACATAGG - Intergenic
1057885627 9:98827542-98827564 AAATCCTCAGTCAAATAGAATGG + Intronic
1058155379 9:101508913-101508935 AAACCCTGTTTCACAAAGGTAGG + Intronic
1058229481 9:102408214-102408236 AAACTCTGCTTCACAAAGATCGG - Intergenic
1058355062 9:104074731-104074753 AAATCCTCATTAACATGGAATGG + Intergenic
1058646207 9:107133757-107133779 AAATCCAACTTCACACAGATAGG + Intergenic
1058656727 9:107229157-107229179 GAATCCCAATTCACACAGATTGG - Intergenic
1059671504 9:116496618-116496640 AATTCCTGATTCCCATTGGTTGG + Intronic
1185530273 X:812779-812801 AAATTCTGATTCACTGGGATAGG + Intergenic
1186598723 X:11012666-11012688 AAATCCTTATTCACACAGTGTGG - Intergenic
1188065688 X:25656668-25656690 AAACCCTGCTTCACAATGATAGG + Intergenic
1190939167 X:55024383-55024405 AAATCCATATTCTCATAGAGTGG + Intronic
1191797967 X:65043061-65043083 CAATTCTGATTGACATAGGTTGG + Intergenic
1194213788 X:91102353-91102375 AAATCCTGATTTAAATAGGTGGG - Intergenic