ID: 1026650388

View in Genome Browser
Species Human (GRCh38)
Location 7:72211133-72211155
Sequence GGAGCCTAAGTTAGTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026650388_1026650392 1 Left 1026650388 7:72211133-72211155 CCAACAAAACTAACTTAGGCTCC No data
Right 1026650392 7:72211157-72211179 TATAGCCTAATTCTCCAGGCTGG No data
1026650388_1026650389 -3 Left 1026650388 7:72211133-72211155 CCAACAAAACTAACTTAGGCTCC No data
Right 1026650389 7:72211153-72211175 TCCCTATAGCCTAATTCTCCAGG 0: 1
1: 0
2: 0
3: 21
4: 589

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026650388 Original CRISPR GGAGCCTAAGTTAGTTTTGT TGG (reversed) Intronic