ID: 1026650389

View in Genome Browser
Species Human (GRCh38)
Location 7:72211153-72211175
Sequence TCCCTATAGCCTAATTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 589}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026650386_1026650389 28 Left 1026650386 7:72211102-72211124 CCTAATGAAATCATTCAAAGGGT No data
Right 1026650389 7:72211153-72211175 TCCCTATAGCCTAATTCTCCAGG 0: 1
1: 0
2: 0
3: 21
4: 589
1026650388_1026650389 -3 Left 1026650388 7:72211133-72211155 CCAACAAAACTAACTTAGGCTCC No data
Right 1026650389 7:72211153-72211175 TCCCTATAGCCTAATTCTCCAGG 0: 1
1: 0
2: 0
3: 21
4: 589

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026650389 Original CRISPR TCCCTATAGCCTAATTCTCC AGG Intronic