ID: 1026650392

View in Genome Browser
Species Human (GRCh38)
Location 7:72211157-72211179
Sequence TATAGCCTAATTCTCCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026650388_1026650392 1 Left 1026650388 7:72211133-72211155 CCAACAAAACTAACTTAGGCTCC No data
Right 1026650392 7:72211157-72211179 TATAGCCTAATTCTCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026650392 Original CRISPR TATAGCCTAATTCTCCAGGC TGG Intronic