ID: 1026651087

View in Genome Browser
Species Human (GRCh38)
Location 7:72216526-72216548
Sequence GCGTAAGGTACCCTGACCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 30}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026651082_1026651087 10 Left 1026651082 7:72216493-72216515 CCATAATTCTGTGTATCATAGGG 0: 1
1: 0
2: 0
3: 6
4: 147
Right 1026651087 7:72216526-72216548 GCGTAAGGTACCCTGACCCTAGG 0: 1
1: 0
2: 0
3: 3
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026651087 Original CRISPR GCGTAAGGTACCCTGACCCT AGG Intronic
905066796 1:35191942-35191964 GCAGAAGGTATCCTGTCCCTGGG - Intronic
912798556 1:112707062-112707084 GCGGAAGGTACCCTGGGCCGGGG - Exonic
918912293 1:190590546-190590568 GCCTTAGGTTCCCTCACCCTGGG - Intergenic
1078475458 11:11625400-11625422 GCATAGGGTACCCTGACCTGAGG + Intergenic
1079181973 11:18201692-18201714 ACATAAGGTACCATGTCCCTAGG + Intronic
1080036244 11:27714686-27714708 GCCTAAGTTACCCTAACCTTTGG - Intronic
1095443440 12:42260764-42260786 GCCTAGGGTGCCCTGTCCCTAGG + Intronic
1119086545 14:71744374-71744396 GAGTAAGGTACCCAGAGCTTAGG - Intergenic
1120848202 14:89144862-89144884 GTCCAAGGAACCCTGACCCTAGG - Intronic
1138275661 16:55732294-55732316 GCAGAAGGGACCCTGTCCCTCGG + Intergenic
1152627172 17:81393184-81393206 GGGGAAGGTTCCCGGACCCTGGG - Intergenic
1156395811 18:36698901-36698923 GGGAAAGGAACCCTGAGCCTTGG + Intronic
1167269944 19:48501005-48501027 GCGTAAGGCAGCTTGAGCCTCGG + Exonic
927683826 2:25157412-25157434 GAGGGAGGTACCCTGGCCCTTGG + Exonic
931517686 2:63059453-63059475 GAGCAAGGTACCCAAACCCTTGG + Intergenic
934713982 2:96532709-96532731 GCTTTAGTTACCCTGACCCTGGG + Intergenic
945919922 2:215745515-215745537 GCAAAAGGTACCATGACTCTGGG + Intergenic
947128990 2:226902384-226902406 GGGTAAAGTGCCCTAACCCTAGG + Intronic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
968648594 4:1751606-1751628 GTGCAAGGTACCCCCACCCTGGG - Intergenic
973614211 4:52663003-52663025 GTGCAAGGTACCATGGCCCTGGG - Intergenic
988056592 5:26105439-26105461 GCGTAAGCTACTCTGCCACTTGG - Intergenic
994811937 5:104530437-104530459 AAATAAGGTACCCTGACCCATGG - Intergenic
1011016965 6:82767601-82767623 GCTTCAGGGACCCTGGCCCTTGG - Intergenic
1026651087 7:72216526-72216548 GCGTAAGGTACCCTGACCCTAGG + Intronic
1029090218 7:98041916-98041938 GCCTAGGGCACCCTGACCCCAGG + Intergenic
1030453645 7:109745197-109745219 GGGAAAGCTACCCTGACACTTGG - Intergenic
1032018697 7:128394873-128394895 ACTTCAGGTTCCCTGACCCTGGG - Exonic
1033061160 7:138109539-138109561 GAGTAGGATACCCTGACCCCAGG + Intronic
1045326404 8:101120869-101120891 GGGCATGGTGCCCTGACCCTCGG - Intergenic
1051192856 9:14533580-14533602 GCTTAAGGTAGCCTGACTCTGGG + Intergenic
1051800181 9:20923821-20923843 GCTTTAGGTAGCCTGGCCCTGGG + Intronic
1191216277 X:57934741-57934763 GCGCCAGGGACCCAGACCCTGGG - Intergenic
1192501910 X:71660151-71660173 GCGTATGGTGCCCTGGGCCTCGG + Intergenic