ID: 1026653018

View in Genome Browser
Species Human (GRCh38)
Location 7:72232080-72232102
Sequence GGTCAAAGAAGACAAAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026653010_1026653018 5 Left 1026653010 7:72232052-72232074 CCCCTACAGGCTGGGGCCAAAGG 0: 1
1: 0
2: 0
3: 17
4: 175
Right 1026653018 7:72232080-72232102 GGTCAAAGAAGACAAAAGGCTGG No data
1026653012_1026653018 4 Left 1026653012 7:72232053-72232075 CCCTACAGGCTGGGGCCAAAGGA 0: 1
1: 0
2: 0
3: 18
4: 160
Right 1026653018 7:72232080-72232102 GGTCAAAGAAGACAAAAGGCTGG No data
1026653013_1026653018 3 Left 1026653013 7:72232054-72232076 CCTACAGGCTGGGGCCAAAGGAG 0: 1
1: 1
2: 4
3: 36
4: 312
Right 1026653018 7:72232080-72232102 GGTCAAAGAAGACAAAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026653018 Original CRISPR GGTCAAAGAAGACAAAAGGC TGG Intronic
No off target data available for this crispr