ID: 1026661181

View in Genome Browser
Species Human (GRCh38)
Location 7:72304113-72304135
Sequence GTCTGAAAGACGGTGGTTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026661181_1026661188 -8 Left 1026661181 7:72304113-72304135 CCCGAAACCACCGTCTTTCAGAC 0: 1
1: 0
2: 0
3: 11
4: 82
Right 1026661188 7:72304128-72304150 TTTCAGACTGGGAGGTCCAAAGG No data
1026661181_1026661189 -3 Left 1026661181 7:72304113-72304135 CCCGAAACCACCGTCTTTCAGAC 0: 1
1: 0
2: 0
3: 11
4: 82
Right 1026661189 7:72304133-72304155 GACTGGGAGGTCCAAAGGTATGG 0: 1
1: 0
2: 0
3: 47
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026661181 Original CRISPR GTCTGAAAGACGGTGGTTTC GGG (reversed) Intronic
900894604 1:5474522-5474544 GGCTGAAAGAAGGAGGTTTCTGG - Intergenic
902990493 1:20184417-20184439 GTGTAAAAGATGGTGGTTTTAGG - Intergenic
904837221 1:33347108-33347130 GTCTGAAAAAGAGTGGATTCTGG + Intronic
906361086 1:45160104-45160126 GTCTCAAATACTTTGGTTTCAGG - Intronic
907727360 1:57032185-57032207 GTCTGTGAGAAGGTGTTTTCGGG - Intronic
912797769 1:112703181-112703203 GCCCGAAGGACAGTGGTTTCAGG - Intronic
915296716 1:154926438-154926460 GTCTGACATCCAGTGGTTTCGGG - Exonic
917070594 1:171146348-171146370 TTCTTAAAGACCCTGGTTTCCGG + Exonic
918633972 1:186752924-186752946 GTCTGAAACTCAGTGCTTTCTGG - Intergenic
921511371 1:216034698-216034720 TTCTGACAGTCAGTGGTTTCTGG - Intronic
1066170290 10:32836199-32836221 TTTTGAATGACAGTGGTTTCAGG - Intronic
1070375561 10:75827839-75827861 GTCTGAAAGATGGTGATCTTTGG + Intronic
1077334480 11:1997339-1997361 TTCTGAAAGAAGGAGGTTTAGGG - Intergenic
1078961390 11:16276708-16276730 GTCTGAAGGTAAGTGGTTTCTGG - Intronic
1083033258 11:59614015-59614037 GTCTCAAAGAGGATGGTCTCTGG + Intronic
1085230310 11:74962056-74962078 ATCTGAAGGACATTGGTTTCTGG + Intronic
1087105657 11:94404099-94404121 GTCTCAAAGACTGTGACTTCAGG - Intergenic
1087273524 11:96137681-96137703 GTCTGAAAGACGGTGGGCAGGGG + Intronic
1202817463 11_KI270721v1_random:52521-52543 TTCTGAAAGAAGGAGGTTTAGGG - Intergenic
1092209158 12:6635289-6635311 CTCTGATAGATGGTGGCTTCAGG - Intronic
1093363875 12:18268442-18268464 GTCAAATAGACTGTGGTTTCGGG - Intronic
1096842052 12:54385650-54385672 GTATGAAAGGGGGTGGTGTCTGG - Intronic
1098219136 12:68250026-68250048 GTCTGAAATAGGGTGGTTTTGGG - Intronic
1101788838 12:107910603-107910625 GTCTGAAAGTAGGTGGTGTGAGG - Intergenic
1101788855 12:107910714-107910736 GTCTGAAAGTAGGTAGTTTGAGG - Intergenic
1101998691 12:109543323-109543345 GTCTGCATGAGGCTGGTTTCTGG - Intergenic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1104056263 12:125233153-125233175 GTCTGAAACAAAGTGGTTACTGG + Intronic
1111854858 13:93624953-93624975 CTCTGAGAGAAAGTGGTTTCTGG + Intronic
1113570755 13:111355249-111355271 GTCTGAGAGATGCTGGTTTGAGG + Intergenic
1118500373 14:66356690-66356712 GTTTGAGAGACTGTGGATTCTGG - Intergenic
1119566377 14:75632563-75632585 ATCTGAAAGACAGTAGCTTCCGG + Intronic
1121519128 14:94573887-94573909 AGCTGAAAGACGGAGGCTTCTGG - Intronic
1122389726 14:101372003-101372025 GCCTGACAGCCAGTGGTTTCTGG - Intergenic
1122631943 14:103111304-103111326 GTCTGAAAGGCTGTGGTGCCAGG + Intergenic
1122798653 14:104218804-104218826 GTCTGGAATATGGAGGTTTCTGG + Intergenic
1124264278 15:28219584-28219606 GTGTCAAAGATGGTGGTATCAGG + Intronic
1124721297 15:32113160-32113182 GTCTGAATGAAGGTGTTGTCAGG + Intronic
1133361663 16:5178780-5178802 GTCTGACTGCCTGTGGTTTCGGG - Intergenic
1135140075 16:19913653-19913675 ATGTAAAAGACGGTGGTTCCTGG + Intergenic
1139543978 16:67640335-67640357 GTCTGAAAGTTAGTGGTCTCAGG + Intergenic
1154205586 18:12334112-12334134 GTCTGGAAGGCAATGGTTTCAGG + Intronic
1158316894 18:56221269-56221291 CTCTGAAAGAGAGTGGTCTCTGG - Intergenic
1160256151 18:77250328-77250350 TTCTGAGAGAGGGTGGGTTCGGG - Intergenic
1167114283 19:47479996-47480018 GGCGGAAAGTCGATGGTTTCAGG - Intronic
1167942799 19:52961200-52961222 ATTTGAAAAACGGTGGTTGCAGG - Intronic
928052706 2:28016590-28016612 GTCTAAAACACAGTGGATTCTGG - Intronic
930088836 2:47517322-47517344 GTCTGAAGGACGGAGGATCCTGG + Exonic
932190329 2:69735997-69736019 CTCTGCAACATGGTGGTTTCAGG + Intronic
939688340 2:145227117-145227139 TTGGGAAAGAGGGTGGTTTCTGG + Intergenic
940461388 2:153967685-153967707 CTCTGGAAGGCAGTGGTTTCAGG - Intronic
941156708 2:161987995-161988017 GGCGGAGAGAAGGTGGTTTCTGG - Intergenic
943699308 2:190972495-190972517 CTCTGAAAGAGGGTGGTACCAGG - Intronic
946523630 2:220494013-220494035 GTCTGCAAGATGATGGTTGCAGG - Intergenic
947363591 2:229371260-229371282 GACTGAGAGATGGTGGTTGCAGG - Intronic
1175566586 20:59984732-59984754 TACTGAAAGAAAGTGGTTTCCGG + Exonic
952923487 3:38305202-38305224 GTCTAAAAGTCTGTGGTTTCTGG + Intronic
958669145 3:97180498-97180520 CTCTGAAACCTGGTGGTTTCAGG - Intronic
962055835 3:131870700-131870722 ATCTAAAAGAAGCTGGTTTCGGG - Intronic
963986072 3:151596583-151596605 GTCTCTAAGACGCTGGTGTCAGG - Intergenic
971371572 4:26023651-26023673 TTCTGGAAGACAGTGGTTTGGGG - Intergenic
973694602 4:53477819-53477841 GTCTGAAAGATGCTTCTTTCGGG - Intronic
975400641 4:73933914-73933936 GTCTTGAAGACTGTGTTTTCTGG - Intergenic
977852235 4:101844362-101844384 GAATGAAAGATTGTGGTTTCAGG + Intronic
979002286 4:115237839-115237861 GTCTGAAAGGAGGTAGTTGCTGG + Intergenic
982489383 4:156010164-156010186 ATCTTAAGGACGGTGGTTTCTGG + Intergenic
987777821 5:22392214-22392236 GCCTGACAGACGGTGCCTTCTGG + Intronic
989329363 5:40238155-40238177 TTCTCAAAGACAGTGGTTTCAGG + Intergenic
990630286 5:57661439-57661461 GTCTGATAGAGGGTTGTTTCTGG + Intergenic
996797317 5:127363336-127363358 GTCTGGAAGTGGGTGGTTTATGG + Intronic
999869603 5:155735545-155735567 GTGTGAATGCCAGTGGTTTCTGG + Intergenic
1000244513 5:159438235-159438257 GTCTGGAGGATAGTGGTTTCAGG + Intergenic
1002653100 5:180718433-180718455 GTCTGGGAGACGGAGGTTGCAGG - Intergenic
1008136998 6:47788512-47788534 GTATGAAAGAAAGTGGTTTCTGG - Intronic
1011549732 6:88520045-88520067 GTGAGAAAGAGGGTGGTTTCAGG + Intergenic
1014356811 6:120421980-120422002 GTGTGCAAGCCAGTGGTTTCTGG - Intergenic
1016225567 6:141731225-141731247 ATATGAAAGATGGTGGTTTTTGG - Intergenic
1018937432 6:168283040-168283062 GTCTGAGACATGGTGGTCTCTGG - Intergenic
1020968487 7:14902922-14902944 GGCTGAAAGACGTAGGTTTCCGG + Intronic
1024132994 7:46375587-46375609 GTCTGAAAAACACTGGTTGCAGG + Intergenic
1026661181 7:72304113-72304135 GTCTGAAAGACGGTGGTTTCGGG - Intronic
1029202738 7:98849841-98849863 ATCTGAAAGACAGTGCCTTCAGG + Intronic
1033431206 7:141291303-141291325 GTCTGATACACGGTGATGTCAGG - Intronic
1034461594 7:151200620-151200642 GCCTGGAACAGGGTGGTTTCAGG + Intronic
1036721717 8:11181927-11181949 GCCTGGAAGGCGGAGGTTTCAGG - Intronic
1044015358 8:87043900-87043922 GTCAGAAAGAAGTTGGTTTCAGG + Intronic
1047080870 8:121458901-121458923 GTCTCATAGACAGTTGTTTCTGG - Intergenic
1047188688 8:122658377-122658399 ATCTCAAAGACGGGGCTTTCAGG + Intergenic
1048427316 8:134334827-134334849 TTCTGAAAGACCTTGGTTTCCGG + Intergenic
1062299571 9:135857779-135857801 GTGAGAGAGACGGTGGCTTCTGG + Intronic
1187276028 X:17817279-17817301 GTATGAAAGCCAGTGGGTTCTGG - Intronic
1188325933 X:28800763-28800785 GTCTGAAAGAAGTTGATGTCAGG + Intronic
1188897445 X:35686501-35686523 GTCTGAAATGCGCTGGCTTCAGG + Intergenic
1192359208 X:70427778-70427800 GTCTGAAAAAGGGTGTTTCCAGG + Intronic