ID: 1026662254

View in Genome Browser
Species Human (GRCh38)
Location 7:72312501-72312523
Sequence TGGGCCACTTTGCAGTTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 136}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026662246_1026662254 2 Left 1026662246 7:72312476-72312498 CCATGTGCCCCAGGACAGACAGC 0: 1
1: 0
2: 2
3: 33
4: 305
Right 1026662254 7:72312501-72312523 TGGGCCACTTTGCAGTTGAGGGG 0: 1
1: 0
2: 1
3: 18
4: 136
1026662245_1026662254 10 Left 1026662245 7:72312468-72312490 CCTATAAGCCATGTGCCCCAGGA 0: 1
1: 0
2: 1
3: 12
4: 146
Right 1026662254 7:72312501-72312523 TGGGCCACTTTGCAGTTGAGGGG 0: 1
1: 0
2: 1
3: 18
4: 136
1026662251_1026662254 -7 Left 1026662251 7:72312485-72312507 CCAGGACAGACAGCGCTGGGCCA 0: 1
1: 0
2: 2
3: 19
4: 195
Right 1026662254 7:72312501-72312523 TGGGCCACTTTGCAGTTGAGGGG 0: 1
1: 0
2: 1
3: 18
4: 136
1026662249_1026662254 -5 Left 1026662249 7:72312483-72312505 CCCCAGGACAGACAGCGCTGGGC 0: 1
1: 0
2: 1
3: 21
4: 231
Right 1026662254 7:72312501-72312523 TGGGCCACTTTGCAGTTGAGGGG 0: 1
1: 0
2: 1
3: 18
4: 136
1026662243_1026662254 20 Left 1026662243 7:72312458-72312480 CCATGTTATACCTATAAGCCATG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1026662254 7:72312501-72312523 TGGGCCACTTTGCAGTTGAGGGG 0: 1
1: 0
2: 1
3: 18
4: 136
1026662242_1026662254 21 Left 1026662242 7:72312457-72312479 CCCATGTTATACCTATAAGCCAT 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1026662254 7:72312501-72312523 TGGGCCACTTTGCAGTTGAGGGG 0: 1
1: 0
2: 1
3: 18
4: 136
1026662250_1026662254 -6 Left 1026662250 7:72312484-72312506 CCCAGGACAGACAGCGCTGGGCC 0: 1
1: 0
2: 2
3: 22
4: 220
Right 1026662254 7:72312501-72312523 TGGGCCACTTTGCAGTTGAGGGG 0: 1
1: 0
2: 1
3: 18
4: 136
1026662241_1026662254 22 Left 1026662241 7:72312456-72312478 CCCCATGTTATACCTATAAGCCA 0: 1
1: 0
2: 0
3: 11
4: 100
Right 1026662254 7:72312501-72312523 TGGGCCACTTTGCAGTTGAGGGG 0: 1
1: 0
2: 1
3: 18
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026662254 Original CRISPR TGGGCCACTTTGCAGTTGAG GGG Intronic
902365267 1:15968978-15969000 TGGGCTACATGGCAGGTGAGTGG + Intronic
904744374 1:32702316-32702338 TGGGCCAAATGGCACTTGAGCGG + Intronic
907498718 1:54862556-54862578 TGGGACACCTTGCAGGTTAGGGG - Intronic
908401492 1:63775616-63775638 TGCGCTACTTAGCAGTTGAGAGG + Intronic
911172008 1:94780155-94780177 TGAGGCACTGTGCAGATGAGCGG - Intergenic
916869787 1:168901231-168901253 TGGGACACTTTGCTGAAGAGAGG - Intergenic
923231748 1:231993225-231993247 AGGTCCACTTTGCAGGTGTGTGG + Intronic
1063537133 10:6894282-6894304 GGAGCCACTGTGCAGATGAGGGG - Intergenic
1063829036 10:9931345-9931367 AGGGCCACTTTCCAGGTGATTGG + Intergenic
1064540890 10:16403953-16403975 TGAGGCACATTGCAGTTAAGAGG - Intergenic
1065278436 10:24110061-24110083 AGAGCCACTTTGCACTTGATAGG - Intronic
1074061145 10:109966872-109966894 GGGGCCCATTTGCAGTTCAGTGG + Intergenic
1074421319 10:113311164-113311186 TGTGCCACTTCCAAGTTGAGAGG + Intergenic
1075852992 10:125603830-125603852 TGGGGCACTTTGCACTCTAGAGG - Intronic
1078926028 11:15875910-15875932 TGGGCCTCTCTGCAATTGTGGGG - Intergenic
1082883665 11:58062344-58062366 TGAGCCACTTTTTAGTTGATTGG + Intronic
1083475602 11:62913067-62913089 TGGGACAGTTTGCACATGAGGGG + Intronic
1085079227 11:73620408-73620430 TGGGCCACTTTGTATTTTACAGG + Intergenic
1091388258 12:108925-108947 TGGGACCCTTTGCAGTTGCTGGG - Intronic
1096788855 12:54033049-54033071 TGTGACTCTTTGAAGTTGAGGGG - Exonic
1097380734 12:58893073-58893095 TTGCCCACTTTGCAGGTGAGAGG + Intronic
1097535085 12:60858712-60858734 TGGGCCACTTAGCAGCCAAGTGG - Intergenic
1097867266 12:64569144-64569166 TGGGTCACTGAGCACTTGAGTGG - Intergenic
1100106957 12:91187040-91187062 TGGATCACTTTACATTTGAGTGG + Intergenic
1102602494 12:114042590-114042612 TGGGCCACTTTGGAGAGAAGTGG + Intergenic
1103172103 12:118830136-118830158 AGGGCCACTGTGCTGTTGAGTGG + Intergenic
1103439685 12:120954023-120954045 TGGGGCACTTTGCATCAGAGCGG - Intergenic
1104237364 12:126952134-126952156 TGGGCCATTTTACAGTAGACTGG + Intergenic
1108872689 13:55005932-55005954 TGTGGAACTTTGAAGTTGAGAGG - Intergenic
1109917676 13:69013027-69013049 TGGGCCAGATTGCTGTTGATTGG - Intergenic
1110701549 13:78554469-78554491 TCTGCCTCTTAGCAGTTGAGAGG - Intergenic
1110987984 13:81997613-81997635 TGAGCCAATTTGCAATTGACTGG - Intergenic
1114787620 14:25619290-25619312 TGGGTCACTTTGCAGTTCTTAGG - Intergenic
1117999942 14:61513790-61513812 AGCGCCAGTTTGCAGATGAGCGG + Intronic
1118921915 14:70157218-70157240 TGTGCCAGTTTGGAGTTGACAGG + Intronic
1122073851 14:99223026-99223048 TGAGCAAATTTGCAGTTCAGGGG + Intronic
1122986294 14:105213141-105213163 AGGCCCACTGTGCAGTGGAGTGG + Intronic
1124876778 15:33602172-33602194 TGGGCCACTCTGCACTTCAGAGG - Intronic
1131643041 15:94313054-94313076 TGGGCCAATTTGGAGATGAGAGG - Intronic
1133800051 16:9077943-9077965 TGGGACAATTTGAAGTTGGGGGG + Intergenic
1135286169 16:21195108-21195130 TGGACCAACTTGCAGCTGAGAGG + Intergenic
1135303423 16:21349808-21349830 GGGGCCACATGGCAGGTGAGGGG - Intergenic
1136300171 16:29329002-29329024 GGGGCCACATGGCAGGTGAGGGG - Intergenic
1139416905 16:66819980-66820002 TGGGTCACTTTGAAGTTGAGTGG - Intronic
1139481538 16:67233628-67233650 GGGGCTACCTTGCAGATGAGTGG + Intronic
1141301188 16:82817026-82817048 TAAGCCACTATGCAGTTGTGAGG + Intronic
1142061903 16:88035772-88035794 GGGGCCACATGGCAGGTGAGGGG - Intronic
1142551263 17:741451-741473 TTGGCCACGTTGCAGTAGAATGG - Exonic
1142893132 17:2957944-2957966 GAGGCCATTTTGCTGTTGAGGGG + Intronic
1143176198 17:4956565-4956587 TGAGCCAGTTTGCACCTGAGTGG - Exonic
1144499179 17:15770477-15770499 TGGGCCAGTTTGAAGATGAGCGG + Intergenic
1145162567 17:20585510-20585532 TGGGCCAGTTTGAAGATGAGGGG + Intergenic
1153095965 18:1403664-1403686 TGTGCCTCTTTGCAGCTGTGTGG - Intergenic
1157141727 18:45114898-45114920 TGAGCGACTTTTCAGTTCAGAGG + Intergenic
1157571430 18:48714917-48714939 TGGCCCACTCTGCAGGTCAGAGG + Intronic
1157700249 18:49757748-49757770 TGGGCCCCATTGCAGATGAGGGG + Intergenic
1160932351 19:1576761-1576783 TGGGACCCTTTGCAGTGGGGTGG - Exonic
1162281089 19:9698549-9698571 GAGGCCTCTTTGCAGTTAAGAGG + Intronic
1166704311 19:44900333-44900355 TGAGCCACTCTGCTGCTGAGAGG - Intronic
925058682 2:874442-874464 TGGGTCACTGAGCAGCTGAGTGG + Intergenic
929104527 2:38351388-38351410 TCGGCCACTTTCCAGTTTTGAGG - Intronic
931745771 2:65290814-65290836 TGGGCCACTTTACTCTTGTGAGG - Intergenic
935818507 2:106869969-106869991 TGTGCCACTTTCCACTTCAGTGG + Intronic
937119821 2:119433340-119433362 TGGGCCAGGCTGCAGCTGAGAGG + Intronic
938647520 2:133346771-133346793 AGGGCCACTTGCCAGTAGAGTGG + Intronic
940851146 2:158689425-158689447 TGGGCCACTTTATAGTTCTGAGG - Intergenic
945305780 2:208257267-208257289 GAGGCCTCTTTGCAGTTAAGAGG - Intronic
946302135 2:218830488-218830510 TGGCCCTATTTGCAGGTGAGGGG + Intronic
948844456 2:240676541-240676563 GGGGCCACATTCCAGCTGAGTGG - Exonic
948849404 2:240698338-240698360 GGGGCCACATTCCAGCTGAGTGG + Exonic
1168918817 20:1514012-1514034 TGCTCCATTTTGCAGATGAGGGG - Intergenic
1168932746 20:1636979-1637001 TGTCCCACTTTGCAGATGAGGGG - Intronic
1171330107 20:24329965-24329987 TGGGCCTCTTTGTAGTTTGGAGG - Intergenic
1171409861 20:24938944-24938966 TGGGCCTCTTTGGATTTGGGGGG - Intergenic
1173446521 20:43123609-43123631 TGTGGCACTTTACAGTTGAAAGG - Intronic
1178436736 21:32566750-32566772 TGGGCCTGTTTGGAGGTGAGGGG + Intergenic
1179882312 21:44298179-44298201 TCGACCACTTTTCAGTTCAGTGG + Exonic
1180559794 22:16606813-16606835 TGGGAAACTTTGCAGTTTTGCGG - Intergenic
1180999411 22:19981135-19981157 TGGGGCACTCTGTAGTTGGGGGG + Intronic
1181103298 22:20555759-20555781 TGGGCCACATTGGAGTGCAGTGG + Intronic
1182458928 22:30470670-30470692 TGGGCCATTTTGCATGTGGGAGG - Intronic
1183094780 22:35545583-35545605 TGTGCCCATTTGCAGTTCAGGGG + Intronic
1184430157 22:44437858-44437880 TGGCCCATTTTGCAGCAGAGAGG + Intergenic
950521315 3:13499627-13499649 TGGGCCACTGCACAGTTGAGGGG + Intronic
953676754 3:45008550-45008572 AGTCCCACTTTGCAGATGAGGGG - Intronic
954390783 3:50267102-50267124 TGGGCCACTTAGTACTTCAGTGG - Intergenic
955355410 3:58227120-58227142 TGAGCAACTTTGCATTTGTGTGG - Intergenic
956875816 3:73462170-73462192 TGGGAAAGTTTGCAGTTGAAAGG + Intronic
958631339 3:96686905-96686927 AGGGCCACTTGGCAGCTGGGAGG - Intergenic
961435996 3:126916985-126917007 TGGGCCACTTGGCAGGTGACAGG - Intronic
968224149 3:196962501-196962523 AAGGCCTCTTTGCAGTTAAGAGG + Intronic
969138325 4:5049059-5049081 TGGGACACTTTGCAGATGCTGGG - Intergenic
969974406 4:11083478-11083500 TGTGCCAGTTTGCAGTTGAAAGG - Intergenic
970879816 4:20915927-20915949 TGGGGCACATTGGAGTTGAAAGG + Intronic
973597486 4:52507362-52507384 TGGGCAGCTTTGCAGTTGTCGGG - Intergenic
974877039 4:67713743-67713765 AAGGCCACATTGCAGTTGGGTGG - Intergenic
976812004 4:89108407-89108429 TGGGCCACCTTGCAGGTGGCTGG + Intronic
977586722 4:98782546-98782568 TGGGGCGCTTTGCATGTGAGGGG + Intergenic
977662718 4:99609517-99609539 GGAGCCACTTTGCATTTGGGAGG - Intronic
990517420 5:56543131-56543153 TGGGCCAGTAAGCAGATGAGTGG + Intronic
991109835 5:62887084-62887106 TTGGCCACGTTGTGGTTGAGTGG + Intergenic
991222314 5:64230678-64230700 TGGGCCTCTTTGAAGTGGGGAGG + Intronic
993057434 5:82998212-82998234 TGGGCCACTTTGCAAATAACAGG + Intergenic
994372302 5:98980915-98980937 TGGCCCATTTTCCAGTTGGGTGG - Intergenic
994701383 5:103139903-103139925 TGATCCACTTTGCTGTTGAGAGG - Intronic
999419235 5:151426661-151426683 AAGGCCTCTTTGCAGTTAAGAGG - Intergenic
1000459433 5:161496096-161496118 TGTGCCACATTGCAGTTTGGTGG - Intronic
1000718793 5:164680258-164680280 TGGGACAGTTTGAAGTGGAGTGG + Intergenic
1001419532 5:171576065-171576087 TGGTCCACTTTGCTATTGATGGG + Intergenic
1003325551 6:5087359-5087381 TGGGCCCTTTCGCAGTAGAGAGG - Exonic
1003344865 6:5257569-5257591 CGGGCCACACAGCAGTTGAGCGG + Intronic
1006277677 6:33019138-33019160 TGGGCCACTTTGCATGAGACGGG - Intergenic
1007234282 6:40379087-40379109 TGTGTCACTTTCCAGTTGAGCGG - Intergenic
1007825425 6:44596228-44596250 TGGGACCCTTTGGAGTTGAGGGG + Intergenic
1011615277 6:89192391-89192413 TGGGACACTGTGCAGTTAGGTGG - Intronic
1012014920 6:93838006-93838028 CAGGCCACTTTGCAGTCTAGAGG + Intergenic
1012240481 6:96865597-96865619 TGAGCCACGTTGCAGGTGGGAGG + Intergenic
1013856154 6:114574887-114574909 AGGGCCACTATGCAGTTGGATGG + Intergenic
1015967953 6:138713826-138713848 AGAGCCACTTTGCAGTGGAGAGG - Intergenic
1022466987 7:30658586-30658608 TGTTCCAATTTGCAGTTGTGTGG + Intronic
1023233901 7:38064293-38064315 AGGGCCATTTTGAAGTAGAGTGG - Intergenic
1026214953 7:68340264-68340286 TGGTCCAGGCTGCAGTTGAGTGG - Intergenic
1026662254 7:72312501-72312523 TGGGCCACTTTGCAGTTGAGGGG + Intronic
1027416565 7:77980622-77980644 GGGGCTATTTTGCAGTTGAATGG - Intergenic
1027766233 7:82346214-82346236 TCTGCCACATAGCAGTTGAGAGG - Intronic
1028479464 7:91288725-91288747 TGGGGCACTTTGGAGGAGAGTGG + Intergenic
1029180036 7:98693711-98693733 TGTGCCACATAGCAGATGAGTGG + Intergenic
1029297890 7:99555999-99556021 TGGGCCCCTTTGGATTTGGGAGG - Intronic
1030864941 7:114689705-114689727 TGGCCAACTTTGCAGTGAAGAGG - Intronic
1032731422 7:134646923-134646945 GTGGCCCCTTTGCAGGTGAGTGG + Exonic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1033548939 7:142427658-142427680 TTGGCCACTTGGCTGATGAGTGG - Intergenic
1034343368 7:150371652-150371674 TGGGCCGCTTTGCAGCTGAATGG - Exonic
1034468329 7:151242787-151242809 TGGACCTCTTGGCATTTGAGAGG - Exonic
1034617448 7:152430981-152431003 TGGGAAACTTTGCAGTTTTGCGG + Intronic
1034971145 7:155419983-155420005 CAGGCCACTTCGCAGATGAGGGG - Intergenic
1037625088 8:20599605-20599627 TGGGCCAGTTTGCAGAGTAGAGG + Intergenic
1042806612 8:72777306-72777328 TGTGGCACTTGGCAGATGAGAGG + Intronic
1046323098 8:112603541-112603563 TGGCACAATTTGCAGTGGAGAGG - Intronic
1046534945 8:115497394-115497416 TGGGCCACACAGCAGGTGAGAGG - Intronic
1048215077 8:132486711-132486733 TGGGTCACTTTGCATCTTAGAGG + Intergenic
1048588058 8:135793735-135793757 GGGGTTACTTTGCAGCTGAGTGG + Intergenic
1049316183 8:141969649-141969671 TTGGCCACATTGCATTTGGGGGG - Intergenic
1052853974 9:33395451-33395473 GAGGCCACTTTGCAGATGGGCGG + Intronic
1057892571 9:98880500-98880522 TGGGCCAGTTGGCAGCTGCGTGG + Intergenic
1058754401 9:108071053-108071075 TGGGCCACATAGCAGGTGAGCGG - Intergenic
1059264331 9:113011973-113011995 TGGTTCACGTTGCAGTGGAGGGG - Intergenic
1060655639 9:125370937-125370959 TGGCCCACTTAGCTGTGGAGGGG - Intergenic
1060987105 9:127826017-127826039 AGGGTCACTTGGCAGGTGAGTGG - Intronic
1061348175 9:130043151-130043173 CGGGCCATTTTGCTGTGGAGCGG - Exonic
1061527835 9:131182319-131182341 TGGGCCACACAGCAGGTGAGCGG + Intronic
1186685425 X:11920305-11920327 AGGGCCACTGTGCAGCTGACTGG - Intergenic
1192288554 X:69765429-69765451 TGGATCACTTTGCAGTATAGTGG + Intronic
1194007813 X:88518787-88518809 TGGGACACCTTGAAGTTGGGAGG + Intergenic
1195010380 X:100727908-100727930 TTGGCCACGTTACATTTGAGAGG + Intronic
1197820298 X:130534969-130534991 TGGGGCACTTTGCCTTTTAGTGG - Intergenic