ID: 1026664545

View in Genome Browser
Species Human (GRCh38)
Location 7:72331120-72331142
Sequence CAGGTAGATTACCTGAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113711
Summary {0: 2, 1: 134, 2: 3413, 3: 33370, 4: 76792}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026664540_1026664545 0 Left 1026664540 7:72331097-72331119 CCCAGCACTTTGGGAGGCCAAGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
Right 1026664545 7:72331120-72331142 CAGGTAGATTACCTGAAGTCAGG 0: 2
1: 134
2: 3413
3: 33370
4: 76792
1026664542_1026664545 -1 Left 1026664542 7:72331098-72331120 CCAGCACTTTGGGAGGCCAAGGC 0: 52775
1: 164492
2: 216668
3: 175886
4: 111238
Right 1026664545 7:72331120-72331142 CAGGTAGATTACCTGAAGTCAGG 0: 2
1: 134
2: 3413
3: 33370
4: 76792
1026664535_1026664545 27 Left 1026664535 7:72331070-72331092 CCGGGCACGGTGGCTCATACCTG 0: 327
1: 14134
2: 68060
3: 148899
4: 181250
Right 1026664545 7:72331120-72331142 CAGGTAGATTACCTGAAGTCAGG 0: 2
1: 134
2: 3413
3: 33370
4: 76792
1026664538_1026664545 8 Left 1026664538 7:72331089-72331111 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1026664545 7:72331120-72331142 CAGGTAGATTACCTGAAGTCAGG 0: 2
1: 134
2: 3413
3: 33370
4: 76792

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026664545 Original CRISPR CAGGTAGATTACCTGAAGTC AGG Intronic
Too many off-targets to display for this crispr