ID: 1026664745

View in Genome Browser
Species Human (GRCh38)
Location 7:72332590-72332612
Sequence TGACTTGTGGTCTCTCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026664745_1026664749 1 Left 1026664745 7:72332590-72332612 CCCCTGGGAGAGACCACAAGTCA 0: 1
1: 0
2: 2
3: 8
4: 143
Right 1026664749 7:72332614-72332636 TTCCTGCCACTGAGATCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026664745 Original CRISPR TGACTTGTGGTCTCTCCCAG GGG (reversed) Intronic
900464780 1:2820451-2820473 TGACTTGGGGTCACTGCCATGGG - Intergenic
901850446 1:12011619-12011641 TGCCATGTGGGCTCCCCCAGGGG + Exonic
906747291 1:48231072-48231094 TGGGTTGTGGTCTCTGCCTGGGG - Intronic
907066524 1:51489686-51489708 TGACTTGTGGTGTCTCTCCGTGG + Intronic
907411740 1:54288114-54288136 TAATTTGGGGTCGCTCCCAGCGG + Intronic
911131422 1:94392230-94392252 TGACATGTGTTCGTTCCCAGTGG + Intergenic
913451738 1:118997500-118997522 AGGCCTGTGGTCTCTGCCAGGGG - Intergenic
916349669 1:163834852-163834874 TGACTTAAGGTGTTTCCCAGGGG - Intergenic
917834986 1:178934331-178934353 TGAACTGTGGTCTCTCTCTGGGG + Intergenic
918462723 1:184792885-184792907 TTACTTCTTGTCTCTCCAAGTGG - Exonic
923215250 1:231843049-231843071 TTTCTGGTGGTGTCTCCCAGTGG - Intronic
924447121 1:244143766-244143788 TGACATGTGGTGTCTCCACGTGG - Intergenic
1065644986 10:27824740-27824762 TAACTTGGGTTCTCTCCCATTGG + Intronic
1068447417 10:57140208-57140230 TGAATTGTTGTGTCTCCTAGGGG - Intergenic
1070394584 10:76001001-76001023 TGACTTGGGGTGCCTCCCCGGGG - Intronic
1070911336 10:80121163-80121185 TGACTTGAAGACTCTCACAGTGG + Intergenic
1071035810 10:81243815-81243837 TGGCATGTGGTCTATCTCAGTGG - Intergenic
1071868212 10:89762030-89762052 TAATTTGTGGTCTCTCCCTGTGG + Intronic
1074119256 10:110481323-110481345 TGAAGTGTGGCCCCTCCCAGAGG + Intergenic
1074844489 10:117385228-117385250 CAACTAGTGGTCTCTGCCAGAGG - Intergenic
1075567118 10:123512825-123512847 TGAGTTGAGATCTTTCCCAGGGG - Intergenic
1076788487 10:132764006-132764028 TGACTTGGGGCCCTTCCCAGAGG + Intronic
1077445077 11:2587061-2587083 GGAGGTGAGGTCTCTCCCAGAGG - Intronic
1077917312 11:6619621-6619643 TCACTTGTGGTGATTCCCAGGGG - Intergenic
1082781817 11:57293891-57293913 TGAGTTGTTGTTCCTCCCAGGGG - Intergenic
1087789138 11:102388877-102388899 TGTCTTCTGGTATCTGCCAGGGG + Intergenic
1092111186 12:5965898-5965920 AGAATTCTGGTATCTCCCAGGGG - Intronic
1095690294 12:45080939-45080961 GGCCATGTGGTCTCTTCCAGAGG + Intergenic
1096652280 12:53067783-53067805 TGGGCTGTGGTCTGTCCCAGAGG - Intronic
1101449216 12:104761157-104761179 TGACCTGTGGTATCTCAGAGGGG + Exonic
1102637933 12:114340848-114340870 TCTCCTGTGGTCTCTCCCTGTGG + Intergenic
1103991017 12:124799553-124799575 GCACTTGTGGTCTATCCCATGGG - Intronic
1109333834 13:60966812-60966834 TGACTTGGGGTTTCACACAGTGG - Intergenic
1111371963 13:87331481-87331503 TTACATTTGGTCTCTCCCACTGG + Intergenic
1111758945 13:92437142-92437164 TGACTTGCCATCTTTCCCAGAGG - Intronic
1112723972 13:102280828-102280850 TGATTTCTGGTGTTTCCCAGGGG - Intronic
1121409619 14:93740566-93740588 GGCCCTGGGGTCTCTCCCAGAGG - Intronic
1128683227 15:69666342-69666364 TGAATGGTGGACCCTCCCAGAGG - Intergenic
1129737780 15:77975543-77975565 TGCCCTGGGCTCTCTCCCAGGGG + Intergenic
1129848306 15:78778073-78778095 TGCCCTGGGCTCTCTCCCAGGGG - Intronic
1131175125 15:90204463-90204485 CGATTTGTGGCCTCGCCCAGTGG + Intronic
1132072540 15:98791488-98791510 TGACTTGTGGACTGTGTCAGAGG + Intronic
1132744527 16:1431211-1431233 GGTCTGGGGGTCTCTCCCAGGGG - Intergenic
1133540687 16:6750206-6750228 TGAATTGTGGGCTCTACCTGAGG + Intronic
1138232829 16:55351869-55351891 TGACTTGGGGCTGCTCCCAGGGG + Intergenic
1139663141 16:68435761-68435783 TGACCTGTGGCCTGTCCCTGAGG - Intronic
1141636432 16:85316519-85316541 TGATCTGAGGTCTCTCCCACTGG + Intergenic
1142514834 17:420845-420867 CGGCTTGGGGTCTCTCACAGAGG - Intronic
1143289874 17:5820512-5820534 CTTCTTGGGGTCTCTCCCAGAGG + Intronic
1150842423 17:68621313-68621335 TGACTTGAATTCTATCCCAGAGG - Intergenic
1159861441 18:73653979-73654001 TGCCTTATTGACTCTCCCAGGGG + Intergenic
1161860550 19:6794981-6795003 TTACGTGTGGTATCTCCAAGTGG + Intronic
1164557541 19:29265410-29265432 TGTAATGTGGTCTTTCCCAGAGG - Intergenic
1167750350 19:51375614-51375636 TGGCTTGTGGTGTCTGTCAGAGG - Intergenic
1168031817 19:53686102-53686124 TGGCCTGTGGTCTCTCCTGGAGG + Intergenic
934051452 2:88214698-88214720 TGACTTGGTGTCTCCTCCAGCGG - Intergenic
939006050 2:136788210-136788232 TAGCTTAAGGTCTCTCCCAGCGG - Intronic
940255541 2:151724390-151724412 TGGCTTGAGGTCTCACCCAAAGG + Intronic
943237338 2:185338893-185338915 TGCCATGTGGTCACTGCCAGTGG + Intergenic
946956491 2:224935667-224935689 TTACGTGTGGGCTCTTCCAGGGG - Intronic
947024289 2:225719194-225719216 TGCCTTGTGTTCTCATCCAGGGG + Intergenic
947537259 2:230948051-230948073 TGACTTCAGTTCTCTCCAAGAGG + Intronic
1169338594 20:4778182-4778204 GGACTTATGGTCTCTGCCAGTGG + Intergenic
1171307830 20:24121020-24121042 TGACTCGTGGTCTCTGGCTGGGG + Intergenic
1172634699 20:36402119-36402141 TGACTTGGGGGCCCTCCCACTGG - Intronic
1173693710 20:44988092-44988114 TGATTTGTGGGCTCTCCAAAAGG + Intronic
1174169754 20:48608714-48608736 TGACTTTTGTTCCCTCCCAGAGG + Intergenic
1175602000 20:60281822-60281844 TGACTTGTGGTCTATTTCACAGG - Intergenic
1176075934 20:63248223-63248245 TGGATTTTGGTCTCCCCCAGGGG - Intronic
1176266880 20:64214105-64214127 TGACTTGGGGTCTATCCCTGGGG - Intronic
1179158569 21:38873463-38873485 TGCCTTGTGGACTCACACAGAGG - Intergenic
1179437398 21:41371435-41371457 TGCCTTGAGGTCTCTTCCAGCGG + Intronic
1179568328 21:42262925-42262947 TGACTCATGGCCTCTGCCAGGGG + Intronic
1181770335 22:25120472-25120494 TCACTCCAGGTCTCTCCCAGAGG - Intronic
1185399393 22:50608122-50608144 GGCCTTGTGGACTCTCCCTGTGG + Intronic
951682091 3:25305561-25305583 TGAATTGTGGTCTTGCCCAGAGG + Intronic
953213363 3:40895875-40895897 TAACTTGTGTTCTCTTCCTGTGG - Intergenic
954835420 3:53462805-53462827 TTCCATGTGGTCTCTCCCTGTGG + Intergenic
954924305 3:54218814-54218836 TGGCTTGTGGTCTCTTCCAGCGG + Intronic
956644013 3:71438901-71438923 TGCCCTGTGGTCTCCACCAGTGG - Intronic
957339142 3:78870729-78870751 AGCCTTGTGTTCACTCCCAGAGG - Intronic
957411974 3:79853045-79853067 TGAATTGTGGTCTCACCCAGGGG + Intergenic
961571794 3:127804504-127804526 TGACCTGTGGGCTCTACCATGGG - Intronic
964637673 3:158875230-158875252 TGAGATACGGTCTCTCCCAGGGG - Intergenic
966208950 3:177433168-177433190 GGACTTATGGGGTCTCCCAGAGG + Intergenic
968586609 4:1419923-1419945 TCACTTCTGGTGTCTCCTAGAGG - Intergenic
971195262 4:24467229-24467251 TGACTTTGGGTTTCTCCTAGGGG - Intergenic
971245590 4:24924594-24924616 TTACATGTGGTCTCTCCATGTGG + Intronic
973239827 4:47945589-47945611 TGACTTATGGTGTTTCCCACTGG + Intronic
974348457 4:60713488-60713510 TGACTTTGAGTCTCTGCCAGAGG - Intergenic
974650527 4:64748646-64748668 GGTCTGCTGGTCTCTCCCAGCGG - Intergenic
976002014 4:80385845-80385867 TGCCCTGTCTTCTCTCCCAGGGG + Intronic
978606419 4:110485034-110485056 TGACTTCTGATGTCTTCCAGAGG - Intronic
981936907 4:150248857-150248879 TGACTAGAGTTCCCTCCCAGAGG + Intronic
983477388 4:168230668-168230690 TCACTTTTGCTCTGTCCCAGAGG - Intronic
983845353 4:172511598-172511620 TGACTTTTGCTGTATCCCAGAGG + Intronic
984168771 4:176335596-176335618 TGACTTGTGCTCTTTCCCTATGG - Intergenic
984883730 4:184431550-184431572 TGTCTTGAGGTCTTTTCCAGAGG - Intronic
987947549 5:24631288-24631310 TGACTTCTGGTGTTTTCCAGAGG - Intronic
987959497 5:24786894-24786916 TGAGATGTGGTGTTTCCCAGTGG + Intergenic
987981651 5:25093664-25093686 TGTCTTATGGTCTGTCACAGAGG + Intergenic
988457898 5:31403828-31403850 TAAATTGTGGTATATCCCAGGGG - Intronic
990406651 5:55497836-55497858 TGTCATGTTGGCTCTCCCAGAGG - Intronic
993943136 5:94086008-94086030 TGCCTTCTGTTCTTTCCCAGTGG - Intronic
994792973 5:104255759-104255781 TGACTTCTAGTTTCACCCAGTGG + Intergenic
997953877 5:138263438-138263460 TGATTTTTGGTATCTCCCTGTGG + Intronic
1000213346 5:159130611-159130633 TGACCAGTGGTGTCACCCAGTGG - Intergenic
1000405547 5:160884568-160884590 TGAGCTGTGGTATCTCCCACAGG - Intergenic
1000814081 5:165899057-165899079 TCAGTTGTGGTCTAACCCAGGGG + Intergenic
1002689052 5:181037593-181037615 GGACTTGTGGTGTCTCCCTCTGG + Intergenic
1004402880 6:15305048-15305070 AGACTTGTGCTGGCTCCCAGTGG - Intronic
1005008973 6:21317798-21317820 TGAGATGTGGTCTCTTCTAGGGG + Intergenic
1006621527 6:35368119-35368141 TTTCTTGTGGTCTCCCACAGTGG + Intronic
1007510438 6:42370716-42370738 TGACTTGGGGTCAATGCCAGTGG - Intronic
1011894053 6:92201793-92201815 GGTCCTGTGGTCTCACCCAGAGG + Intergenic
1018927933 6:168219718-168219740 TGACTTCTGGTCTTGCCCACTGG - Intergenic
1022597688 7:31728298-31728320 TGGCTTGTTTTCTTTCCCAGAGG - Intergenic
1024750366 7:52458251-52458273 TGACTTGCAGTTTCTCCCTGTGG + Intergenic
1025858312 7:65303699-65303721 TGTCCTGGGGACTCTCCCAGGGG + Intergenic
1026479101 7:70763367-70763389 TGACTTTTGCCCTCTCCCTGGGG + Intronic
1026664745 7:72332590-72332612 TGACTTGTGGTCTCTCCCAGGGG - Intronic
1028706561 7:93855230-93855252 TTACAAGTGGTCCCTCCCAGTGG + Intronic
1028719134 7:94009372-94009394 TGACTTGTTTTTTTTCCCAGTGG + Intergenic
1029192083 7:98779090-98779112 TGGCCTGTGAACTCTCCCAGAGG + Intergenic
1030266109 7:107623730-107623752 AGAATTTTGGTCTCTCCCAAGGG + Intronic
1032637267 7:133723417-133723439 TTACCTGTGTTCTCTGCCAGAGG - Intronic
1033468081 7:141615504-141615526 AAACTACTGGTCTCTCCCAGTGG - Exonic
1035106360 7:156444846-156444868 TGACTTTTGGTGTGTCCGAGAGG - Intergenic
1036212391 8:6852976-6852998 TAACTTGTGGTCTCCCCTTGGGG - Intergenic
1039801130 8:40955464-40955486 TGACTTGTGGAACCTCCTAGAGG - Intergenic
1041375133 8:57204766-57204788 GGACTTGGGGTCTCCCCCACTGG + Intergenic
1041924873 8:63226467-63226489 TGTCATGTGGTCTCTCCAACAGG - Intergenic
1043990383 8:86745858-86745880 TGATTTGTGGTCTTCCACAGAGG + Intergenic
1047634033 8:126740506-126740528 TGGCTTTTGCTGTCTCCCAGAGG + Intergenic
1047719892 8:127630041-127630063 TGACTTGCAGTGTCTCCCATAGG - Intergenic
1049389820 8:142361894-142361916 TGTGTTGTGGTTTCTCCCTGTGG - Intronic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1052268956 9:26606299-26606321 TTTCTTGTGGTCTCTTCCAAGGG + Intergenic
1059146691 9:111906103-111906125 TCACTTGTGATCTCTACCTGTGG + Intronic
1059967922 9:119634260-119634282 TGACTGGTAGTTTCTCTCAGAGG + Intergenic
1062268629 9:135698971-135698993 TGAGTGGTGGTGCCTCCCAGGGG - Intronic
1062351014 9:136138623-136138645 TGGCAGGTGGTCTCACCCAGTGG + Intergenic
1203363010 Un_KI270442v1:234454-234476 TGACGTGTCGTCTCTGCCATAGG - Intergenic
1186634110 X:11383539-11383561 TGGCCTGTGGTCTCTGCCATTGG + Intronic
1189630640 X:42948976-42948998 TTACCTCTGGTCTCTTCCAGGGG - Intergenic
1190784290 X:53629118-53629140 TGCCTTTTGGTTTTTCCCAGAGG - Intronic
1192264336 X:69528898-69528920 TTACTTGTGGTCTCTCAAGGGGG - Intronic
1196745863 X:119071167-119071189 TGGCTTTAGGTCTCTCCCACTGG + Intergenic
1197262671 X:124334253-124334275 TGACTTCTGCTGTCCCCCAGGGG - Intronic
1197262720 X:124334439-124334461 TGACTTCTGCTGTCCCCCAGGGG - Intronic
1197262769 X:124334625-124334647 TGACTTCTGCTGTCCCCCAGGGG - Intronic
1197949499 X:131878865-131878887 TGTCTTCTGGTCTCTCCCAAAGG + Intergenic
1199635316 X:149807462-149807484 TCTCTTGCTGTCTCTCCCAGTGG + Intergenic
1201377665 Y:13340268-13340290 TGCCTTGCGGTCTCTTCCTGTGG - Intronic