ID: 1026665220

View in Genome Browser
Species Human (GRCh38)
Location 7:72336014-72336036
Sequence GGATGGGTCTGGCGCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 262}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026665220_1026665228 12 Left 1026665220 7:72336014-72336036 CCACCTGGGCGCCAGACCCATCC 0: 1
1: 0
2: 0
3: 26
4: 262
Right 1026665228 7:72336049-72336071 CTCAGAGACTAGGTCCCAGCCGG No data
1026665220_1026665229 22 Left 1026665220 7:72336014-72336036 CCACCTGGGCGCCAGACCCATCC 0: 1
1: 0
2: 0
3: 26
4: 262
Right 1026665229 7:72336059-72336081 AGGTCCCAGCCGGACTGCAGAGG 0: 1
1: 0
2: 1
3: 11
4: 274
1026665220_1026665227 2 Left 1026665220 7:72336014-72336036 CCACCTGGGCGCCAGACCCATCC 0: 1
1: 0
2: 0
3: 26
4: 262
Right 1026665227 7:72336039-72336061 CTGCTTGGAGCTCAGAGACTAGG 0: 1
1: 0
2: 3
3: 24
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026665220 Original CRISPR GGATGGGTCTGGCGCCCAGG TGG (reversed) Intronic
900121863 1:1051678-1051700 GGATGGGCCCGGAGCCCACGAGG + Intronic
900407270 1:2498238-2498260 GGGTGGGTCTGGGTCCCTGGGGG - Intronic
900417927 1:2543552-2543574 TGATGGGGCTGGAGCCCAGTGGG - Intergenic
900522575 1:3112846-3112868 TGATGGGGCTGGAGCCCAGGCGG - Intronic
900562370 1:3313651-3313673 AGGTGGTTCTGGCCCCCAGGCGG - Intronic
900951494 1:5860477-5860499 GGATGGGTGGGCTGCCCAGGTGG + Intergenic
901676758 1:10889844-10889866 GGATGAGTCCGGGGCCCAGCGGG - Intergenic
901788700 1:11641841-11641863 GGAGGGGGCTGGCACCAAGGAGG - Intergenic
902288425 1:15421479-15421501 GGCAGGCTCTGGCCCCCAGGGGG - Intronic
903669916 1:25029248-25029270 GGAAGGGTTTGGCGCCAAGTCGG - Intergenic
904696936 1:32336120-32336142 GGGTGGGGCTGGCGCCCGAGGGG + Exonic
905276967 1:36824686-36824708 GGCTGGGGCTGGAGCCCAGAGGG + Intronic
905287154 1:36889018-36889040 GCATGGGCCTGGCACGCAGGAGG - Intronic
906325529 1:44843186-44843208 GAATGGGTCCCGCGCGCAGGCGG + Intergenic
906368481 1:45231712-45231734 GTCTTGGTCTGTCGCCCAGGCGG - Intronic
906376219 1:45298928-45298950 GGGTAGGTCTGGGGCCAAGGTGG + Intronic
906636547 1:47414213-47414235 GGATGGATCTGGGACCCATGTGG + Intergenic
907108937 1:51909002-51909024 GGCTGGGGCTGGGGCCCAGGAGG - Exonic
908740131 1:67318771-67318793 GGATGAGACTGGAGCTCAGGGGG + Intronic
909943223 1:81634622-81634644 GGCTGGGACTGGAACCCAGGAGG - Intronic
910717962 1:90253074-90253096 GTCTGGCTCTGTCGCCCAGGCGG - Intergenic
912516609 1:110220334-110220356 GGATGTGGCTGGTGCCCACGGGG + Intronic
913211982 1:116589674-116589696 GGAAGGGTATGGAGCCCAGGGGG - Intronic
913442168 1:118909505-118909527 GGATGGGGCTGGAAGCCAGGAGG + Intronic
917789588 1:178491029-178491051 GGATGGGCCTGGTGGACAGGAGG + Intergenic
920246934 1:204595209-204595231 GTCTGGCTCTGTCGCCCAGGTGG + Intergenic
922416439 1:225427463-225427485 GGAAGGGTCTGCGGCCGAGGTGG - Intronic
922440837 1:225653579-225653601 CTACGGGTCTGGCGCCCAGGAGG - Intergenic
1065488209 10:26255045-26255067 GTATGGGCCTGGAGCTCAGGAGG + Intronic
1065618871 10:27558014-27558036 GTATCGCTCTGTCGCCCAGGCGG - Intergenic
1066125614 10:32338846-32338868 GGAGGAGCCTGGAGCCCAGGAGG + Intronic
1068953612 10:62802986-62803008 GTCTGGGTCTGTTGCCCAGGCGG - Intergenic
1068984815 10:63097796-63097818 AGATGGGACTTGAGCCCAGGAGG - Intergenic
1069720750 10:70547939-70547961 GGCTGGGGCTGGCTCCCAGATGG + Intronic
1070016037 10:72532452-72532474 GCATGGGCCTGGCACACAGGAGG - Intronic
1070045759 10:72834689-72834711 GCCTTGGTCTGTCGCCCAGGTGG + Intronic
1070923110 10:80201441-80201463 TGGTGGGTCTGGGGCTCAGGAGG - Intronic
1072741289 10:97911542-97911564 TGCTGGGGCTGGCACCCAGGAGG - Intronic
1074632647 10:115275233-115275255 GGATGGGTTTGGGACCCAGTGGG + Intronic
1074979729 10:118609902-118609924 TGCTGAGTCTGGCACCCAGGTGG + Intergenic
1075091766 10:119447719-119447741 GGAAGGGGCTTGCACCCAGGAGG + Intronic
1075201506 10:120408534-120408556 GGCTGGGGCTGGTGCCCATGGGG - Intergenic
1075414089 10:122249673-122249695 GGAGGGGTGTGGCCTCCAGGTGG + Intronic
1075519761 10:123136480-123136502 GGACGGGGCGGGCGCGCAGGGGG - Intronic
1075626652 10:123968821-123968843 GGGTGAGTCTGGAGCACAGGAGG - Intergenic
1076065104 10:127442326-127442348 GGCTGGGTCTGGGGGCCTGGTGG - Intronic
1076350108 10:129809843-129809865 GGAGGGCTCTGGAGCCAAGGAGG - Intergenic
1076810553 10:132884370-132884392 GGATTGTTCTGGGGTCCAGGGGG - Intronic
1077076857 11:706006-706028 GGCTGGGGCTGGAGCCCAGGCGG + Intronic
1077181286 11:1218358-1218380 GGCTGGGGCTGGGGCACAGGGGG - Intergenic
1077465722 11:2732867-2732889 AGATGGGGCTGGGGCCCATGGGG - Intronic
1078147998 11:8735349-8735371 GGCTGGGTCTGGGTCCAAGGTGG - Intronic
1078468363 11:11567595-11567617 GGCTGGGTTTGGGGCCCAGAGGG - Intronic
1078772228 11:14361272-14361294 AGACGGCTCTGTCGCCCAGGCGG - Intronic
1080283842 11:30586205-30586227 GGCTGGGGCTGGGGGCCAGGGGG + Intronic
1080568201 11:33531767-33531789 GGAAGGGTTTGGCGCCTAAGTGG + Intergenic
1081778229 11:45691685-45691707 GGATGGGGCTGGGTCACAGGTGG - Intergenic
1081994500 11:47354994-47355016 GGTGGGGTCTGACGCCCAGCTGG + Exonic
1082005004 11:47414532-47414554 GCATGGGTGTGGAGCTCAGGAGG + Intronic
1082998592 11:59272161-59272183 GGATGTGCCTGGTGCCCAGTAGG + Intergenic
1083859461 11:65412146-65412168 GTGTGGGTCTGGAGGCCAGGTGG - Exonic
1084636921 11:70398825-70398847 GGACGGGTCTGGGCCCAAGGAGG + Intronic
1084666549 11:70579506-70579528 GGATGAGGCTGGGCCCCAGGTGG + Intronic
1084666567 11:70579575-70579597 GGATGGAGCTGGGCCCCAGGTGG + Intronic
1089055894 11:115584516-115584538 GGTTGGGGCTGGAGGCCAGGGGG + Intergenic
1089079182 11:115761740-115761762 AGATGGGACTGGAGCTCAGGGGG - Intergenic
1091713620 12:2760495-2760517 GGGAGGGTCTGGAGCTCAGGAGG + Intergenic
1096235816 12:49925692-49925714 GGATGGGTCTAGGGCCTTGGAGG + Intergenic
1098988641 12:77040681-77040703 GGATGGGAGTGGGGACCAGGAGG + Intronic
1101397064 12:104357574-104357596 AGGTGGGTCTGGGGCTCAGGAGG + Intergenic
1103893016 12:124254107-124254129 GGATGGGACTGGCCTCCACGTGG + Intronic
1104001438 12:124863303-124863325 GGGCGGGTCAGGCGCCCGGGTGG + Intronic
1105215228 13:18280300-18280322 GGAAGGGTATGGAGCCCAGGGGG - Intergenic
1105811730 13:24001623-24001645 GGATGAGTGTGGTGCCCTGGTGG - Intronic
1106182046 13:27377937-27377959 GGCTGAGGCTGGAGCCCAGGAGG + Intergenic
1106405622 13:29470521-29470543 GAATGTGTTTGGAGCCCAGGTGG - Intronic
1106891339 13:34249081-34249103 TGATGGGTCTGGGGCCCTAGAGG + Intergenic
1107349601 13:39500292-39500314 GGAAGGATCTTGAGCCCAGGAGG - Intronic
1110467467 13:75818512-75818534 GGCTGGTTCTGACACCCAGGGGG - Intronic
1116892893 14:50286037-50286059 GGCTGTGTCTGTCACCCAGGAGG + Intronic
1119380103 14:74223136-74223158 GAATGGGCCTGGGGCCGAGGAGG - Intergenic
1121020881 14:90579325-90579347 GGAAGGGTCTGGCCTGCAGGTGG - Intronic
1121638538 14:95470076-95470098 GGATGTGGCAGGGGCCCAGGGGG + Intronic
1122060504 14:99133891-99133913 GGATGGGTCTGGCTGGGAGGCGG - Intergenic
1122269503 14:100562236-100562258 GGATGGGGCTGGCCACCTGGCGG - Intronic
1122386635 14:101352814-101352836 GGATGGCTCTGGAGCACAGGTGG - Intergenic
1122403020 14:101478672-101478694 GGGTGGGTGTGGGGGCCAGGCGG - Intergenic
1122447600 14:101781222-101781244 GGTGGTGTCTGGTGCCCAGGAGG + Intronic
1122921056 14:104880321-104880343 TGAAGGGTTTGGCGCCCAAGAGG + Exonic
1124438622 15:29671212-29671234 GGAAGGGTCCGGAGCCCAGGAGG - Intergenic
1125929387 15:43589757-43589779 GGGTGGGGCTGGAGTCCAGGAGG - Intronic
1125942554 15:43689589-43689611 GGGTGGGGCTGGAGTCCAGGAGG - Intergenic
1128309420 15:66621209-66621231 GGAAGGGTCTGGCACACAGCAGG + Intronic
1129703771 15:77782999-77783021 GGCTGTGTCTGGAGACCAGGAGG - Intronic
1129955303 15:79630913-79630935 GGTTGGGTCTGGGACCCTGGGGG + Intergenic
1130906235 15:88242631-88242653 GCATGGGTCTGGCCCACAGCTGG + Intronic
1132556842 16:576303-576325 GGAAGGCTCTGCTGCCCAGGAGG - Intronic
1133028801 16:3000125-3000147 ACATGGGTCGGGGGCCCAGGAGG - Intergenic
1133285354 16:4688228-4688250 AGATGGGTCTGGCGTCCCTGGGG - Intronic
1134089684 16:11384867-11384889 CGGTGGGTCTGGGCCCCAGGAGG - Exonic
1134438931 16:14286042-14286064 GGCTGGGTCTGCAGTCCAGGGGG - Intergenic
1136518498 16:30782023-30782045 GGTAGGGTCTGGCCCCCAGGGGG + Exonic
1138529880 16:57629263-57629285 GGAGGGGACTGGGGCCCAAGGGG + Intronic
1139504802 16:67393489-67393511 GGGTGGGACTGCAGCCCAGGCGG + Intronic
1139506474 16:67400427-67400449 GGAGGAGTCTGAGGCCCAGGGGG - Intronic
1139522199 16:67490220-67490242 GTCTGGCTCTGTCGCCCAGGTGG + Intergenic
1139636919 16:68263769-68263791 GGAGGGCTCAGGCGCCCATGAGG + Intergenic
1140477741 16:75247408-75247430 GGGTGGATATGGTGCCCAGGCGG - Intronic
1141656324 16:85418566-85418588 GGCTGGGTCTGGCTCCTGGGAGG - Intergenic
1141700371 16:85639487-85639509 GGCTAGGCCTGGCGCCCAGGAGG - Intronic
1141951863 16:87344850-87344872 GGATGGGTTTTGCCCCCAGGTGG - Intronic
1142077622 16:88129312-88129334 GGCGGGGTCTGGCGGGCAGGAGG + Intergenic
1143078665 17:4366031-4366053 GACTGGGCCTGGCGCCCGGGGGG - Intronic
1144658330 17:17052214-17052236 GGATGAGTCTGGAGCCAGGGTGG - Intronic
1145279186 17:21455819-21455841 GAATGGGTCTGGAGACCTGGGGG + Intergenic
1145398671 17:22514628-22514650 GAATGGGTCTGGAGACCTGGGGG - Intergenic
1146063266 17:29617959-29617981 GGCTGTGGCTGGCGCCCAAGAGG - Intronic
1148225644 17:45896366-45896388 GGATGGGTGGGGAGCCCTGGCGG + Intronic
1148460958 17:47838755-47838777 GGAGGGGGCTGGGGGCCAGGAGG - Intronic
1148625676 17:49067287-49067309 GCATGGGTCAGGCTTCCAGGTGG - Intergenic
1149633076 17:58142721-58142743 GGATGGGGCGGCCGGCCAGGCGG - Intergenic
1149995827 17:61405524-61405546 GCAGGTGTCCGGCGCCCAGGGGG - Exonic
1150246065 17:63676284-63676306 GGATGGGACTAGCTCACAGGAGG - Intronic
1150473956 17:65460262-65460284 GGAAAGCTCTGGAGCCCAGGTGG + Intergenic
1151535631 17:74737396-74737418 GGAAGGGGCTAGCGCCGAGGAGG - Intronic
1152228499 17:79103450-79103472 GGAGGGGTATGGGCCCCAGGGGG + Intronic
1152298533 17:79482420-79482442 GGATGGGCATGGCGGACAGGTGG + Intronic
1152636547 17:81432740-81432762 GGGTGGGTCTGGGGCTCGGGGGG - Intronic
1153248904 18:3100731-3100753 GGAAGTGTCTGGCTCCCAGCAGG - Intronic
1153350638 18:4077567-4077589 GGGTGGGTCAGGCGGGCAGGAGG - Intronic
1154026370 18:10710734-10710756 GGAAGGGTCTGGTGGCCAGGAGG - Intronic
1154502453 18:15003571-15003593 GGATGTGACTGAGGCCCAGGAGG - Intergenic
1160918207 19:1507587-1507609 GGATGTGTCTGGCGCCCTCGGGG + Exonic
1160963437 19:1734946-1734968 GGATGGGGCAGGGGCCCAGGAGG + Intergenic
1161119678 19:2518459-2518481 GGAGGGGTCTGCCTCCCACGAGG - Intronic
1161153934 19:2722658-2722680 GAAGGGGTCTGGAGGCCAGGAGG - Intronic
1161165686 19:2785905-2785927 GGATGGGTCGGGCCCCGTGGCGG + Intronic
1161400535 19:4065047-4065069 GGCTGGGTCTCCCGCCCGGGAGG + Intronic
1161948239 19:7452251-7452273 GGATGTGTCTGGAGCCAGGGAGG + Intronic
1162301189 19:9846112-9846134 GGATGTGTCTGGCACAGAGGAGG + Intronic
1162727653 19:12699815-12699837 TGGAGGGTCTGGCGCCCAGGAGG + Exonic
1163125276 19:15241094-15241116 GGATGGGCCTGGCCACCATGTGG - Intronic
1163257031 19:16162334-16162356 GGATTGCTCTTGAGCCCAGGAGG + Intronic
1163302761 19:16458092-16458114 GGATGGGTCTGGCCTCCTGTCGG + Intronic
1164840263 19:31387875-31387897 GGCTGGGCCTGTCTCCCAGGAGG - Intergenic
1165423992 19:35735735-35735757 GAATGGGTTTGGCGTGCAGGTGG - Intronic
1166198161 19:41219857-41219879 GGAGGGCTCTGGAGCCCTGGGGG + Intronic
1166738879 19:45102364-45102386 AGCTGGGACTGGCACCCAGGGGG - Intronic
1167160009 19:47761168-47761190 GGCTGAGGCTGGAGCCCAGGAGG + Intergenic
1168120937 19:54252259-54252281 GGGGGGGTCTGGGGCCAAGGGGG - Intronic
1168455041 19:56500254-56500276 GGAGAGGTCTGGGGCTCAGGAGG - Intergenic
927564980 2:24104254-24104276 GGGTGGGTGTGGGGCCCAGTGGG - Intronic
932024463 2:68119587-68119609 GGATGGGCCTGTCGTCCAGAGGG - Intergenic
932685243 2:73863632-73863654 GGGTGGGTCTGGGGGCCAGCTGG + Exonic
932753940 2:74391894-74391916 GGAAGGGTCTGGCGGCGAGTCGG - Intronic
934299092 2:91766437-91766459 GGAAGGGTATGGAGCCCAGGGGG + Intergenic
934550767 2:95260251-95260273 GTGTGTGTTTGGCGCCCAGGAGG - Intergenic
934769779 2:96900382-96900404 GGAAGGGACAGGCACCCAGGTGG - Intronic
936154927 2:110041252-110041274 GGATGGCTCTGGCCCCCATCGGG + Intergenic
936189755 2:110330162-110330184 GGATGGCTCTGGCCCCCATCGGG - Intergenic
938501628 2:131833743-131833765 GGATGTGACTGAGGCCCAGGAGG - Intergenic
939496034 2:142929644-142929666 GGAGGGGACAGGCGCACAGGTGG + Intronic
942221628 2:173774711-173774733 GGATGTGTCTGGCACCCACGTGG - Intergenic
945884642 2:215362558-215362580 AGTTGGGCCTGCCGCCCAGGAGG + Intronic
946331163 2:219009892-219009914 GGATGGGTCTGGAGCTCTGATGG + Intronic
1169076235 20:2761196-2761218 GGATGGGTCAGGTGCCATGGTGG + Intergenic
1171011787 20:21513052-21513074 GGACTGGCCTGGCGCCCTGGAGG - Intronic
1171126876 20:22610293-22610315 GAAGAGGTCTGGAGCCCAGGGGG - Intergenic
1172441951 20:34972031-34972053 GGATGGGTCTGGCATGGAGGTGG - Intergenic
1172776966 20:37413524-37413546 TGATGGGTGTGGGGCCCAGGAGG - Intergenic
1172867743 20:38112922-38112944 AGATGGGGATGGCACCCAGGAGG - Intronic
1173504322 20:43575045-43575067 GGATGGGTCTGTCTCTCATGTGG + Intronic
1174407298 20:50310612-50310634 GCCTGGTTCTGGCGCCCAAGTGG + Intergenic
1175966845 20:62664206-62664228 GCATGGGCCTGGAGCCCTGGGGG - Intronic
1176100284 20:63361494-63361516 GGATGGACCGCGCGCCCAGGGGG + Intronic
1176376363 21:6088709-6088731 GGATAGGACAGCCGCCCAGGGGG - Intergenic
1176869231 21:14073012-14073034 GGGTGCGTGTGGCGCCCACGGGG - Intergenic
1179474199 21:41632944-41632966 AGCTGGGCCTGGTGCCCAGGTGG - Intergenic
1179747112 21:43449535-43449557 GGATAGGACAGCCGCCCAGGGGG + Intergenic
1179904269 21:44414085-44414107 GGGTGGGGCTGGCGTGCAGGTGG + Intronic
1180105239 21:45614098-45614120 GGGTGGGTCTGGCTCTCAGCTGG - Intergenic
1180964465 22:19779201-19779223 GGATGGGGTTGTCACCCAGGTGG + Intronic
1181780616 22:25190456-25190478 GTATCGGTCTGTGGCCCAGGGGG + Intronic
1182503052 22:30762586-30762608 GGATGGGTCTAGAGCGCAAGAGG - Intronic
1183897011 22:40977548-40977570 GTCTGGCTCTGTCGCCCAGGAGG + Intergenic
1184609077 22:45590925-45590947 GTTTGGGTCGGGGGCCCAGGAGG + Intronic
1185068522 22:48643842-48643864 GGAAGGGTCTGGGGTCAAGGTGG + Intronic
1185116910 22:48943013-48943035 AAATGGGTCTGGGGCCCGGGAGG + Intergenic
1185320268 22:50197475-50197497 GGATGGGTCGGTCACCCAGGTGG - Exonic
950565476 3:13767336-13767358 GGGTGGGACTGGCCCCCAGGAGG - Intergenic
950574625 3:13824629-13824651 GCATGGGCCTGGGGGCCAGGAGG - Intronic
951519742 3:23600226-23600248 GGAAGGGTCTGGAACCCAGGGGG - Intergenic
954368252 3:50157212-50157234 GGATGGGACAGGGGGCCAGGTGG - Intronic
954634665 3:52065016-52065038 GGAAGGGCCTGGAGCCCAGGTGG + Intergenic
954912497 3:54121735-54121757 GCCTGGGTCGGGCGCGCAGGGGG + Intergenic
955450259 3:59058546-59058568 GGATGGAACTGGAACCCAGGAGG + Intergenic
955563861 3:60223364-60223386 GAATGGATCTGGTGCCCAGATGG - Intronic
958668443 3:97170706-97170728 GGCTCGCTCTGTCGCCCAGGTGG - Intronic
959541842 3:107549047-107549069 GGATGGTCCTGTCACCCAGGTGG - Intronic
961144847 3:124585015-124585037 GGATGGGGCTGGGGATCAGGAGG + Intronic
961503990 3:127358119-127358141 GGAGGGGGCTGGTGCCCAGGTGG - Intergenic
961811901 3:129526898-129526920 GTAGGGGGCTGGAGCCCAGGTGG + Intergenic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967645833 3:191922518-191922540 GGATGGGGTGGGCTCCCAGGTGG + Intergenic
968084097 3:195866978-195867000 GGCTGGGTCTGCGGCCCAGAGGG - Exonic
968658435 4:1788539-1788561 GGCTGGGGCAGGAGCCCAGGGGG + Intergenic
968959408 4:3735320-3735342 GGATGGGCCTGGAGCTCTGGAGG + Intergenic
969350628 4:6596176-6596198 GGGTGGGCGTGGCGTCCAGGTGG + Intronic
969480530 4:7444691-7444713 GGATGGATCTGGGGCCAGGGTGG + Intronic
969518001 4:7659312-7659334 TGTTGGGCCTGGCTCCCAGGAGG - Intronic
972939816 4:44182181-44182203 GGACGGGTCGGCCGGCCAGGCGG - Intronic
981873289 4:149511959-149511981 GGATGTATCTGGCGCAAAGGAGG - Intergenic
982830590 4:160054512-160054534 GTCTCGGTCTGTCGCCCAGGCGG - Intergenic
983132487 4:164038462-164038484 GTCTGGCTCTGTCGCCCAGGCGG - Intronic
984735590 4:183104933-183104955 AGTTGGCTCTGTCGCCCAGGCGG + Intronic
986180592 5:5389677-5389699 GGATGTTTCTGGCACCCAGTGGG + Intergenic
989187265 5:38637516-38637538 GTCTGGCTCTGTCGCCCAGGTGG - Intergenic
990788594 5:59451424-59451446 GTATGTGTCTGGAGCTCAGGAGG - Intronic
992782557 5:80141479-80141501 GGCTGGGTCTGGCTGCCAGCTGG - Exonic
994366979 5:98928373-98928395 GTACGGGCCTGGCGCGCAGGGGG - Intronic
997323774 5:133002746-133002768 GGCTCGTTCTGTCGCCCAGGTGG + Intronic
997662787 5:135602369-135602391 GGATGGACCTGGCTTCCAGGAGG + Intergenic
998874234 5:146583245-146583267 GGATGTGTCTGGGTGCCAGGAGG - Intronic
1000545737 5:162599310-162599332 GGATGTGGCTTGAGCCCAGGAGG - Intergenic
1002423943 5:179164972-179164994 GGACAGGTCTGCGGCCCAGGAGG + Intronic
1002538927 5:179893529-179893551 GGATGGGTCTGGGGTACAGATGG - Intronic
1002539331 5:179895587-179895609 GGCTGGCTCTGTGGCCCAGGGGG - Intronic
1004240637 6:13918059-13918081 GGATGGGACAGGGGCCAAGGTGG - Intergenic
1004659176 6:17694689-17694711 GGATGGGGCTGGGGCCACGGTGG + Intronic
1005504399 6:26457493-26457515 GGTTGGGCCTGGAGCGCAGGAGG - Intergenic
1006010753 6:31041114-31041136 GGAAGGGCCGGGAGCCCAGGTGG - Intergenic
1006596018 6:35192863-35192885 GGATGGGACTGGAGGCCAGGAGG - Intergenic
1007076969 6:39074293-39074315 GGATGTGCCTGGAGCCCAGCTGG + Intronic
1007210000 6:40185759-40185781 AGAAGGGGCTGGAGCCCAGGAGG + Intergenic
1007835201 6:44668575-44668597 AGATGTTTCTGGGGCCCAGGAGG - Intergenic
1014045260 6:116877253-116877275 GGAGGTGTCCGGCGGCCAGGAGG + Exonic
1016714991 6:147215408-147215430 GTCTGGCTCTGTCGCCCAGGTGG + Intronic
1018467064 6:164057711-164057733 GGATGGTTCTGTCGTGCAGGAGG - Intergenic
1019557514 7:1640050-1640072 GAAGGGGTCTGGCACCCAGCAGG + Intergenic
1019791534 7:3017191-3017213 GGATGGGCATGGCGGCCAGTGGG + Intronic
1019992614 7:4702890-4702912 GGCTGGGTCTGTCACCCAGAGGG - Intronic
1020006306 7:4785288-4785310 GGGTGGGACAGGCCCCCAGGAGG - Intronic
1020083731 7:5299520-5299542 GGATGCATGTGGCTCCCAGGTGG + Intronic
1023350238 7:39313211-39313233 TGATGGGTCTGGGGATCAGGAGG - Intronic
1024144042 7:46492994-46493016 GGATAGGTCGGGCTCTCAGGTGG + Intergenic
1024590057 7:50873098-50873120 GGATAGGTCTGGCGCCCTTTTGG + Intergenic
1025210546 7:57017665-57017687 GGATGCATGTGGCTCCCAGGTGG - Intergenic
1025661412 7:63559182-63559204 GGATGCATGTGGCTCCCAGGTGG + Intergenic
1026509495 7:71016391-71016413 TGATGAGGCTGGCGGCCAGGTGG - Intergenic
1026621267 7:71951953-71951975 GGTTGGGTCTGACTCCCAGGAGG - Intronic
1026665220 7:72336014-72336036 GGATGGGTCTGGCGCCCAGGTGG - Intronic
1026841064 7:73670117-73670139 GGCTGGGGCTGGGGGCCAGGAGG + Intronic
1029661943 7:101968310-101968332 GGTTGAGTCTGGGGTCCAGGTGG + Intronic
1032495530 7:132359006-132359028 GTCTGGGTCTAGAGCCCAGGTGG - Intronic
1034180621 7:149134757-149134779 GTCTGGCTCTGTCGCCCAGGCGG + Intronic
1034550677 7:151818707-151818729 GGCTGGGCCTTGAGCCCAGGGGG - Intronic
1035459948 7:159032399-159032421 GGATGGGCCGGGCTCCCAGGCGG - Intronic
1035495925 7:159326066-159326088 GGATGCATCAGGCCCCCAGGAGG - Intergenic
1035748228 8:1976808-1976830 GGGTGGCTCAGGAGCCCAGGAGG + Intronic
1036033249 8:4994126-4994148 GGGTGGGGCGGGGGCCCAGGAGG + Intronic
1036565978 8:9938364-9938386 GGTTAGGTCTGGCCCACAGGAGG + Intergenic
1038416575 8:27400796-27400818 GCGTGGGTCTGGAGCTCAGGAGG + Intronic
1038648293 8:29379619-29379641 AGATGGGCCTTGGGCCCAGGAGG - Intergenic
1040718853 8:50292563-50292585 GACTGTGTCTGGCGCCCAGATGG + Intronic
1043301993 8:78744918-78744940 GGCTGGGTGTCGTGCCCAGGTGG + Intronic
1045112444 8:98948029-98948051 AGATGGTTCAGGCTCCCAGGGGG - Intronic
1045359851 8:101422806-101422828 GTCTGGATCTGTCGCCCAGGTGG - Intergenic
1047116283 8:121845023-121845045 GTCTGGCTCTGTCGCCCAGGTGG + Intergenic
1048282657 8:133116500-133116522 GGGTGGGTTGGGGGCCCAGGGGG + Intronic
1049531800 8:143158979-143159001 GGATGGGTGGGGGGCGCAGGGGG - Intronic
1049680009 8:143913898-143913920 GCATGGGTCTGGGGACCAAGGGG + Intergenic
1051184262 9:14442124-14442146 GGCTGGGACTGGAGCCTAGGAGG + Intergenic
1055593654 9:77843886-77843908 GGATGGGTCTGTGGCTCAGAGGG + Intronic
1056381079 9:86057758-86057780 GGATGTGACTGAGGCCCAGGAGG - Intronic
1057214621 9:93220954-93220976 GGATGGGTGGGCAGCCCAGGAGG - Intronic
1059792509 9:117655476-117655498 GGATGTGTCTGGCAAGCAGGTGG - Intergenic
1060419512 9:123457750-123457772 GCCTGGGTCTGGCTCCCTGGCGG - Intronic
1061092100 9:128432411-128432433 GTATTGCTCTGGCACCCAGGCGG + Intronic
1061793480 9:133070902-133070924 GGATGGCTCAGGCGTGCAGGTGG + Intronic
1061992897 9:134169878-134169900 GGATGGTGCTGGCGGCCGGGAGG - Intergenic
1062033672 9:134373188-134373210 GGAAGTGTCTGGGGCCCGGGTGG + Intronic
1062122791 9:134842601-134842623 GGATGGGTCGGGCGAGCTGGGGG - Exonic
1062375171 9:136258882-136258904 GGAAGTGTCTGGCGCCGTGGAGG + Intergenic
1062498045 9:136840806-136840828 GGATGTGACTGAGGCCCAGGAGG + Exonic
1062589523 9:137267130-137267152 GGATGGCACTGTTGCCCAGGGGG + Intronic
1203376704 Un_KI270442v1:382786-382808 GGAGGCCTCTGGCGCCTAGGCGG + Intergenic
1187938809 X:24362226-24362248 GGGTGAGCCTTGCGCCCAGGAGG + Intergenic
1195254298 X:103078216-103078238 GGAAGGATCTTGAGCCCAGGAGG - Intronic
1197774593 X:130110922-130110944 GGATGGGGCGGGCGCGAAGGAGG + Intergenic