ID: 1026670211

View in Genome Browser
Species Human (GRCh38)
Location 7:72383651-72383673
Sequence TTCCCAGAACACTTCCTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026670211_1026670215 -9 Left 1026670211 7:72383651-72383673 CCTCTAAGGAAGTGTTCTGGGAA 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1026670215 7:72383665-72383687 TTCTGGGAAGGGACAGAGCAGGG No data
1026670211_1026670214 -10 Left 1026670211 7:72383651-72383673 CCTCTAAGGAAGTGTTCTGGGAA 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1026670214 7:72383664-72383686 GTTCTGGGAAGGGACAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026670211 Original CRISPR TTCCCAGAACACTTCCTTAG AGG (reversed) Intronic
901697406 1:11018901-11018923 TTGCCAACAAACTTCCTTAGAGG + Intronic
902521423 1:17019669-17019691 TTTCCACAACACTTTTTTAGGGG - Intronic
905034494 1:34908721-34908743 TTCCTAGAAATCTTCCATAGAGG + Intronic
905126294 1:35718359-35718381 TTCCCACAAGCCTTGCTTAGAGG - Intronic
905470829 1:38190506-38190528 TACCCAGCACACTTCCACAGGGG + Intergenic
905563140 1:38942741-38942763 TTTCCAGAACACTTCCACACAGG - Intergenic
912678732 1:111713528-111713550 TTCACATAACACTTCATTGGTGG - Exonic
915190793 1:154148835-154148857 ATCCTGGAACACTTCCTTAGTGG - Intronic
916479114 1:165199377-165199399 TTCCCAGAACCCTCCCCTGGAGG + Intergenic
917716270 1:177741034-177741056 TTCCCAGAAACCTTCATTGGAGG - Intergenic
918333616 1:183485404-183485426 TTGCCAAAAAACTTACTTAGGGG + Intronic
918384462 1:183991652-183991674 TTCCCATATCACTTCATTTGTGG + Intronic
918480822 1:184974741-184974763 TTCCCAGCTCACATCCTTCGAGG + Intergenic
919057939 1:192593829-192593851 TTCCCAAAACAGTTGCTTTGGGG + Intergenic
920730421 1:208478333-208478355 TTCCCTGAACATTTCCTCGGAGG - Intergenic
921322815 1:213959564-213959586 TTCTTAGAACACTTGCTTTGAGG + Intergenic
922594711 1:226804682-226804704 TTCCCAGAATACTTCAACAGTGG - Intergenic
924005602 1:239606949-239606971 AAGCCAGAACACATCCTTAGAGG - Intronic
924059927 1:240162718-240162740 TTTCCAGAAGACTTCTTTGGAGG + Intronic
924678619 1:246207003-246207025 TTCCCTAAACATTTCATTAGTGG + Intronic
1062838923 10:654598-654620 TTCACAGAACACTACCAAAGAGG + Intronic
1069150853 10:64957714-64957736 TTTCCAGAAAGCTTGCTTAGAGG - Intergenic
1069688027 10:70331629-70331651 GTCCCAGAAGACTGCATTAGGGG + Intronic
1072905860 10:99453020-99453042 TGAACAGAACACATCCTTAGAGG - Intergenic
1075297410 10:121290520-121290542 TTCTCAGAACAATGCCTTAGGGG - Intergenic
1082614612 11:55343498-55343520 TTCATAGAACACTTACTTGGTGG + Exonic
1085389424 11:76175001-76175023 TCCCCAGAGCCCCTCCTTAGTGG - Intergenic
1086384508 11:86293437-86293459 CTCCCAGAACACTTCCTTTCAGG + Intergenic
1087597001 11:100266894-100266916 TGCCTAGAACACTTCCTAAAAGG - Intronic
1087933399 11:104003799-104003821 TTCTCAGGACACTTCTTGAGAGG - Intronic
1088756669 11:112890731-112890753 CTCCCAGAAAACTTCCTTTGGGG + Intergenic
1089880499 11:121768784-121768806 TCCACAGAAAACTTCATTAGGGG - Intergenic
1089962780 11:122630553-122630575 TTGCCTGCACATTTCCTTAGAGG - Intergenic
1092255124 12:6922694-6922716 ATCCCTGACCACTTCCTTTGTGG + Intronic
1093487583 12:19668021-19668043 TTCACAGAACACTTTTTGAGTGG - Intronic
1095393093 12:41732230-41732252 ATCCCTGAACATTTCCTTCGAGG + Intergenic
1098361443 12:69658088-69658110 TTCCCAGAACACATCCAGAGTGG - Intronic
1102205219 12:111085655-111085677 GTCCCGGAACACTTCTCTAGGGG - Intronic
1104281457 12:127381691-127381713 TTCCCAGAACAATTATTTTGAGG - Intergenic
1108715789 13:53076682-53076704 TGGCCAGAAGACTTCCTGAGGGG + Intergenic
1110375073 13:74784003-74784025 TTCTCAGAAAACTCCCTTGGAGG + Intergenic
1112679563 13:101747359-101747381 TTCCCAGTAAACTTCCTTGAGGG - Intronic
1114886356 14:26856794-26856816 TTCCTAAAACAATTTCTTAGGGG + Intergenic
1116267426 14:42711635-42711657 TTTCCAGAACACTTCAATACTGG + Intergenic
1116945658 14:50832716-50832738 TTACCAGAATACTTACATAGAGG + Intergenic
1117233766 14:53749998-53750020 TTACCAGAACACAAACTTAGAGG + Intergenic
1124349056 15:28942414-28942436 TTCCCAACACAGTTCCTTATGGG - Intronic
1124363989 15:29058915-29058937 TTCCCAAAACACGCTCTTAGAGG + Intronic
1125925835 15:43562383-43562405 TGCCCTGCACACTTCCTCAGGGG - Intronic
1125938979 15:43661934-43661956 TGCCCTGCACACTTCCTCAGGGG - Intronic
1126645432 15:50870607-50870629 TTCCTATAAATCTTCCTTAGAGG + Intergenic
1126719521 15:51562576-51562598 TTCCCAGAATACCTCCTATGTGG + Intronic
1127657008 15:61065108-61065130 TTCCAGGAAGACTTCCTTAAAGG + Intronic
1127983241 15:64049499-64049521 TACCCAGAACTCATCCTCAGAGG - Intronic
1131540444 15:93270932-93270954 TTCCCAGGGGACTTCATTAGTGG - Intergenic
1131786131 15:95912887-95912909 TTTCCAGAAAAATTCATTAGAGG - Intergenic
1132554219 16:565583-565605 AGGCCAGGACACTTCCTTAGGGG - Intergenic
1132784505 16:1648282-1648304 TTTCCAGAGCACTTCATTGGAGG + Intronic
1141867997 16:86763982-86764004 GTCCCAGAAGCCTTCCTGAGAGG + Intergenic
1147977967 17:44258778-44258800 TCCCCAGAGCTCTTTCTTAGTGG - Intronic
1151185272 17:72359574-72359596 CTCCCAGCACACTTGCTTTGGGG - Intergenic
1151804446 17:76396874-76396896 TCCCCAGAGCTCCTCCTTAGTGG - Intronic
1153011410 18:543009-543031 TCCCCTTAAAACTTCCTTAGAGG + Intergenic
1154463868 18:14623494-14623516 TTCCCAGCACAGTGCCTTTGTGG - Intergenic
1155239898 18:23855083-23855105 TGCCCAGATCACTTGCTCAGGGG + Intronic
1155644691 18:28063414-28063436 TTCACAGAACAATTCCTCAAAGG - Intronic
1156891955 18:42200760-42200782 TTCACAAAAATCTTCCTTAGAGG + Intergenic
1157585276 18:48797095-48797117 TTCCCAGAGCACTACCCTATAGG + Intronic
1159686863 18:71432968-71432990 TTCTGAGAAAACTTCCTGAGGGG + Intergenic
1159946193 18:74446445-74446467 CTACCAGAACACTTCCTTCCGGG - Intronic
1163682053 19:18688390-18688412 TTCCCAGACCCCTCCCTCAGGGG - Intronic
1164827047 19:31291403-31291425 TTCCCAGCACTCTTCATGAGGGG + Intronic
1166388609 19:42396539-42396561 TACCCAGAACACTTGCCTGGGGG + Intergenic
1166799425 19:45447045-45447067 GGCCCAGGACACTTGCTTAGAGG + Intronic
1166814438 19:45534193-45534215 TTCGCAGAAAACTCCCTTGGAGG - Intronic
1167102982 19:47415461-47415483 TTCCCAGAACACTTGCCAAAGGG + Intronic
1167390316 19:49190454-49190476 CTCCCACAGCACTCCCTTAGTGG - Intronic
1168239349 19:55081498-55081520 CCCCCAGACCCCTTCCTTAGCGG - Intronic
1168503405 19:56912649-56912671 TTCACTAAACACTTCTTTAGGGG + Intergenic
927980800 2:27373877-27373899 TTCCAAGGACACTTCCTCTGTGG - Exonic
928483211 2:31704634-31704656 TTCCCAGAACACTGCAGTTGTGG + Intergenic
936516179 2:113182908-113182930 TGCCCAGAACACTACCTGTGTGG - Exonic
938248662 2:129797466-129797488 TTCCCAGAGCACACCCTTGGGGG + Intergenic
939021733 2:136965477-136965499 TACCCAGAACACTTTCCTTGTGG - Intronic
942079968 2:172390900-172390922 TTCCCAGAACATTTCCAAACAGG - Intergenic
942798121 2:179845234-179845256 TTCCCAGTTCAATTCTTTAGTGG + Intronic
942965025 2:181881887-181881909 TTCTCAGAAGACTTCCTCAAAGG - Intergenic
944110646 2:196128449-196128471 TACCCAGAGCCCTTCCTTAGAGG + Intergenic
944302315 2:198137928-198137950 TTCCCAGAACACAGCCTAGGGGG - Intronic
944612424 2:201425025-201425047 TTCCAATAAAACTTCCTTTGTGG - Intronic
945281094 2:208036336-208036358 TTGCCAGAACAGGTCCTTAATGG + Intergenic
946320315 2:218950191-218950213 TTCCAAGGACCCTTCCTTAAAGG - Intergenic
947297107 2:228643454-228643476 TTCCCCCAACACTTCTTCAGAGG + Intergenic
947370174 2:229437669-229437691 TTCCCACAAGACTGGCTTAGTGG - Intronic
948525997 2:238571180-238571202 TTCCCACATCACTGCTTTAGTGG + Intergenic
1168867889 20:1104849-1104871 CTCCCAGAGCCCTTCCTTAGTGG + Intergenic
1168888037 20:1273980-1274002 TTCACCGATCACTTCTTTAGAGG - Intronic
1169029282 20:2395467-2395489 TTTCCAAAAGACATCCTTAGAGG + Intronic
1170718113 20:18849426-18849448 TCCCAAGAATACTTCCTAAGAGG + Intergenic
1172120674 20:32596954-32596976 TTCCCAGAACCTTCCCTCAGAGG + Intronic
1172860345 20:38044774-38044796 TTCCCAGACCACTTCCCTAAGGG + Intronic
1173440368 20:43070078-43070100 GGCCCAGAATACTTCCTTTGTGG + Intronic
1176810663 21:13534879-13534901 TTCCCAGCACAGTGCCTTTGTGG + Intergenic
1178595705 21:33950496-33950518 TTCACAGAACACCTCTTTGGCGG - Intergenic
1180664727 22:17501299-17501321 TTCCCAGAAATATTTCTTAGTGG - Intronic
1181515474 22:23409099-23409121 TTCCCACAACAGTTCATCAGTGG - Intergenic
1182933306 22:34195452-34195474 GTCCCAGAGCACTTACTTGGTGG + Intergenic
1183523959 22:38313036-38313058 TTCCCTGACCACTTCCTTGCAGG - Intronic
950942506 3:16907556-16907578 TCCCCAGAGCACTCCATTAGGGG + Intronic
951531480 3:23702302-23702324 TTTCCTTAACACTTCCTTACAGG - Intergenic
953197665 3:40749874-40749896 TTCCCAGAGCAATTCTTTGGAGG + Intergenic
953370160 3:42380781-42380803 TTCCCACCACACTTCCATGGGGG + Intergenic
956060010 3:65339892-65339914 TTCCCAGGACCCCTCCTTTGTGG + Intergenic
956093686 3:65694017-65694039 AGCCCAGAACACTTTCTTAACGG + Intronic
960039101 3:113131296-113131318 TTCCCAGCATACATCCTTTGGGG + Intergenic
961603887 3:128079403-128079425 TTCCAAGACCACTTCCACAGAGG - Intronic
966389632 3:179438409-179438431 TTCCCAAAACAATCCCATAGGGG - Intronic
971236312 4:24845282-24845304 TTCCCACCACACTTCCTTCAGGG + Intronic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
972295003 4:37729154-37729176 TTTGCTGAACATTTCCTTAGAGG - Intergenic
983515167 4:168648022-168648044 GTCCCAGAGAACTACCTTAGTGG - Intronic
985137612 4:186802851-186802873 TTCGCAGAAAACTTTCTCAGGGG + Intergenic
987057388 5:14207134-14207156 TACCCAGACCATTTCCTTAAAGG - Intronic
988713641 5:33803251-33803273 TTCCCACCACACTTCTTTTGGGG - Intronic
992069583 5:73136561-73136583 CTCCCAGGACATTTCCTTAAAGG + Intergenic
995155270 5:108903879-108903901 GTCCCAGTTCTCTTCCTTAGAGG + Intronic
995378098 5:111500726-111500748 TTACTAGAACCCTTTCTTAGAGG + Intronic
996033886 5:118736797-118736819 TTCCAAGGACACTTGTTTAGTGG - Intergenic
999397743 5:151240920-151240942 TCCCCAGACACCTTCCTTAGGGG + Intronic
1002839915 6:896624-896646 TACCCACAACACCTCCTTACAGG - Intergenic
1003439968 6:6131401-6131423 TTCCCAGAAAACTACTTCAGGGG + Intergenic
1003734532 6:8863717-8863739 TTCTCAGAACCCTACCTTAAAGG + Intergenic
1003808129 6:9749576-9749598 TGCCCAGAAGATTGCCTTAGAGG - Intronic
1004608708 6:17218466-17218488 GTCCAAGGACACTTCCTGAGTGG + Intergenic
1008058888 6:46975716-46975738 TTTCCAGGACACTTGCTTCGAGG - Intergenic
1010606374 6:77893623-77893645 TTCAAATAACACTTCCTTAGTGG - Intronic
1012191639 6:96287304-96287326 TTCCTAGAACATTACCCTAGAGG + Intergenic
1012999616 6:106009107-106009129 TCCCTAGAACACTTGCGTAGGGG + Intergenic
1014616982 6:123614718-123614740 TTCCCAGACCATTGCCTTAAAGG - Intronic
1016041611 6:139437583-139437605 TTTCCAGAAGACTTGCTTAAGGG - Intergenic
1018866570 6:167751139-167751161 TTCCCAAAGCACTTCCTGAAAGG - Intergenic
1019125423 6:169837511-169837533 TTCCCACTACACATCCTAAGAGG - Intergenic
1023281937 7:38579708-38579730 CTCCCAGAATAATTCCTTAGAGG + Intronic
1026670211 7:72383651-72383673 TTCCCAGAACACTTCCTTAGAGG - Intronic
1027266047 7:76495808-76495830 TTCCCTGAACACTGCCTGACGGG - Intronic
1027317420 7:76993925-76993947 TTCCCTGAACACTGCCTGACGGG - Intergenic
1027431164 7:78114200-78114222 TGCCCTGAAGACTTGCTTAGAGG - Intronic
1028420698 7:90629510-90629532 TTTCCAAAACACTCCATTAGAGG - Intronic
1033996544 7:147356618-147356640 TTCCCATAAAACTTCAATAGTGG - Intronic
1034479879 7:151311416-151311438 TTCCCAGGACAGTGCCCTAGTGG + Intergenic
1035682234 8:1496447-1496469 TTCCCAGAACCGGTCCTCAGAGG - Intergenic
1039865063 8:41493518-41493540 TTGCCAGAACAATTCCTTAAAGG + Intronic
1044089077 8:87977096-87977118 TTCCCATTACACTCTCTTAGAGG - Intergenic
1045264074 8:100604180-100604202 TTCCCTGAACACTGGCTGAGAGG + Intronic
1046490618 8:114948272-114948294 TTCTCAGCACTTTTCCTTAGAGG + Intergenic
1047085119 8:121507311-121507333 TTCCTAGAACTCCTCCTTAGGGG + Intergenic
1050489544 9:6173372-6173394 TTCCCATAACAGATCCTGAGAGG + Intergenic
1051589748 9:18765567-18765589 TACCCTGACCACTTCCTTACTGG + Intronic
1051633266 9:19159336-19159358 CTCCCAGAACAGTTTCTTAATGG + Intergenic
1053099892 9:35362968-35362990 TTCCCAGAACTATGCCTTGGAGG + Intronic
1057153521 9:92817535-92817557 TTCACAGCTCATTTCCTTAGTGG + Intergenic
1057682401 9:97201326-97201348 TTCACAGCTCATTTCCTTAGTGG - Intergenic
1058637190 9:107048311-107048333 TGCCCAAAGCACTTCCTGAGGGG + Intergenic
1061243011 9:129385172-129385194 TTCCCAGGACACTCCCTTTTGGG - Intergenic
1061676392 9:132218438-132218460 TACCCAGGAGACTTCCTTTGAGG + Intronic
1061751417 9:132780105-132780127 TTCCCAGATCACGTCCATTGAGG - Intronic
1186115373 X:6299955-6299977 TTCCCAGACCACCGCGTTAGGGG + Intergenic
1186744217 X:12549255-12549277 TTCCCAGAACTCTTCTTTCCTGG + Intronic
1187098757 X:16171029-16171051 TTCCCACATCTCTTCCTCAGTGG - Exonic
1188844809 X:35059587-35059609 TTCCCAGATCTCCTCCTCAGAGG - Intergenic
1188899428 X:35711549-35711571 TTCCCAGATCTCTTCCTCAAAGG - Intergenic
1192017360 X:67346108-67346130 CTCCCAGATCACTTCCTCTGGGG - Intergenic
1196764669 X:119232100-119232122 ATCTCTGAACACTTCCCTAGGGG + Intergenic
1197980145 X:132209606-132209628 TGGCTAGAACACTTCCTTGGTGG + Intronic
1198002629 X:132454628-132454650 TTCCCAGAAAACTCCCTTCAAGG - Intronic
1198870056 X:141168850-141168872 TTCCAGGAACACTGCCATAGAGG + Intergenic
1198959899 X:142173235-142173257 TTCCCAGATGACCTCCTCAGGGG + Intergenic
1198963078 X:142203235-142203257 TTCCCAGATGACCTCCTCAGAGG + Exonic
1199529226 X:148828351-148828373 TTTGCAGAACACTTTCTCAGTGG + Intronic
1199896811 X:152134877-152134899 TTCCCAGATGACCTCCTCAGGGG + Exonic