ID: 1026670346

View in Genome Browser
Species Human (GRCh38)
Location 7:72385266-72385288
Sequence TATCACATGATTCAGCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026670346 Original CRISPR TATCACATGATTCAGCAAAC AGG Intronic
902829638 1:19003730-19003752 TATCACAGGACTCAGGGAACTGG - Intergenic
906131050 1:43456807-43456829 TATCACAAAATTCAGCATAATGG + Intergenic
908976014 1:69899490-69899512 TAACTCAGGATTCAGCAAATTGG + Intronic
910562177 1:88602103-88602125 TGTCACATGATAAAGCAAAAAGG - Intergenic
911958577 1:104269912-104269934 TATCACATGACTCAGCAATTTGG - Intergenic
913037614 1:114987179-114987201 TAGCACATGTTTAAGCAAAGAGG + Intronic
913139754 1:115929114-115929136 TATCACATAATTCTTCAAAGCGG + Intergenic
916330334 1:163609209-163609231 TATCACTTTCTTGAGCAAACAGG + Intergenic
918942294 1:191016212-191016234 TTTCAGATGATTCTGCATACAGG - Intergenic
920869498 1:209782363-209782385 TATCACATATTTAAGCATACTGG + Exonic
924277830 1:242405947-242405969 TTTCACATGATTGAGCAAAATGG + Intronic
1064909994 10:20390376-20390398 TATCAACAGATGCAGCAAACTGG + Intergenic
1072329595 10:94334545-94334567 TATAAAATAATTAAGCAAACTGG + Intronic
1072339443 10:94432463-94432485 TATAACATAATACAGCAAAATGG - Intronic
1073074779 10:100817030-100817052 TATCAGAAGACTCTGCAAACAGG + Intronic
1079113511 11:17622867-17622889 TACCATATGATCCAGCAATCTGG - Intronic
1080980972 11:37405181-37405203 TATCTCATCTTTCAGCAAAGAGG - Intergenic
1085960922 11:81460890-81460912 TATCAAACGATTCAGTAAAAGGG - Intergenic
1088516004 11:110634603-110634625 TATCACATTACTTAGCAAAAAGG - Intronic
1089801112 11:121028433-121028455 AATATCATAATTCAGCAAACTGG + Intronic
1090264545 11:125345866-125345888 GATTACATGATTTAGTAAACAGG + Intronic
1092631638 12:10385208-10385230 TACCATATGACTCAGCAATCTGG + Intronic
1092968353 12:13667580-13667602 TATAACATGCTTCTTCAAACTGG - Intronic
1095286113 12:40412596-40412618 TATCATATCACTCAACAAACTGG - Intronic
1095844116 12:46727830-46727852 TGTCACATGATAAAGGAAACAGG + Intergenic
1099417384 12:82408278-82408300 TGTCATATGAATCCGCAAACTGG - Intronic
1099975767 12:89544174-89544196 TAACACATGGTTCAGGAAGCTGG - Intergenic
1099988193 12:89693872-89693894 TTTTACATGGTTCAGGAAACTGG + Intronic
1100445510 12:94656369-94656391 TAGCTCATGATTCTGCAATCTGG + Intergenic
1102534086 12:113568054-113568076 TATCACAGGAGTCTGCAAAGTGG + Intergenic
1105387280 13:19942959-19942981 CATCACATTATACTGCAAACCGG + Intergenic
1106433058 13:29700125-29700147 GATCATATTATTAAGCAAACAGG - Intergenic
1107998620 13:45886616-45886638 TAGCTCATGGTTCTGCAAACTGG + Intergenic
1112625637 13:101100452-101100474 TATCACATGCTTAAGCAAAAAGG + Intronic
1112628813 13:101138401-101138423 TATCATATGCTTCAGCAGAAAGG + Intronic
1114564523 14:23620377-23620399 ACTCACATGATTGAGCAAATAGG + Intergenic
1116469877 14:45274776-45274798 TATCCCATTGTTCATCAAACTGG + Intergenic
1119023791 14:71136877-71136899 TGTCACCTGATTCAGGACACTGG - Intergenic
1124864850 15:33479088-33479110 TATTCCATCATTCTGCAAACAGG - Intronic
1127200313 15:56639809-56639831 TAATTCATGGTTCAGCAAACAGG + Intronic
1130747308 15:86669130-86669152 TATAAAATAATTGAGCAAACAGG + Intronic
1134766095 16:16759267-16759289 TAGCACATGATTCTGCAGGCTGG - Intergenic
1134979951 16:18599947-18599969 TAGCACATGATTCTGCAGGCTGG + Intergenic
1138979115 16:62244746-62244768 TATCAAATGATAAAGCAAAACGG - Intergenic
1140270414 16:73460259-73460281 TCTCACATGATTCATCTAAGTGG + Intergenic
1143666261 17:8363079-8363101 GATGACATGATTTAGCAAATTGG + Intergenic
1144526615 17:15995881-15995903 TATCAGAAGATTCAGAACACTGG + Intronic
1144994342 17:19256841-19256863 AATCACATTATACAGCAAATAGG - Intronic
1146853719 17:36246470-36246492 TACCATACGATTCAGCAATCAGG - Intronic
1146869626 17:36370362-36370384 TACCATACGATTCAGCAATCAGG - Intronic
1147072503 17:37970986-37971008 TACCATACGATTCAGCAATCAGG - Intergenic
1147084026 17:38050523-38050545 TACCATACGATTCAGCAATCAGG - Intronic
1149070150 17:52531682-52531704 AATCACATCATTTAGCAAAAAGG + Intergenic
1149230228 17:54525166-54525188 GGTCACTTGACTCAGCAAACTGG - Intergenic
1150082977 17:62257780-62257802 TACCATACGATTCAGCAATCAGG - Intergenic
1153466284 18:5391269-5391291 TATTACATGAGTCAGAAACCTGG - Intergenic
1154937654 18:21077433-21077455 TTTCACATAATTCAGAACACAGG + Intronic
1157579788 18:48766964-48766986 TATCACATGTTTTAGGAAAAGGG + Intronic
1159355901 18:67337298-67337320 GGCCACATGCTTCAGCAAACAGG + Intergenic
1160052657 18:75450254-75450276 TATCTCCTGATACAGCACACTGG + Intergenic
1160385579 18:78494372-78494394 CATCACATGACTCAGCGAGCCGG + Intergenic
1160888843 19:1366212-1366234 CATCACATGATACATCTAACAGG - Intronic
1164098027 19:22029340-22029362 TATCACAGGGTCCAGCACACAGG - Intergenic
1164117952 19:22240232-22240254 TATCACAGGGTCCAGCACACAGG - Intergenic
1164128984 19:22344834-22344856 TATTACAGGAACCAGCAAACAGG + Intergenic
1164200983 19:23018380-23018402 TATCACAGGGTCCAGCACACAGG - Intergenic
1164293172 19:23885772-23885794 TTTCCAATGATTCAGCAAGCTGG + Intergenic
925199321 2:1953299-1953321 TCTCACATGCTACAGCAAAGGGG - Intronic
932872154 2:75412770-75412792 TATTACATTATACAGCAAAGGGG - Intergenic
938031483 2:127998220-127998242 GATCACATCATTCAGAAAATAGG - Intronic
939447496 2:142329035-142329057 AATGAAATGATTCAGCACACAGG + Intergenic
940352062 2:152701889-152701911 TCTCACATGCTGCAGCAACCAGG + Intronic
940854455 2:158718932-158718954 TAGCCCATGATTCAGCAATCAGG + Intergenic
942914650 2:181290391-181290413 TATCACATGATTGAACTAACTGG + Intergenic
944953582 2:204781003-204781025 TATCACATCATTCAGAGAACAGG + Intronic
947953321 2:234166428-234166450 TTTCTCATGATTCTGCAATCTGG + Intergenic
948251484 2:236533578-236533600 CATCACATGCTTCTGCCAACTGG + Intergenic
1169113866 20:3050084-3050106 CATCACATGACTCTGCAACCTGG - Intergenic
1169280056 20:4259395-4259417 TCTAACAAGATTCAGCAACCTGG + Intergenic
1169622444 20:7523000-7523022 CATCACCTTATTCAGCAAAGTGG + Intergenic
1174028574 20:47601079-47601101 TAGCACATGATTCTGGAAGCTGG + Intronic
1177335063 21:19713157-19713179 TATCAAATGATTTAGCATATTGG + Intergenic
1184429975 22:44436994-44437016 TGTTACATGACTCTGCAAACTGG + Intergenic
949716611 3:6939269-6939291 TACCACATGACTCACAAAACTGG - Intronic
950653897 3:14424813-14424835 AACCACGTGAGTCAGCAAACTGG - Intronic
952552421 3:34494542-34494564 TATCTCAACCTTCAGCAAACTGG + Intergenic
954065859 3:48105408-48105430 TAGCACATAATTAAGCAAATGGG - Intergenic
954781637 3:53066309-53066331 TATCACATGACCCAGCACAAAGG - Intronic
957192811 3:77031835-77031857 TATAACATGATACCACAAACTGG + Intronic
965670001 3:171137836-171137858 AATCACATTATTCAACAAAAAGG + Intronic
966305677 3:178531410-178531432 TACCATATGATCCAGCAAACAGG - Intronic
966478997 3:180383845-180383867 TACCACATGACTCATTAAACAGG + Intergenic
967431996 3:189396661-189396683 TTTCAGATAATTCAGCAAAAAGG + Intergenic
974755597 4:66203157-66203179 TATCATATAATGCAGCAAAAAGG - Intergenic
980348030 4:131649305-131649327 TGATACATGATTCAGTAAACTGG - Intergenic
982020669 4:151200767-151200789 TATCATCTGAATCAGCAAAGAGG + Intronic
982342835 4:154321444-154321466 TTTCACACAATACAGCAAACTGG - Intronic
993876382 5:93312000-93312022 AACCCCATGATTCTGCAAACTGG + Intergenic
998754984 5:145367956-145367978 TATCATATGATTAAGCAATGTGG - Intergenic
998932489 5:147196682-147196704 TATCACATACTTGAGCAAATAGG - Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1004735196 6:18398818-18398840 TAACATATGATCCAGCAATCGGG - Intronic
1005359166 6:25014502-25014524 TTGCACATGATTCTGGAAACAGG + Intronic
1008830297 6:55751278-55751300 TATCCAATAATTCAGTAAACAGG + Intergenic
1013861965 6:114646603-114646625 TTTCACATCATTCAGAAAACTGG - Intergenic
1016051360 6:139533759-139533781 TATGTCATGATTCAGCATAAGGG - Intergenic
1016147045 6:140690576-140690598 TGTCACATGATAAAGCAAAAAGG + Intergenic
1016302428 6:142647165-142647187 TAAGACATGATTCACAAAACTGG - Intergenic
1017757408 6:157541308-157541330 TATCACTTGTCTCAGCAAAGGGG + Intronic
1018231060 6:161676001-161676023 GGTCACATAATTCAGGAAACTGG - Intronic
1021544403 7:21796959-21796981 GATCACATGTTTCAGTAAAATGG + Intronic
1025780102 7:64594007-64594029 TATCACAAAATTGAGCAAAACGG + Intergenic
1026670346 7:72385266-72385288 TATCACATGATTCAGCAAACAGG + Intronic
1028213370 7:88102104-88102126 TATCACATAATTCACTAAAAAGG + Intronic
1032372065 7:131366251-131366273 TATCATATGATTCAACAAAAAGG + Intronic
1033507109 7:142015249-142015271 AATCACATGAATGAACAAACGGG - Intronic
1039100194 8:33933139-33933161 TACCATATGATCCAGCAAAAAGG + Intergenic
1039771924 8:40695821-40695843 TATCACATCAATTAGCAAATGGG - Intronic
1041998413 8:64091309-64091331 TTTCACATGATTGTGTAAACTGG - Intergenic
1042456838 8:69015008-69015030 AATCACATGATGCATCCAACTGG - Intergenic
1043362079 8:79485284-79485306 CATCTCATGATTCTGAAAACTGG + Intergenic
1043979395 8:86620535-86620557 AATCACCTGTTTCAGTAAACAGG + Intronic
1044632862 8:94296279-94296301 TATCACATGATAAAGGAAAAAGG + Intergenic
1047954453 8:129962760-129962782 TAACAGATGAATGAGCAAACAGG - Intronic
1048008022 8:130434821-130434843 TATCACATGAGACAGGAAGCAGG + Intronic
1052368933 9:27642968-27642990 TGTCACATGATAAAGTAAACAGG - Intergenic
1057320333 9:94006756-94006778 TGCCAAATGATTCAGCAGACAGG + Intergenic
1058737402 9:107906497-107906519 TAAGACATGATTCAGCACATGGG - Intergenic
1060149403 9:121278610-121278632 TAGGATGTGATTCAGCAAACAGG + Intronic
1061839777 9:133351839-133351861 TAGCACATGATCCAGCATAAAGG + Exonic
1186542015 X:10410503-10410525 TATCAGAAGATTCAGCATATTGG - Intergenic
1189996653 X:46645732-46645754 TAAAACGTGATTCAGAAAACAGG + Intronic
1190901144 X:54674065-54674087 TAGAACATGATTCAGAAATCAGG - Intergenic
1192506618 X:71689508-71689530 TAGCTCATGTTTCAGCAAGCTGG + Intergenic
1192513321 X:71739544-71739566 TAGCTCATGGTTCAGCAAGCTGG - Intergenic
1192513376 X:71741969-71741991 TAGCTCATGGTTCAGCAAGCTGG + Intergenic
1192520079 X:71792038-71792060 TAGCTCATGTTTCAGCAAGCTGG - Intergenic
1192526103 X:71846017-71846039 TAGCTCATGATTCAGCAAGCTGG + Intergenic
1194923832 X:99799235-99799257 AGTCATATGATTTAGCAAACCGG - Intergenic
1196487052 X:116224108-116224130 TATCCCATGACTCAGTAAATGGG - Intergenic
1196534856 X:116831735-116831757 TATTACATGCTTCAGTACACAGG + Intergenic
1197087839 X:122500119-122500141 TAGCACGTGCTTCAACAAACTGG - Intergenic
1198087832 X:133297046-133297068 TATCACATGTGTCAGCCACCAGG + Intergenic
1198456389 X:136821903-136821925 TGACACAGGATTCAGCACACTGG + Intergenic
1198552144 X:137756372-137756394 TATCAAATTAATCTGCAAACTGG - Intergenic
1199151664 X:144494259-144494281 TATCACATGATTGAAAACACTGG - Intergenic
1199323328 X:146467441-146467463 TATCAAATGAGTTAGCAACCAGG + Intergenic
1199462411 X:148099192-148099214 TGTCACATGAATCAGCAACATGG + Intergenic
1202080331 Y:21077649-21077671 TATCACAGGATGCAGCATCCAGG + Intergenic